ID: 921521064

View in Genome Browser
Species Human (GRCh38)
Location 1:216154652-216154674
Sequence TTGCCTAGGCCTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 1, 2: 11, 3: 56, 4: 423}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921521064 Original CRISPR TTGCCTAGGCCTGAGGAGGA GGG (reversed) Intronic
900437821 1:2639891-2639913 TGGGTGAGGCCTGAGGAGGAGGG + Intronic
901128415 1:6945670-6945692 TTGCCTAGGCCCGGGGAGACAGG - Intronic
901475959 1:9489489-9489511 TTGCCCAGGGCTGGGGAGGTGGG - Intergenic
901524160 1:9808960-9808982 TTGCTTAGGCCTGAAGGAGAAGG - Intronic
902562603 1:17287025-17287047 TTGACCAGGCCTGAGGATAAGGG + Intergenic
903076058 1:20767454-20767476 TTCCCTAGGCCTTAGCAGAAAGG + Intronic
903150738 1:21406229-21406251 TTGCCTAGGGCTGAGGGGGTGGG - Intergenic
903339280 1:22643918-22643940 CTCCCGAGGGCTGAGGAGGACGG + Intronic
903424600 1:23244557-23244579 ATGCGTGGGCCTGAGTAGGAGGG + Intergenic
903753919 1:25647535-25647557 TTGCCTTGGCCTCAGGAGAGGGG - Intronic
903760805 1:25697195-25697217 TTGCCTAGGGCTGGGGAAGGGGG - Intronic
903844529 1:26270317-26270339 ATCCCTAGGGCTGAGGAGAAAGG - Intronic
904092658 1:27956093-27956115 CTGCGGAGGCCAGAGGAGGAGGG + Intronic
904320004 1:29690382-29690404 TTGCTGAGGCCAGAGGAAGAGGG + Intergenic
904425306 1:30418995-30419017 TGGCCTAGGCCTGCAGAGGTAGG - Intergenic
904881371 1:33699836-33699858 TTGCCTAGGGCTGAGGGAGTTGG - Intronic
905624440 1:39478315-39478337 TTGTTGAGGCTTGAGGAGGAAGG + Intronic
905813171 1:40927930-40927952 TTGCCAAGGCCTTGGGAGGAGGG + Intergenic
905983939 1:42259227-42259249 TTGCAAAGGCCTGGGGATGAGGG + Intronic
906334546 1:44917451-44917473 TTGCCTAGGCTTGAGTATAATGG - Intronic
906712991 1:47945582-47945604 TTGTCAGGGACTGAGGAGGAGGG - Intronic
906743796 1:48207619-48207641 GTGAGTAGGTCTGAGGAGGATGG - Intergenic
907793268 1:57689309-57689331 GTGCCCAGGCCTGTGGAAGAAGG + Intronic
908634593 1:66148668-66148690 TTGCCTAGGGCTAAGGATGGTGG - Intronic
910547059 1:88430394-88430416 TTGCCAAGGGCTGAGGGAGAGGG + Intergenic
910993098 1:93076337-93076359 TTGCCTAGGGCTTGGAAGGAGGG + Intergenic
911024850 1:93426025-93426047 TTGCCTATGGCTGAGGAGAATGG + Intergenic
911238630 1:95439877-95439899 CTGCCTAGGTCTGAGGAAGATGG - Intergenic
912353201 1:109034246-109034268 TTGCCTAGGCCAGAGGGCAATGG - Intronic
912460170 1:109825197-109825219 TTGCCTAGGCTGGAGGACAATGG + Intergenic
912468867 1:109892902-109892924 TTGCCGAGGCCTGAGGAGAGAGG - Intergenic
912756582 1:112329537-112329559 TTTCCTAGGCCTGGGGAGACTGG - Intergenic
913178956 1:116300931-116300953 TTGCCTAGGGCTGAGGAGGTTGG - Intergenic
914224668 1:145710306-145710328 TTGCCAGGGGCTGGGGAGGAAGG - Intergenic
916356207 1:163911326-163911348 TTGCCTAGGGCTGGGGGTGAGGG + Intergenic
916879532 1:169006401-169006423 TTGCCTAGGCCTGAGGGTTGGGG - Intergenic
916899857 1:169209733-169209755 TTGCTTAGGCCAGAGTATGAAGG - Intronic
917118499 1:171625599-171625621 TTGCCCAGCCCTGAGGAGGATGG + Intergenic
917803631 1:178593966-178593988 CTGCCAAGGCCTGAGGATGGGGG + Intergenic
918206072 1:182310510-182310532 CTGCCTAGGGCTGAGGGGAATGG - Intergenic
918703320 1:187632148-187632170 CTGCCTTGGCCTAAGGGGGAGGG - Intergenic
919166555 1:193902377-193902399 CTGCCTAGGACTGAGTAGGATGG + Intergenic
920197917 1:204241805-204241827 TTGCCTTGGGCTGGGGAGAAAGG + Exonic
920836026 1:209511849-209511871 TTGCCTAGGGCTGGGGAGTGAGG + Intergenic
921521064 1:216154652-216154674 TTGCCTAGGCCTGAGGAGGAGGG - Intronic
921550309 1:216527356-216527378 TTGACTAGCCCTGGGTAGGATGG - Intronic
923020548 1:230160019-230160041 TGGCCTAGGAGTGGGGAGGAGGG - Intronic
923226748 1:231944686-231944708 TTTCCTAGGCCTGAGGGTGCAGG - Intronic
923374603 1:233348152-233348174 TTGCCTAGGGCTGAGAGGGAAGG - Intronic
923454994 1:234156943-234156965 TTGCCTAGGGTTGAGGAGGGTGG + Intronic
1063097851 10:2923798-2923820 TTTCCCAGGGCTGAGAAGGAAGG + Intergenic
1063686262 10:8239811-8239833 TGGCCTAGAACTGAGGAGGAAGG + Intergenic
1063766422 10:9146513-9146535 TTGCCTGGGGCTGAGGGGGGTGG - Intergenic
1063833747 10:9987387-9987409 TTGGCTTGGCCTGAGGAGCTCGG + Intergenic
1064130739 10:12707515-12707537 TGGCCAAAGCCTGCGGAGGAAGG + Intronic
1064741858 10:18442187-18442209 TTGCCTAGGCTGGAGGACAATGG + Intronic
1064859419 10:19811341-19811363 TTGCCAGGGGCTGAGGAGAAAGG + Intergenic
1065093928 10:22262658-22262680 GGGCCCAGGCCTGGGGAGGAAGG + Intergenic
