ID: 921521662

View in Genome Browser
Species Human (GRCh38)
Location 1:216163435-216163457
Sequence CCTCAAGTAATTCAGATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921521662_921521664 17 Left 921521662 1:216163435-216163457 CCATATATCTGAATTACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 921521664 1:216163475-216163497 ATTTTATTTATCTTATCTTTTGG 0: 1
1: 0
2: 17
3: 177
4: 1651
921521662_921521665 25 Left 921521662 1:216163435-216163457 CCATATATCTGAATTACTTGAGG 0: 1
1: 0
2: 1
3: 16
4: 153
Right 921521665 1:216163483-216163505 TATCTTATCTTTTGGTTATTTGG 0: 1
1: 0
2: 0
3: 39
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921521662 Original CRISPR CCTCAAGTAATTCAGATATA TGG (reversed) Intronic
908895436 1:68893434-68893456 CCACAAGTAAGTCATATATCTGG + Intergenic
908909037 1:69051313-69051335 GCTCAAGTAATTAAAATACAAGG - Intergenic
916979698 1:170120606-170120628 TCTCATGTAACTCATATATATGG - Intergenic
918404436 1:184197518-184197540 CACCAAGTAATTCAGAAAGAAGG - Intergenic
918737803 1:188088266-188088288 TCTGAAGGAATTCAGCTATATGG + Intergenic
919482810 1:198110167-198110189 CCTCCAGTGATTCAGCTACATGG + Intergenic
921521662 1:216163435-216163457 CCTCAAGTAATTCAGATATATGG - Intronic
921642087 1:217567549-217567571 CATAAAGCAAATCAGATATAAGG - Intronic
922644460 1:227272822-227272844 TATCAAGTAATTGAGAGATATGG + Intronic
923641551 1:235766503-235766525 CCTCAGTTAATTAAGATACATGG - Intronic
1065695099 10:28372509-28372531 CCTCAAGTAGTTGAGATTTCAGG - Intergenic
1066343494 10:34559163-34559185 CCGCAATTAACTAAGATATAAGG - Intronic
1066499592 10:35977678-35977700 TATAAAGTAATTCATATATATGG + Intergenic
1068386502 10:56335361-56335383 TGTAAAGAAATTCAGATATATGG - Intergenic
1068499906 10:57831662-57831684 CCTGATGAAATTAAGATATAAGG - Intergenic
1068699165 10:60001740-60001762 CCTTTAGTATTTCAGAGATAGGG - Intergenic
1073644324 10:105284162-105284184 CAACAGGTAACTCAGATATAAGG - Intergenic
1076092538 10:127700247-127700269 CCTCTAGAAAATAAGATATAGGG + Intergenic
1078204841 11:9219695-9219717 CCTCAAATAATCCAGATTGATGG + Intronic
1080832931 11:35913243-35913265 CCTGAGGTAATTCAGCAATATGG - Intergenic
1081373960 11:42337813-42337835 TCTCAAATAATTAAGATAAATGG - Intergenic
1083000026 11:59283029-59283051 CCTCAAGTGGATCAGAAATACGG - Intergenic
1086849857 11:91796781-91796803 CCTCATGTAAGTGAGATATTTGG - Intergenic
1092009532 12:5097997-5098019 CCTCATCAAATTCAGATTTATGG - Intergenic
1092701852 12:11240684-11240706 CCTTCAGTTATTCAAATATATGG - Intergenic
1093079616 12:14794611-14794633 CCTCAAGTCGTGCAGATGTATGG - Exonic
1093169867 12:15848360-15848382 CCTAAAGTAAAAGAGATATATGG - Intronic
1093335042 12:17894630-17894652 CCTCTAGTGATGCAGTTATAAGG - Intergenic
1095462496 12:42457311-42457333 CCTGAAGAAATGCAGGTATAAGG - Exonic
1098082290 12:66800447-66800469 TCTCAAGTAATTCAGCTGCATGG + Intronic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1100483030 12:94997755-94997777 CCACAAGTATTTCAGATTTTAGG - Intronic
1102839493 12:116103018-116103040 CCTAAAGTAATGAAAATATAGGG - Intronic
1106693128 13:32140912-32140934 CCTGAATTAATTAAAATATATGG + Intronic
1107035105 13:35894161-35894183 CCAGAAGTATTTCAGATACAAGG - Intronic