1065242404 10:23720003-23720025 TTGCCAGGGCCTGGGGAGAAGGG + Intronic
1066421314 10:35267266-35267288 TTGCCCAGGCTGGAGTAGGATGG - Intronic
1066505823 10:36041696-36041718 TTGCCTAGGGCTTGGGAGAATGG - Intergenic
1067089914 10:43261324-43261346 ACACCTAGGCCAGAGGAGGAAGG + Intronic
1067411379 10:46067670-46067692 TTGCCTAGGGCTGGGGAGGATGG + Intergenic
1067455297 10:46414882-46414904 TTGCCTAGGCTGGAGTAGGGTGG - Intergenic
1067631907 10:47969753-47969775 TTGCCTAGGCTGGAGTAGGGTGG + Intergenic
1067728657 10:48792858-48792880 TTGCCTAGTCCTGGGGATGGTGG + Intronic
1067947782 10:50701304-50701326 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1068121947 10:52789776-52789798 TTGCCAAGGGCTGAGGAGGAGGG - Intergenic
1068857392 10:61811508-61811530 TTGCCTAGGACTAAGGGGGCAGG + Intergenic
1070169620 10:73922903-73922925 TTGCCTAGGGCTGAGGGGGTTGG - Intergenic
1070516880 10:77216163-77216185 TTGCCTAGGGCTGAGAAGACTGG + Intronic
1070552435 10:77501405-77501427 GTGCATGTGCCTGAGGAGGATGG + Intronic
1070691283 10:78528394-78528416 TTGCCCAGGCCTTAAAAGGAAGG - Intergenic
1070712670 10:78694046-78694068 CTGGCAGGGCCTGAGGAGGAAGG + Intergenic
1070883099 10:79866297-79866319 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1071107363 10:82113989-82114011 TTGCCTAGAGCTGGGGAGTAGGG - Intronic
1071300884 10:84255269-84255291 TCGCCAAGGCCTGGGGAGCAAGG + Intronic
1071649667 10:87382612-87382634 GTGCGTAGGCATGGGGAGGAGGG + Intergenic
1071667171 10:87570190-87570212 TTGCAAAGGCTTGAAGAGGAGGG + Intergenic
1071719148 10:88125417-88125439 TTGTTTAGGGCTGAGGAGGACGG + Intergenic
1072510994 10:96124652-96124674 TTGCTTCAGCCTGAGGGGGAGGG + Intergenic
1073257871 10:102166288-102166310 TTGCCAAGGGCTGGGGAGGAGGG - Intergenic
1074057081 10:109932254-109932276 TTGCCTGTGACTGGGGAGGATGG - Intergenic
1074165068 10:110867799-110867821 CTGCTTAAGCCTGAGGAGTACGG + Intergenic
1074462274 10:113648652-113648674 TCGCCAGGGCATGAGGAGGAGGG - Intronic
1074548445 10:114420566-114420588 TTGCTTAAGGCTGAGGGGGATGG - Intergenic
1075034881 10:119056330-119056352 TTGCCTAGGGCTGGGGTGGTGGG + Intronic
1075827464 10:125371280-125371302 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
1076728168 10:132423036-132423058 CTGCTTAGGCCTGGGGAGGAGGG - Intergenic
1077381799 11:2246816-2246838 TTACCTAAGGCTGGGGAGGAGGG + Intergenic
1077447359 11:2603540-2603562 TTGCCTAGGGCTGAGGGGGATGG - Intronic
1078471285 11:11588920-11588942 TTGCCCAGGCCTGATGAAGCAGG + Intronic
1078918786 11:15807248-15807270 TTGCCTGTGGCTGTGGAGGAGGG - Intergenic
1079089522 11:17470906-17470928 TTCCCTGGGCCTGGTGAGGAGGG + Intronic
1079333469 11:19552011-19552033 TTCCCTTTGTCTGAGGAGGACGG + Intronic
1079878701 11:25894742-25894764 TTGCCTAGGGCTGGGGGAGAAGG - Intergenic
1079909271 11:26289052-26289074 TGGCCTAGGCCTTAGGAATATGG + Intergenic
1080125307 11:28726998-28727020 TTGACTAGGCCTGGAGAGGATGG - Intergenic
1081961527 11:47141267-47141289 TTGCCTAGGGTTGGGGAAGACGG - Intronic
1084655843 11:70517690-70517712 TTGCCAAGGGCTCAGGGGGAGGG + Intronic
1084716566 11:70878063-70878085 TTGACTTGGCCTCAGGAGCAGGG + Intronic
1085055544 11:73401474-73401496 TCTCTTAGGCCTGAGGAGAAAGG + Intronic
1086306289 11:85484245-85484267 ATGCCTAGGGAGGAGGAGGAGGG - Intronic
1087048205 11:93862058-93862080 GGGACTAGGCCTGAGGAGGGAGG + Intergenic
1087214438 11:95480202-95480224 CTGCCTAAGCCTTAGGAGAAGGG - Intergenic
1087750706 11:102003637-102003659 TTGCCTAGGCCGGAGTACAATGG - Intergenic
1088963358 11:114692845-114692867 TTGCCTAGGCTGGAGGACAATGG + Intronic
1089366471 11:117923963-117923985 TGGCCCAGGGCTGAGGAGGGAGG - Intronic
1089695362 11:120212877-120212899 TAGCTTAGGCCTGCGGAGTAAGG - Intronic
1091288103 11:134420121-134420143 CTCTCTAGGCCTGTGGAGGAAGG - Intergenic
1091402520 12:189490-189512 TGGCATAGGCCTGTCGAGGACGG + Intergenic
1091432085 12:444936-444958 TTGCCAAGGGCTGAGAAGGGGGG + Intergenic
1091908990 12:4213494-4213516 TCGCTTAGGGCTGAGGAAGATGG + Intergenic
1092808292 12:12248137-12248159 TTGCTTTAGCCTTAGGAGGAAGG - Intronic
1092923721 12:13255859-13255881 TTGCCTCGCCGGGAGGAGGAAGG + Intergenic
1094133682 12:27101577-27101599 TGGCCTAAGCCATAGGAGGATGG - Intergenic
1094183821 12:27619621-27619643 TGGCCTAAGCCATAGGAGGATGG - Intronic
1094391560 12:29956856-29956878 TTGCCTAGGGCTAGGAAGGATGG + Intergenic
1095132972 12:38565538-38565560 TAGCCTAGCCCTTAGGAAGAAGG + Intergenic
1095856807 12:46869151-46869173 TTGCCTAGACCTGTAGATGAGGG + Intergenic
1096153879 12:49331201-49331223 TTGCTGAGGCCTGAGGGGCATGG - Exonic
1096698351 12:53365542-53365564 TTGACTAAGGCTGAGGAGGGAGG - Intergenic
1097232994 12:57523252-57523274 TTCCCTCAGCTTGAGGAGGAGGG - Intronic
1097642338 12:62197296-62197318 CTGCTTAGACTTGAGGAGGATGG - Intronic
1099360845 12:81698682-81698704 TTCCCTATGCCTGTGGAAGAAGG + Intronic
1099899344 12:88688604-88688626 TTGTCTAGCCTTGAAGAGGAAGG + Intergenic
1100079364 12:90828816-90828838 TGGCCTAGAGCTGAGCAGGAAGG + Intergenic
1100144149 12:91656723-91656745 TAGCCTGGGAATGAGGAGGAGGG - Intergenic
1100390527 12:94142792-94142814 TCCCACAGGCCTGAGGAGGAGGG + Intergenic
1100478955 12:94959592-94959614 TTGCTCAGGACTGAAGAGGAGGG - Intronic
1101330108 12:103750753-103750775 TTCCCCAGGCCTGAAGAGGAGGG - Intronic
1102367266 12:112348981-112349003 TTGCCTTTGAATGAGGAGGAGGG + Intronic
1102912654 12:116729797-116729819 TTGCTTAGGACTGAGGGGCAGGG + Intronic
1103314061 12:120037838-120037860 TTGCCTACTTCTGAGAAGGATGG - Intronic
1103865549 12:124049244-124049266 GTGCCTGGGCCTCAGGAGGTGGG - Intronic
1104768677 12:131346531-131346553 TTGCCTGGCCCTGAGGCGAAGGG - Intergenic
1105209799 13:18250846-18250868 TGGCCTCTGCCTGATGAGGATGG - Intergenic
1105684194 13:22761901-22761923 TTTCCTGGGCCTGAGGGGAAGGG + Intergenic
1106192994 13:27470446-27470468 TTGCCTAGGGTTAAGGAGAAGGG + Intergenic
1106925393 13:34607846-34607868 TTGCATAGGCCTGAGAGGGGTGG - Intergenic
1108240762 13:48461173-48461195 TTGCCTTGGGCTGAGGGGGTAGG - Intronic
1108678690 13:52760924-52760946 TTGCTCAGACCTGAGCAGGAAGG - Intergenic
1110130370 13:72001572-72001594 TTGGCTAAACCTGACGAGGAAGG - Intergenic
1110544007 13:76736551-76736573 TTGCCCAAGCCTGAGAATGAGGG - Intergenic
1110945810 13:81414486-81414508 TTGCCAAGGTCTTAGGAGGAGGG + Intergenic
1111442422 13:88297388-88297410 CTGACTAGACCTGAGAAGGAGGG + Intergenic
1111502748 13:89144307-89144329 TTGCCAGGGACTGGGGAGGAGGG - Intergenic
1111513776 13:89299748-89299770 TTGCCTGGGCATGAAGCGGAGGG + Intergenic
1111571507 13:90093248-90093270 TTGCCAGGGTCTGGGGAGGAGGG + Intergenic
1112798878 13:103088685-103088707 TTTCCTAGGCCTGCGAAGGGAGG + Intergenic
1113331496 13:109332446-109332468 TAGCCTAGGCCAGAGGAGTTTGG + Intergenic
1114493980 14:23120012-23120034 CTGCCTAGGCCTGCGGTGCAAGG - Intergenic
1115337374 14:32255249-32255271 TAGCCTGGGCCTGAGGTGGCTGG - Intergenic
1116844468 14:49852555-49852577 CTGCCTAGGCCTGAGTGGGCAGG - Intronic
1118897805 14:69961068-69961090 TTGCCAAGGACTGAGGAGAGAGG - Intronic
1119008493 14:70957601-70957623 TTGTCTAGGGCTAAGGAGGATGG + Intronic
1120610839 14:86639427-86639449 TTGACTAGGGCTGAGGGTGAAGG - Intergenic
1120660048 14:87239071-87239093 CTACCTCAGCCTGAGGAGGAGGG + Intergenic
1121039949 14:90737923-90737945 TTTCCTAGGGCTGGGGAGGCTGG + Intronic
1121068905 14:90998187-90998209 TTGTTTAGGACTGGGGAGGATGG + Intronic
1121348053 14:93150651-93150673 GAGCCTAGGCCTGAGGAGACTGG + Intergenic
1122485157 14:102074419-102074441 TTGCCCAAGCTTGGGGAGGAGGG - Intergenic
1124236084 15:27990296-27990318 TTGCCTAGGGCTGTGGAGCTGGG - Intronic
1124818105 15:33017155-33017177 TTGCCAAGGCCTTGGGAGGAGGG + Intronic
1125453494 15:39833479-39833501 TTGCTTAGGGCTGAGGGCGAAGG + Intronic
1127360296 15:58239182-58239204 TTACCTAGGGCTGAGAGGGAGGG + Intronic
1128424869 15:67531737-67531759 TTGCCTAGGGCTGAAGAGGTTGG + Intergenic
1129319404 15:74765952-74765974 TTGCCTGGGGCTGGGGAGAAGGG + Intergenic
1129595065 15:76957210-76957232 TTGCCTCGGCCTGAGGATAGAGG + Intergenic
1130171374 15:81518381-81518403 CTGCAGAGGCCTGAGCAGGAAGG - Intergenic
1130652793 15:85771826-85771848 TTGTGGAGGCCTGAGTAGGATGG - Intronic
1131515486 15:93073669-93073691 TTGTCTAGGTCTGGGCAGGATGG + Intronic
1132295166 15:100729188-100729210 TTCCTGAGGCCTGAGGAGCAGGG + Intergenic
1132766903 16:1539009-1539031 TTGCTGAGGCCTGAGGTGGGGGG - Intronic
1132766921 16:1539093-1539115 TTGCTGAGGCCTGAGGTGGGGGG - Intronic
1132769136 16:1551343-1551365 TTGACTGGCCCTGGGGAGGAGGG - Intronic
1132800756 16:1751721-1751743 TTGCCTGGGGCTGGGGACGAGGG - Intronic
1133102215 16:3486391-3486413 CTGCCCCAGCCTGAGGAGGAGGG + Exonic
1133703004 16:8326494-8326516 TTGCCTAGGGGCGAGGCGGATGG + Intergenic
1137435789 16:48453435-48453457 CTGCCAAGGCCTGGGGAGTAGGG - Intergenic