1109004178 13:56848483-56848505 CTTCAATTAATTGTGATATATGG + Intergenic
1110728604 13:78853813-78853835 CCACAAGAAATAAAGATATATGG + Intergenic
1110754076 13:79151334-79151356 CCTCAAGAAAAGCAGATAGACGG - Intergenic
1110861993 13:80354764-80354786 CCCCATGTAATTCTAATATATGG - Intergenic
1111204618 13:84989497-84989519 CCACAAGTAATTTCAATATATGG + Intergenic
1111236413 13:85414526-85414548 CCTCAGCTAATTAAGACATAGGG - Intergenic
1111962509 13:94826379-94826401 CATCATCTAATACAGATATATGG - Intergenic
1120393540 14:83939065-83939087 TCTCAATTAATTCAGAAATTGGG - Intergenic
1120602563 14:86529949-86529971 CCTAAAGTAATTCAAATAAATGG - Intergenic
1122872434 14:104645938-104645960 CCTTAAGTAATTCTAATAAAAGG + Intergenic
1128253057 15:66177159-66177181 CCCCAAATTATTCATATATATGG + Intronic
1131567229 15:93497343-93497365 TCTCAAGTCATTTAGAAATATGG + Intergenic
1132202003 15:99961445-99961467 CCTCAAGTGATACAGACATTTGG - Intergenic
1132425999 15:101717868-101717890 TCTTAAGTAATACAGAAATAAGG + Intronic
1135207763 16:20497163-20497185 TCTGAAATAATTCAGATATTAGG + Intergenic
1135211136 16:20526537-20526559 TCTGAAATAATTCAGATATTAGG - Intergenic
1142946906 17:3437307-3437329 CCTTAAGTAATTCAAATATATGG + Intergenic
1145791101 17:27627507-27627529 CCTCCATAAAGTCAGATATATGG - Intronic
1148984124 17:51606687-51606709 TCTATAGTACTTCAGATATAAGG - Intergenic
1155920088 18:31594977-31594999 CCTCAACTAAGTCAGAAGTAGGG - Intronic
1155924643 18:31642367-31642389 CCTCAAGTAGTTCTGAAACAGGG + Intronic
1156012641 18:32512471-32512493 CCTCAAGTCGTGCAGATGTATGG + Intergenic
1157048504 18:44132279-44132301 CCTCCAGTAATTCATATTTGGGG - Intergenic
1158782351 18:60666330-60666352 ACTCAAGTAATCCAGATACTGGG + Intergenic
1159249789 18:65859954-65859976 CCTCAAGTAATTTTTATCTATGG + Intronic
1159746195 18:72238335-72238357 CCTCTATTAATTCACATATATGG - Intergenic
1164264408 19:23599948-23599970 CCTCAAGTGATCCACATAAATGG + Intronic
925150751 2:1613039-1613061 CCTCAAGGAATTCTGGTTTAGGG + Intergenic
928034035 2:27805290-27805312 CCTCAAGAAAATCAGGTCTATGG - Intronic
931155918 2:59629908-59629930 CCACATGTAATTCAGTAATAAGG + Intergenic
931780269 2:65573364-65573386 CCTCAAGTGATTCTAATGTACGG - Intergenic
931980626 2:67690110-67690132 CCTCTAATAATTCAGATAGAAGG + Intergenic
933021380 2:77197412-77197434 TTTCAAATAATACAGATATATGG - Intronic
933386081 2:81611889-81611911 CTTCAGGTGATTCAGATATACGG + Intergenic
937594578 2:123658379-123658401 CCTCAAGTAATGATAATATAGGG + Intergenic
940392108 2:153144205-153144227 CTTGAAGTAATTCAGAGAGAAGG + Intergenic
941366290 2:164615560-164615582 CCTCAAGAAATCCAGATTTCAGG + Intronic
942690598 2:178581032-178581054 TATCAAGTAATTCAAATAAAGGG + Intronic
946577884 2:221096015-221096037 CCTCATGTAATTCCTATACAAGG + Intergenic
947444616 2:230154599-230154621 GCTGATGTAATTCAGGTATAGGG + Intergenic
1171879472 20:30607121-30607143 CCTCAAGACATGCACATATAAGG + Intergenic
1176205840 20:63887693-63887715 CCTCAATTAATCCAGGAATATGG - Intronic
1177920666 21:27148508-27148530 CCTCAAGTCATACAGTGATATGG + Intergenic
1179151755 21:38815119-38815141 ACTCAAGTGAGTCAGATATATGG + Intronic
949107357 3:216812-216834 CCTTAAGCAATGCTGATATATGG + Intronic