1138611850 16:58131060-58131082 TTGCCTAGGCCTGTGCTGGGTGG + Intergenic
1139023640 16:62784709-62784731 TTGCCTTGGACTGAGGGGAAGGG - Intergenic
1140709211 16:77660885-77660907 TTGCCAGGGGCTGAGGGGGAGGG + Intergenic
1141176994 16:81727400-81727422 TTGCTTAGGGCTGAGGGGGATGG + Intergenic
1141212725 16:81996213-81996235 TTGGCTAGGCATGTGGAGAATGG + Exonic
1141353260 16:83318658-83318680 TTCCGTAGGCCACAGGAGGAAGG - Intronic
1141610193 16:85176904-85176926 GAGCCTGGGCCTGGGGAGGAGGG - Intronic
1141832337 16:86516809-86516831 TTGCCTGGGGCTGAGGAGCTCGG - Intergenic
1142105410 16:88299804-88299826 TTGCCTGACCCTGAGCAGGATGG + Intergenic
1142195996 16:88739570-88739592 TTGCCTCGGCCTGCAGAGCACGG - Intronic
1142484871 17:240456-240478 TTGCCAGGGCTTGGGGAGGATGG - Intronic
1143311772 17:5997837-5997859 TTGCTTAGGCCCTGGGAGGAAGG + Intronic
1143684489 17:8503241-8503263 TTGCCCAGGCCGGAGCACGATGG - Intronic
1144060427 17:11579216-11579238 ATTCATAGGCCTCAGGAGGAAGG - Intergenic
1145065051 17:19756327-19756349 TTACTTAGACCTGGGGAGGAAGG - Intergenic
1145290361 17:21540313-21540335 TTGCCTAGGAATGAGCATGAGGG + Intronic
1146770944 17:35568194-35568216 CTGCTCCGGCCTGAGGAGGATGG - Intergenic
1147552530 17:41454229-41454251 TTGCCAAAGCTTGAGGAGCAGGG + Intergenic
1147777871 17:42916038-42916060 TTGCCTAGGCTTGAGTGGGTTGG - Intergenic
1149487201 17:57051896-57051918 TTGCCTATGCCTGTGATGGAAGG + Intergenic
1149656751 17:58313643-58313665 TTACCTGGGCCTGAGGAATAGGG + Intronic
1150381248 17:64721774-64721796 TTGCCTAGGGCTGGGGAGGAAGG + Intergenic
1150775253 17:68076329-68076351 TTGCCTAGGGCTGGGGAGGAAGG - Intergenic
1151319829 17:73346166-73346188 TTGCCTAGGCTGGAGTATGATGG - Intronic
1151384437 17:73746547-73746569 CTGCCTTGGCCTGATGAGCATGG - Intergenic
1151386534 17:73758529-73758551 TTCCCCAGGCCTGAGTAGGTCGG - Intergenic
1151920782 17:77153662-77153684 TGGCCTGGGGCTGAGGAGGTGGG + Intronic
1152024545 17:77800272-77800294 TTGCCTAGGGCTGCGGAGGTGGG + Intergenic
1152080183 17:78182329-78182351 TTGCCCAGGCCGGAGTACGATGG - Intronic
1152786978 17:82253438-82253460 GCGCCTAGGCCTGTGGAGGGTGG - Intronic
1154022967 18:10681564-10681586 TTGCCATGGCCTGAGGTGGTGGG - Intronic
1155899715 18:31373865-31373887 CTGCCTGGGCCTGGGGAGGCGGG - Intergenic
1156527287 18:37778741-37778763 TTTCCTAGTCCTGAGGCGGCCGG - Intergenic
1157550497 18:48577985-48578007 TTGCCTAGGGCTGAGGAAGCTGG - Intronic
1158371483 18:56810948-56810970 TGGCCTAGGGCTGAGGTGGGTGG - Intronic
1158410989 18:57206070-57206092 TTCCCTGGGGCTGAGGAGGTTGG - Intergenic
1160491919 18:79345201-79345223 TTCCCTAGGCAGGAGAAGGATGG + Intronic
1160561026 18:79755825-79755847 TGGCCTAGGGGTGAAGAGGACGG + Exonic
1161282099 19:3451516-3451538 CTGCCTCGGCCTGAGTAGCACGG - Intronic
1161448231 19:4329701-4329723 GGGCCTAGGCCTGAGGAGTAGGG - Intronic
1162180513 19:8865742-8865764 CTCCCCAGGCCTGAGAAGGATGG - Exonic
1162184201 19:8891983-8892005 CTCCCTAGGCCTGAGAAGGATGG - Exonic
1162184593 19:8895041-8895063 CTCCCCAGGCCTGAGAAGGATGG - Exonic
1162184960 19:8897655-8897677 TTCCCCAGGTCTGAGAAGGATGG - Exonic
1162185396 19:8900804-8900826 TTCCCCAGGCCTGAGAAGAATGG - Exonic
1162186538 19:8909467-8909489 TTCCCCAGGTCTGAGAAGGATGG - Exonic
1163691194 19:18739356-18739378 TTGCCTGGGCCAGCTGAGGAAGG + Intronic
1164635654 19:29789372-29789394 TTGCCTAGGGCAGAGGAGGTGGG + Intergenic
1165133498 19:33648393-33648415 TTGCCTAGGACTGGGCAGGAAGG - Intronic
1166200660 19:41235575-41235597 TAGCCTAGTGCTGAGGAGCACGG - Intronic
1166611483 19:44203039-44203061 TTGCCTAGGGCTGAGGAGTTTGG + Intergenic
1166908973 19:46137504-46137526 TTGCCTGAGCCAGAGGATGAAGG + Intergenic
1166920924 19:46228674-46228696 TTGCCTGGCCCGGAGGAGAACGG + Intergenic
1168391448 19:56011319-56011341 TTGCCTAGGGCTGGGGTGAATGG + Intronic
926742752 2:16125989-16126011 TGGCCGAGGCCAGGGGAGGAGGG - Intergenic
927468312 2:23353141-23353163 TTGCCTAGGGCTGAGGGGTTTGG - Intergenic
928698397 2:33873473-33873495 TTGCCTAGGGCTGGGGAGGATGG - Intergenic
928945668 2:36769849-36769871 CTGCCTAGTGCTGGGGAGGAGGG - Intronic
929091397 2:38221134-38221156 TAGCTTAGGGCTGAGGGGGATGG + Intergenic
929213391 2:39384072-39384094 TTGCCCAGGCTTGAGGACAATGG - Intronic
929602274 2:43211825-43211847 CTGAGTGGGCCTGAGGAGGAAGG + Intergenic
929634720 2:43506556-43506578 TTGCCTAGGGCTGAGTGGCAGGG + Intronic
929645943 2:43627662-43627684 TTGCCTAGGGTTGAGGGGAATGG + Intergenic
930714591 2:54581314-54581336 TTGCTTAGAATTGAGGAGGAGGG + Intronic
932852298 2:75199312-75199334 TTGCCTTTCCCTGCGGAGGAAGG - Exonic
932988954 2:76763062-76763084 TCGCCTAGGATTGAGGAGGTAGG + Intronic
933697023 2:85227297-85227319 TCGCCAAGGCCTGAGGGAGAGGG - Intronic
933708960 2:85311550-85311572 TTGCCTAGGGCTGGGGGAGATGG - Intergenic
934694123 2:96386311-96386333 TTGCCTATGTATGAGGAGAAGGG - Intergenic
934733479 2:96674179-96674201 TTGCCTAGGGCTGGGGAGGTGGG - Intergenic
935016304 2:99185678-99185700 TTGCCTAGGAATTAGGAGAATGG + Intronic
935634219 2:105237529-105237551 TTGACCAGGCCTTAGGAGGACGG + Intergenic
937272637 2:120663103-120663125 TTGTCTGGGCCTGGGGAGGTGGG - Intergenic
937869842 2:126778990-126779012 TTGCCAGGACCTGGGGAGGAGGG - Intergenic
940588340 2:155686036-155686058 TTGCCTTGGCCTGGGGAGATTGG - Intergenic
941210871 2:162637274-162637296 TTGCCAGGGCCTGTGGAGTAAGG + Intronic
942075040 2:172349899-172349921 TTGCCTAGGCTGGAGTAGAATGG - Intergenic
942612776 2:177758840-177758862 TTGCCCAGGCACGAGGTGGAGGG - Intronic
943052451 2:182932434-182932456 TTGCCTAGGGCTGGGGATGGGGG + Intronic
943752795 2:191527215-191527237 TTGCCAAGGGCTGAGGGGAAGGG - Intergenic
944247844 2:197550102-197550124 TGGCCTAGAACTGAGGAGCAGGG + Intronic
945733128 2:213565747-213565769 TAGCCCAGGCCTCAGAAGGATGG + Intronic
946371807 2:219285752-219285774 CTGCCTAGTCCTGAGGGTGAGGG - Exonic
946382253 2:219357007-219357029 TTGCCTAGGGCTGAGGAGGGTGG + Intergenic
946943878 2:224799173-224799195 TTGCCTAGGGATGTGGAGGAAGG - Intronic
947250174 2:228093919-228093941 TTGCCTAGGCCTAAGGAGGATGG + Intronic
947462903 2:230318507-230318529 TTGCTTAGGAGTGAGGAGCAGGG + Intergenic
948214186 2:236216428-236216450 TTCCTTAGGCCTGGGGAAGAGGG - Intronic
948481356 2:238252448-238252470 GTCCCTACGCCTGCGGAGGATGG + Intronic
949042963 2:241857898-241857920 ATGCCAAGGCCTGGGGAGGGTGG - Intronic
1169057406 20:2634972-2634994 TGGCCTAGCCCTGAGGGGGAAGG + Intronic
1169164511 20:3410471-3410493 TTGCCTAGGGCTGGGGTGGTTGG - Intergenic
1169310932 20:4539214-4539236 TTGCCAAGGACTGTGGGGGAAGG + Intergenic
1169421397 20:5463602-5463624 TTCCCTTGGCTTGAGGAGGGAGG + Intergenic
1169733509 20:8812193-8812215 ATTCCAAGGCCTGAGGAAGAAGG - Intronic
1169825426 20:9763097-9763119 TTGCCTGGGGCTGAGGGGAAGGG + Intronic
1169943652 20:10965296-10965318 TTGCCTATGACAGAGAAGGATGG + Intergenic
1171345381 20:24461970-24461992 TTGCTGAGACCTGAGGAGCAGGG - Intergenic
1172128639 20:32640806-32640828 TTGCCTAGGTCTGGAGAGGGGGG - Intergenic
1172593925 20:36136623-36136645 TTGCCTAGGCCTGAGTACACAGG + Intronic
1172840590 20:37900979-37901001 TTGCTCAGGCCTGCAGAGGAAGG - Intergenic
1172981120 20:38942620-38942642 TTGCCTAGGGCTGGGGAGTTGGG + Intronic
1173619772 20:44428249-44428271 TTGGCCACGCCTGAGGAAGATGG + Intronic
1174884312 20:54315402-54315424 TTGCCAAGACCTGAGAAGGTTGG + Intergenic
1175999764 20:62826583-62826605 TGGCTTAGGCCAGAGCAGGAGGG + Intronic
1177726625 21:24977016-24977038 TTGCTTAGGACTGAGGATGGTGG + Intergenic
1177834317 21:26171949-26171971 GTGCCTAGGCCCGGGAAGGATGG + Intergenic
1179583910 21:42362952-42362974 TTGCCTAGGATAGAGGGGGAAGG - Intronic
1179732084 21:43373708-43373730 GGGCCCAGGCCTGAGGACGACGG - Intergenic
1179989680 21:44940586-44940608 TTGCTTAGGGCTGAGGGGGATGG - Intronic
1180766464 22:18348554-18348576 TGGCCTCTGCCTGACGAGGATGG + Intergenic
1180779851 22:18513824-18513846 TGGCCTCTGCCTGACGAGGATGG - Intergenic
1180812565 22:18771145-18771167 TGGCCTCTGCCTGACGAGGATGG - Intergenic
1181140882 22:20804018-20804040 TTCCCAAGGCCTGTGGGGGAAGG - Intronic
1181198724 22:21205393-21205415 TGGCCTCTGCCTGACGAGGATGG - Intergenic
1181401013 22:22650406-22650428 TGGCCTCTGCCTGACGAGGATGG + Intergenic
1181435837 22:22910345-22910367 ATGGCGAGGCCTGAGGAGGTTGG - Intergenic
1181702990 22:24631498-24631520 TGGCCTCTGCCTGACGAGGATGG + Intergenic
1182313614 22:29427198-29427220 GTGCCCAGGACTGATGAGGAGGG + Intergenic
1182410745 22:30183357-30183379 GTGCCTGGGCCTGGGGAGGGTGG - Intergenic
1182916904 22:34042015-34042037 TTGCCTAGGGCTGAGGGAGAAGG - Intergenic
1183251391 22:36732843-36732865 TTTCCCAGGACTGAGGAGGGTGG - Intergenic
1184774750 22:46617581-46617603 CTGCCCAGGCCTGGGGAGGAAGG - Intronic
1185030050 22:48437832-48437854 TTGCCTGACCCTGTGGAGGACGG - Intergenic
1203228081 22_KI270731v1_random:89444-89466 TGGCCTCTGCCTGACGAGGATGG + Intergenic