949975422 3:9453543-9453565 CCTCAAGTTTTTCAGTTAAAAGG + Intronic
955051796 3:55418236-55418258 CCTCTAGTAATTCCAATATCTGG - Intergenic
955631368 3:60979103-60979125 CCTCAATTAATTCAGTTCTTAGG + Intronic
956050934 3:65247752-65247774 CCTCAGGTAATTCTGATGTGTGG + Intergenic
956869905 3:73406625-73406647 CCACAATGAATTCAGATATTAGG + Intronic
957764014 3:84597938-84597960 ATTCAATTAATTCAGATATTTGG - Intergenic
960487612 3:118272251-118272273 TCTCAAGTGATTCAAATATATGG - Intergenic
962449346 3:135499091-135499113 ACTCAAGAATTTTAGATATAAGG + Intergenic
962857909 3:139366043-139366065 CCTCAAGTTATTTAGAGATATGG + Intronic
963254501 3:143131299-143131321 CCTTAAGTAATGCAGATAAATGG + Intergenic
964135606 3:153341783-153341805 TAGCAAGTAATTCACATATAGGG - Intergenic
965351512 3:167617292-167617314 CCTCAAGTAATTCACTCATCTGG - Intronic
967245747 3:187484692-187484714 CCTCAAGTAACTCAGAGAGCAGG - Intergenic
970404804 4:15752716-15752738 CCTCAAATAGTTCAGACACATGG - Intergenic
971084937 4:23263130-23263152 CTTCAAATAAATTAGATATAAGG - Intergenic
974198785 4:58611820-58611842 CCTCATATAAATTAGATATAAGG - Intergenic
975816989 4:78228277-78228299 CTTTAAGTAATCCAGATATTAGG - Intronic
976190661 4:82483745-82483767 CCTCAAGAAATTCAGACTTTGGG + Exonic
976541859 4:86286726-86286748 CCTCAAGTACTTCAGGAATGAGG + Intronic
977216361 4:94288922-94288944 CCTCATTTAATTAAAATATAGGG + Intronic
977263781 4:94830594-94830616 CCTCTACTATTTCAGATATATGG - Intronic
977658157 4:99548075-99548097 ACACAAGTAATACAGATATATGG + Exonic
977716126 4:100185745-100185767 CCATAAGGAATTCTGATATAAGG + Intergenic
979100145 4:116603017-116603039 ACTCAAGTACTTCGAATATATGG - Intergenic
979833617 4:125332575-125332597 CCTCATCTAAATCAGAGATAAGG - Intronic
980699265 4:136402477-136402499 CTTAAAGTAATGCAGATATTAGG - Intergenic
981343205 4:143646640-143646662 CCTCAAGAAATTCACAATTATGG - Intronic
983289490 4:165784215-165784237 ACCCAAGTCATTTAGATATAAGG + Intergenic
985470963 5:45561-45583 CCTCAAGGATTCCAGATATGAGG + Intergenic
987557807 5:19478073-19478095 CATCAAGTAATTCAAAGATGGGG + Intronic
992985548 5:82225306-82225328 CCTCAGGTAATACAAATATTTGG + Intronic
994017172 5:94980969-94980991 CCTCAAGTATTTTAGTTACATGG - Intronic
994407412 5:99362473-99362495 GCTCAAGAAATTGAGATTTATGG + Intergenic
995160935 5:108980802-108980824 CTTCAAATAATTCAGTAATAGGG - Intronic
996529528 5:124513160-124513182 CCTCAATGAATTCAGAGCTATGG + Intergenic
997113441 5:131100471-131100493 TCTAAAGTAATTCAAATATTAGG + Intergenic
997543311 5:134682913-134682935 ACTAAAGTAATTAATATATAAGG + Intronic
997599325 5:135128466-135128488 CTTAAAGTAATACAGACATATGG + Intronic
998735064 5:145128366-145128388 CATCAACTGAGTCAGATATATGG + Intergenic
1000286855 5:159834257-159834279 CCTCAAGTCATTCAGAACTCAGG + Intergenic
1000918618 5:167112397-167112419 CTTAGAGTAATTGAGATATAAGG + Intergenic
1006797881 6:36742608-36742630 CCTCAGGTAATTCAGAAAGGTGG - Intronic
1007814037 6:44507650-44507672 CCTTAGGTGATTCTGATATACGG - Intergenic
1007863836 6:44945315-44945337 CCCTAAGTATTTCAGATGTAAGG + Intronic
1008704721 6:54144125-54144147 CTGCCAGTAATCCAGATATAAGG + Intronic
1012515977 6:100059943-100059965 CCTCAAGAAATTCATAATTACGG + Intergenic