949437297 3:4043207-4043229 CTGCCCAGGCCTGAAGAGCATGG - Intronic
949986158 3:9542904-9542926 TTGCTTAGGGCTGAGAAGGAAGG + Intronic
950460418 3:13118638-13118660 TTGCCAAAGGCTGGGGAGGAGGG + Intergenic
950910911 3:16590842-16590864 TTGCCTAGGGCTGCACAGGATGG + Intronic
951213390 3:20000090-20000112 TTTCCAAAGCCTGAGGAGGCTGG - Intronic
953085390 3:39660665-39660687 TTGCCTAAGTCTGAGGAGTGTGG + Intergenic
953327221 3:42022680-42022702 TTGCCTAGGCCGGAGTACAATGG - Intronic
954398168 3:50303784-50303806 TTACCTAGGCTGGAGGAGGTGGG + Intronic
954880971 3:53835920-53835942 TTGGCTGGGCCTGTGGTGGAGGG - Intronic
956168936 3:66417637-66417659 TGGACTAGGTCTGAGGATGATGG - Intronic
956258441 3:67309740-67309762 TTCCCTAGGCTTCAGTAGGATGG + Intergenic
956409788 3:68967674-68967696 ATGCTGAGGCCTGGGGAGGAAGG + Intergenic
956954717 3:74323423-74323445 TTGCCTCTGCCTGAGGGTGAAGG + Intronic
957175840 3:76808403-76808425 TTACCTGGGACAGAGGAGGAAGG - Intronic
958779811 3:98526838-98526860 TTGCCTAGGCTTGAGGTATAGGG - Intronic
959538868 3:107518032-107518054 TTGCATTGGCTTGAGGAGAAAGG + Intergenic
959870884 3:111326332-111326354 TTGCTTAGGGCTGCGGGGGAGGG - Intronic
961544861 3:127625737-127625759 TTGCCTAGGGCTGGTGGGGAAGG - Intergenic
962292897 3:134151980-134152002 TTGCCTAGAGCTGAGGGTGAGGG + Intronic
962743432 3:138380280-138380302 TTGCCAAGGACTGAGGAGAGGGG - Intronic
963461595 3:145620905-145620927 TTGCCTAGGGATGGAGAGGAGGG + Intergenic
965544575 3:169902658-169902680 TTGCCTAGGCCTGGGGGTCAAGG - Intergenic
965689992 3:171345604-171345626 TAGCCTAGGCTTGAGGGTGAGGG - Intronic
965842524 3:172923114-172923136 TTGCATGGGCCTGATGATGAGGG + Intronic
967294206 3:187949501-187949523 TAGCCTAGGACTCAGGAGGGAGG + Intergenic
968007022 3:195250015-195250037 TTGACTGGGTCAGAGGAGGAGGG - Intronic
968226406 3:196975071-196975093 TTGACTCCGGCTGAGGAGGAAGG + Intergenic
968259266 3:197306599-197306621 TTGCCTAGGGTTGAGGAGCATGG + Intergenic
968299951 3:197604890-197604912 ATGCCTACCCCTGAGGAGGTAGG + Intergenic
969078214 4:4597587-4597609 TTGCCTGGGGCAGAGGGGGATGG + Intergenic
969565962 4:7978285-7978307 TTGGCTGAGCCTGAGGAGGAAGG + Intronic
969939845 4:10721145-10721167 TTGCCAGGGACTGAGGAGGGAGG + Intergenic
971263612 4:25078522-25078544 AAGCCTGGGCCTGAAGAGGATGG + Intergenic
971363170 4:25955162-25955184 TTGCTCAGGGCAGAGGAGGATGG + Intergenic
971402789 4:26292224-26292246 TTGCCAGGGGCTGAGGAGTAGGG - Intronic
971456074 4:26845535-26845557 TTGCCAAGGTCAGGGGAGGAGGG - Intergenic
972035969 4:34521340-34521362 TTGCCTAGGGCAGAGAAGGATGG - Intergenic
972459918 4:39292118-39292140 TTGCCTGGGCCTTAAGAGTAGGG - Intronic
975538892 4:75483426-75483448 TTGCCTAGGCCTGGGGCGTTAGG + Intronic
979022935 4:115525505-115525527 TTCCCTTGGCTTGGGGAGGAAGG + Intergenic
979903455 4:126253665-126253687 TTGCCAGGGCTTGAGGATGAAGG + Intergenic
983682271 4:170367274-170367296 TTGCCTAGGGATGAGGAAGTGGG - Intergenic
984624883 4:181996007-181996029 TTGAGTTTGCCTGAGGAGGAGGG - Intergenic
985479252 5:97459-97481 TTGCCTGGGGCTGGGGAGGACGG - Intergenic
985647093 5:1090109-1090131 CAGCCCAGGCCTGGGGAGGATGG + Intronic
985881547 5:2642179-2642201 TGGCCTGGGCCAGAGGAGGAAGG + Intergenic
986517098 5:8575328-8575350 TTCCCTTGGCCACAGGAGGATGG - Intergenic
986747219 5:10755203-10755225 TTTCCTTGGCTTGTGGAGGAAGG + Intronic
986867309 5:12005189-12005211 TTGCCAGGGGTTGAGGAGGAGGG - Intergenic
987045707 5:14105710-14105732 TTGCCTAGGCCTGAGTGCAATGG - Intergenic
987656175 5:20809367-20809389 TTGCCTAAGACTGAGGGTGATGG - Intergenic
988767377 5:34394573-34394595 TTGCCTAAGACTGAGGGTGATGG + Intergenic
989419811 5:41224412-41224434 GTGCCTAAGACTGGGGAGGAGGG - Intronic
989563098 5:42873361-42873383 TACCCTAGGCCTGAGGGGAAAGG - Intronic
991226661 5:64281338-64281360 TTGACTAGGCATGATGAGAATGG + Intronic
991551955 5:67847005-67847027 TTGCCTAGGGCTGAGCAAGAGGG + Intergenic
991666677 5:69006272-69006294 TTGCCAAGGCCTGAGGGAGGTGG + Intergenic
992052961 5:72957386-72957408 TTGCCTAGGCCTGGGGCAGGGGG - Intronic
992592525 5:78310035-78310057 ATGCCTAGTCCTGAGCAGGTAGG - Intergenic
993146905 5:84105820-84105842 TGAGCTAGGCCTGAGAAGGATGG - Intronic
993202155 5:84830314-84830336 TGCCCAAGGCCTGAGGAGCACGG - Intergenic
994726695 5:103444541-103444563 GTTCCCAGGCCTGTGGAGGAAGG - Intergenic
996562459 5:124845512-124845534 TTGCCAGGAACTGAGGAGGAGGG + Intergenic
996872267 5:128204390-128204412 TTGCTTAGGGCTGGGAAGGATGG - Intergenic
997442142 5:133916336-133916358 TTGCCATGGCCAGAGGAGAATGG + Intergenic
998066338 5:139162034-139162056 TTGCCTAGGCCTTACCAGGTGGG + Intronic
999110805 5:149119684-149119706 CTGCCTAGGGCTGGAGAGGATGG + Intergenic
999234990 5:150085318-150085340 TTGCCTGGGCCAGAGAAGGATGG + Intronic
999413501 5:151374037-151374059 TGGACTAGGCCTGAGAAGGAAGG - Intergenic
1000057362 5:157619179-157619201 TTGCACAGGACTGAGGAGCAGGG - Intergenic
1001097444 5:168786695-168786717 TTGGTGAGGCCTGGGGAGGAAGG + Intronic
1001191008 5:169631345-169631367 TTGACTAGTACTGTGGAGGATGG + Intergenic
1001404929 5:171469515-171469537 TTGACTCAGCCTGGGGAGGAAGG - Intergenic
1001640391 5:173239671-173239693 TTGCCTAGGGCTGGGAAGGTAGG - Intergenic
1002062721 5:176635854-176635876 TTGCCCAGGCCTGAGTACAATGG + Intronic
1002103921 5:176870583-176870605 TTGCCCAGCCCTGGGGAGGTGGG + Intronic
1002960997 6:1914898-1914920 CTGCCCAGGCCTAAGCAGGAGGG - Intronic
1002979618 6:2123238-2123260 GTGTCTAGTCCAGAGGAGGAGGG - Intronic
1003551328 6:7104612-7104634 TTGCCTAGAACTGAGGACTAGGG - Intergenic
1006298797 6:33182232-33182254 TTGCCTAGGCTGGAGTACGATGG - Intronic
1006632803 6:35441513-35441535 TTACCTTGCCCTGAGGGGGAAGG - Intergenic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1007550324 6:42724471-42724493 TTGCCCAGGGCTGAGGAGTGAGG - Intergenic
1008125506 6:47663926-47663948 ATTCGTAGGCCTGAGGAGGCGGG + Intronic
1008949283 6:57137759-57137781 TTGCCTAGGGATGAGGAAGATGG - Intronic
1012583065 6:100892251-100892273 TGGCCTGGGCATGGGGAGGATGG + Intergenic
1013590399 6:111615019-111615041 TTGCCAGGGGCTGGGGAGGAGGG + Intergenic
1013601832 6:111712413-111712435 TTGACTGGGGCTGGGGAGGAGGG - Intronic
1014392109 6:120875012-120875034 TTGTCTATGCCTCATGAGGAGGG + Intergenic
1017230022 6:152063859-152063881 TCGCCAAGGTCTGAGGAGGCTGG + Intronic
1017722591 6:157254207-157254229 TTGCCTAGGGCTGAGGGAGTGGG - Intergenic
1017884899 6:158590863-158590885 TTGCCAAGGACTGTGGGGGAGGG - Intronic
1019492354 7:1321382-1321404 TTGCCTAGGGCTGGTGGGGAGGG + Intergenic
1019942070 7:4299491-4299513 TTGCCTGGAGCTGGGGAGGAGGG + Intergenic
1021393526 7:20122234-20122256 TTGGCTCGGCCTGGGGAGGAGGG - Intergenic
1021457146 7:20841974-20841996 TTGCCCAGGCCTGAGTAGAGTGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023252067 7:38275153-38275175 CTGCATAGGTCTGATGAGGAAGG + Intergenic
1023928366 7:44687924-44687946 TTGCTTAGGGCTTGGGAGGATGG - Intronic
1026564610 7:71479703-71479725 TTTCTTATGTCTGAGGAGGAAGG - Intronic
1026812074 7:73476139-73476161 TTGCTCAGGGCTGGGGAGGATGG + Intronic
1026903747 7:74051162-74051184 TTCCCTGGGGCTGAGGATGAAGG - Intronic
1027253051 7:76411103-76411125 TTCCCCAGGCCAGGGGAGGAGGG - Intronic
1027425310 7:78056079-78056101 TTGCCAGGGGCTGGGGAGGAGGG - Intronic
1029945102 7:104524537-104524559 TGGGCTAGGCCTGAGGATAAAGG - Intronic
1031004154 7:116453244-116453266 TTGGAAAGGTCTGAGGAGGAAGG - Intronic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1032333528 7:131002802-131002824 TTGGCTAGGGCTCAGGTGGATGG - Intergenic
1033621284 7:143063916-143063938 TTGGCTGGGTCTGAGGATGAAGG + Intergenic
1034182386 7:149148340-149148362 TTGCCAAGGCCTGCGGGGGCCGG + Intronic
1034270840 7:149802842-149802864 CTGCCCAGGCCGGGGGAGGAGGG + Intergenic
1034292613 7:149945035-149945057 TTCCCTGGGGCTGAGGAGGCAGG - Intergenic
1034813458 7:154151857-154151879 TTCCCTGGGGCTGAGGAGGCAGG + Intronic
1034821329 7:154219191-154219213 TTGTCTTGGCCTGGGGATGAAGG - Intronic
1035447797 7:158954910-158954932 TTGTCTAGGCCTGTGGGGGACGG - Intronic
1038332538 8:26620203-26620225 GTGCCTTGGCCTAAGGAGAAGGG + Intronic
1039379295 8:37069879-37069901 TTGCCTGGACCTTAGGAGTAAGG + Intergenic
1039472591 8:37822625-37822647 TTGCTTGGGCCTGGGGAAGAGGG - Intronic
1039815738 8:41093054-41093076 TAACCCAGGCCTGCGGAGGATGG + Intergenic
1041406563 8:57505781-57505803 GTGCCCAGGCCTGGGGAGCAAGG + Intergenic
1041481894 8:58331660-58331682 TTGCCTTGGCTGGAGGAGGGAGG - Intergenic
1041851425 8:62397619-62397641 TTTCCAAGGACTGAGGAGTAGGG - Intronic
1042236582 8:66619245-66619267 TTGCCTAGGGCTGAGGACCTCGG - Intergenic
1042422267 8:68605704-68605726 TTGCCAGGGCTTGAGGAGGGAGG + Intronic
1043464281 8:80489035-80489057 TTGCCTAAGCCCTAGAAGGAAGG + Intronic