1016868100 6:148789669-148789691 CCTCCCGTAATTCAGAATTACGG + Intronic
1020254107 7:6492354-6492376 CACCAAGTAATGCAGACATATGG - Intergenic
1020668961 7:11082623-11082645 CTTCTAGTAATTGTGATATAAGG - Intronic
1020763452 7:12293977-12293999 CCTCAAGTGGATCAGATATCTGG - Intergenic
1021068575 7:16208767-16208789 CCTCAAGGAATTCATATACCTGG - Intronic
1021961727 7:25879622-25879644 CCTAAAGAAACTCAGAAATAAGG - Intergenic
1023334223 7:39151660-39151682 ACTCAAATAAGGCAGATATATGG + Intronic
1024396306 7:48872263-48872285 GCTCAAATAATTCAGATATTAGG - Intergenic
1027808878 7:82866699-82866721 CCTCAAGAAATTCATATTAAAGG - Intronic
1030550933 7:110958788-110958810 TCTCAGGTAATTCAGACATGAGG + Intronic
1031174741 7:118336282-118336304 ACTCAGGGAATTCAGATGTATGG - Intergenic
1031564803 7:123282468-123282490 CCTTAGGTAATACAGACATAAGG - Intergenic
1031651558 7:124297265-124297287 CATCAAATAATGCAGAAATAAGG - Intergenic
1032669226 7:134068195-134068217 CCTCAAGTAGGTCAGAAACAAGG - Intergenic
1033305045 7:140219029-140219051 CCACAGGTGATTCAGAAATAGGG + Intergenic
1039626689 8:39061467-39061489 GCTCAATTATTTCAGATATAGGG + Intronic
1039640226 8:39211905-39211927 GTTCAAGTAATTCAGACCTATGG - Intronic
1043477415 8:80619010-80619032 CCTCAAGTAAATCAGAGGAAGGG - Intergenic
1046188399 8:110754418-110754440 CCTTTAGTAATTAAGATATTTGG - Intergenic
1046355935 8:113085254-113085276 CCACAAATAATTCAGTTAAAAGG + Intronic
1046445859 8:114318237-114318259 CCTAAAGAAATTTAAATATAGGG + Intergenic
1046981196 8:120338217-120338239 ACTCTAGTAATTCAGAATTAGGG - Intronic
1047609657 8:126508668-126508690 CCTCAACAAATTCATGTATAGGG + Intergenic
1050018651 9:1261545-1261567 CCTCTAGTAATTCAGAAGCAAGG + Intergenic
1050739444 9:8803320-8803342 CCTCAGGTAATTAAATTATAGGG - Intronic
1051732235 9:20156604-20156626 TCTCCAGTAATTCAGAAAAAGGG + Intergenic
1056508184 9:87277327-87277349 CCTCATTTAATTCAGAAATAAGG - Intergenic
1056851755 9:90090834-90090856 CCACAAGTAATCCAGAGATCTGG + Intergenic
1058136988 9:101318027-101318049 CCTCAAATAACTCATAGATAAGG + Intronic
1058781808 9:108344700-108344722 TCTTAAGTAATTCAGATCTATGG + Intergenic
1058909992 9:109512180-109512202 CCTCAGGTAATTCTGATGCACGG - Intergenic
1059906126 9:118988847-118988869 GCTCTAGTAACTCAGGTATAAGG - Intergenic
1059979498 9:119754801-119754823 TCTGAAGTAATTTTGATATATGG + Intergenic
1061817000 9:133203584-133203606 CCTCAAATATTTCAGATGTTGGG + Intergenic
1185922551 X:4109882-4109904 CATATAGTAATTGAGATATAGGG - Intergenic
1186630454 X:11343005-11343027 CCTTAAGTAATTAAAATATTTGG - Intronic
1186885706 X:13911263-13911285 CCTAGAGTGGTTCAGATATATGG + Intronic
1188276212 X:28204610-28204632 ATTCTAGTAATTCAAATATATGG - Intergenic
1192830092 X:74742222-74742244 CCTCATGAAATTCAGATAGACGG + Exonic
1193553816 X:82930319-82930341 CCTCAAGTGGATCAGAAATATGG - Intergenic
1195487665 X:105427429-105427451 CCTAAAGTAAATAAAATATATGG - Intronic
1197837275 X:130709092-130709114 CCTCAAGGAATTAACAAATATGG - Intronic
1198011325 X:132558176-132558198 CCTCAAATAGTTCAGAAAAAGGG + Intergenic
1198321722 X:135523872-135523894 CCTTATGTAGGTCAGATATATGG + Intronic
1199046975 X:143185886-143185908 CCTCAAGGAACTCAGAATTATGG + Intergenic