1044047325 8:87452826-87452848 TTGCCTAGGCTGGAGCAGCATGG + Intronic
1044056096 8:87570905-87570927 TAGCCTGGGCCTGAGCAGCATGG + Intronic
1044680360 8:94771699-94771721 ATGCCCAGGCCTGGGCAGGAAGG + Intronic
1045128260 8:99119278-99119300 TTGCCTAGGCTGGAGTATGATGG + Intronic
1045366710 8:101483590-101483612 TTGCCTAGGCTGGAGTATGATGG + Intergenic
1045412729 8:101934895-101934917 TTGCCTAAGTCTGAGGAGGATGG - Intronic
1045797112 8:106059028-106059050 TTGTCTAGCCTTGAGGAAGAGGG - Intergenic
1048160431 8:132015890-132015912 TTGCCAAGGCCTGGTGGGGAAGG - Intergenic
1049497858 8:142945086-142945108 GTGCCTGGGCCTCAGCAGGAGGG - Intergenic
1050435922 9:5610696-5610718 TTCCCTTGGCCTGTGGGGGAGGG - Intergenic
1051006527 9:12352232-12352254 TTTCCTGGACCTGAGGAGGTGGG + Intergenic
1051462924 9:17343846-17343868 TTTCCTAGGGCTGGGCAGGATGG - Intronic
1051641637 9:19230110-19230132 TTGCCTTGGCCTGAGGCAGGTGG - Intergenic
1051649651 9:19309049-19309071 TTGCCTTGGAATGAAGAGGATGG + Intronic
1053237195 9:36466233-36466255 TTGCCTAGGACTGAGATGGGAGG + Intronic
1054549918 9:66390503-66390525 TTGCCTAATCATGAGGAGGCGGG - Intergenic
1055802670 9:80057319-80057341 TTGCCAAGGACTGAGGGGGTGGG + Intergenic
1056674355 9:88661331-88661353 TTGCCTAGGGCTGAGGGGATAGG + Intergenic
1056819762 9:89830790-89830812 TTGCCAGGGGCTGAGGAGGAGGG - Intergenic
1057434429 9:95026356-95026378 TTGCCTAGGGATGAGGAGAGGGG - Intronic
1057438939 9:95067844-95067866 TTGCCTAGGACTGGGGAGCTAGG - Intronic
1057695809 9:97322261-97322283 TTGTCCAGGGCTGGGGAGGAGGG - Intronic
1057925509 9:99143815-99143837 TTGCCTAGGGCTAAGGAGTTTGG - Intronic
1058360776 9:104143725-104143747 TTGCCAAGGGCTGGGGAGCAGGG - Intergenic
1059341574 9:113600481-113600503 TTGCCCAGGCCTGAGAAGATGGG + Intergenic
1059628591 9:116094728-116094750 TGGCTTGGGCCAGAGGAGGAAGG - Intergenic
1060498178 9:124133184-124133206 TTGTCTCGGCCTGTGGAGAAGGG - Intergenic
1061086648 9:128403334-128403356 TTGCCTAGGGCTGGGGAGAAGGG + Intergenic
1061338481 9:129959828-129959850 CTCCCTAGGGCTGAGGAAGATGG - Intronic
1061444192 9:130628565-130628587 TTCCCAAGGCCTGGGGATGAGGG + Intronic
1062057289 9:134475229-134475251 TTGCCTGGGCCTCAGGGGGCTGG + Intergenic
1062611984 9:137379435-137379457 TTGCCTGGGGCTGAGGGGAATGG + Intronic
1203491397 Un_GL000224v1:108755-108777 TTACCAAGGGCTGAGGGGGAAGG - Intergenic
1203504021 Un_KI270741v1:50625-50647 TTACCAAGGGCTGAGGGGGAAGG - Intergenic
1186802518 X:13107544-13107566 TTGCCTGGGGCTAAGGAGTAGGG + Intergenic
1186983944 X:14990391-14990413 TTGCCAGGGGCTGAGGAGTAGGG + Intergenic
1187201382 X:17136801-17136823 TTGCCAGGGGCTGAGGGGGAAGG - Intronic
1188336070 X:28934546-28934568 TTGCCTATGGCTGAGGGGGAAGG - Intronic
1189483116 X:41408271-41408293 TTGCCTTTTCCTGAGAAGGAAGG - Intergenic
1189578615 X:42382284-42382306 TGGCAAGGGCCTGAGGAGGAAGG + Intergenic
1190228116 X:48561097-48561119 ATACTTAGGCCTGGGGAGGAAGG - Exonic
1190888067 X:54546684-54546706 TTGCCCAGGCCGGAGTGGGATGG + Intronic
1191887662 X:65905457-65905479 TTGCCCAGGCCGGAGGAGAGTGG - Intergenic
1192364597 X:70460741-70460763 TTGCTTAGACATGAGGGGGATGG - Intronic
1192405285 X:70879099-70879121 TTGCCTAGGGCTGAGGGTGAGGG + Intronic
1192452158 X:71251359-71251381 TGGCCCAGCCCTTAGGAGGAGGG + Intronic
1193792559 X:85833328-85833350 TTGCCAGGGCCTCAGGAGGTGGG + Intergenic
1194163182 X:90481066-90481088 TTGCTTAGGACTGGGGAGGATGG + Intergenic
1195309827 X:103621390-103621412 TTGGCTAGGGTTGGGGAGGATGG + Intronic
1195453744 X:105044527-105044549 AAGCCTAAGCCTGAAGAGGAGGG + Intronic
1195911479 X:109892341-109892363 TTGCCTAGGTTTAAGGAGGTGGG - Intergenic
1197485512 X:127045535-127045557 TTGGCCAGGGGTGAGGAGGAGGG - Intergenic
1197759588 X:130018296-130018318 TTGCCTAGGGTTGGGGAGGATGG + Intronic
1197819903 X:130531751-130531773 CTGCCCAGGCCTGAGGGGGTGGG - Intergenic
1198224720 X:134634530-134634552 TTCCCTAGGACTGAGCAGGGTGG - Intronic
1198532447 X:137559805-137559827 TTCCCTAGGCCTGAGGGGGTTGG - Intergenic
1199853068 X:151739025-151739047 TTGCCCAGACCTCAGGAGGACGG - Intronic
1199988379 X:152968952-152968974 TGGCCCAGGCGTGAGGAGAAGGG + Intronic
1200055840 X:153460239-153460261 CTGCCAAGGCCTGAGGGGAATGG + Intronic
1200063102 X:153492293-153492315 GAGCCCAGGCCTGAGGAGGGGGG + Intronic
1200133863 X:153865245-153865267 TCGCCCAGGTCTGGGGAGGAGGG + Intronic
1200509456 Y:4058791-4058813 TTGCTTAGGACTGGGGAGGATGG + Intergenic