ID: 921524444

View in Genome Browser
Species Human (GRCh38)
Location 1:216200147-216200169
Sequence CAAAGTTACATTTCACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921524443_921524444 3 Left 921524443 1:216200121-216200143 CCTGAAATGAAAAGAAAAAAAAA 0: 1
1: 9
2: 210
3: 2499
4: 32467
Right 921524444 1:216200147-216200169 CAAAGTTACATTTCACAAGTTGG 0: 1
1: 0
2: 0
3: 11
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921524444 Original CRISPR CAAAGTTACATTTCACAAGT TGG Intronic
906582206 1:46945471-46945493 AAAAGTAAAAATTCACAAGTGGG - Intergenic
906601389 1:47132389-47132411 AAAAGTAAAAATTCACAAGTGGG + Intergenic
907948732 1:59160108-59160130 CAAAGTTTCATTTCTGAATTTGG + Intergenic
908556306 1:65259958-65259980 GTAATTTACATGTCACAAGTTGG - Intronic
909457648 1:75868772-75868794 CAAAGTTACATCTTACATGCCGG - Intronic
910087617 1:83421989-83422011 CTAAGTTACAGTTCATAATTGGG - Intergenic
911583784 1:99666910-99666932 AAAAATTACATTTCACCAGATGG - Intronic
911810310 1:102268197-102268219 TAAAATTACATTTGACAATTGGG + Intergenic
912581107 1:110721761-110721783 CAAACTTTCATTTCACAGTTAGG + Intergenic
914898065 1:151694667-151694689 CAAAGATACCTTTGGCAAGTTGG - Exonic
917687812 1:177435429-177435451 CAAAGTCACAATTCACCAGGGGG + Intergenic
917704862 1:177622297-177622319 CAAAGTTATAGTTGTCAAGTGGG - Intergenic
918488556 1:185055051-185055073 AAAAGTTTCATTACACATGTAGG + Intronic
918769679 1:188539992-188540014 CAAAGTTAAATGTCCAAAGTGGG + Intergenic
920764982 1:208823687-208823709 CAAATTAACATTTCACGAATAGG - Intergenic
921524444 1:216200147-216200169 CAAAGTTACATTTCACAAGTTGG + Intronic
921687317 1:218104897-218104919 CAAAGTCACATTTTACACGGTGG + Intergenic
923892002 1:238226489-238226511 GAAAGTTACATTTTACATGGCGG + Intergenic
1064901764 10:20302757-20302779 CCAAGTACCATTTCACATGTTGG + Intergenic
1068723475 10:60273836-60273858 CAAAGTCACATTTTACATGGTGG - Intronic
1070302605 10:75215208-75215230 CAAAGTTAAATTTTACTAGCTGG - Intronic
1074085544 10:110207012-110207034 CAAAGTTATTTTCCAGAAGTGGG - Intergenic
1075290186 10:121222702-121222724 CTGAGTTTCATTTCAGAAGTAGG + Intergenic
1076544199 10:131232994-131233016 CAATTTTAAATATCACAAGTAGG + Intronic
1076545384 10:131242010-131242032 CAAAGTAACATTGTACAACTTGG + Intronic
1076928905 10:133514273-133514295 CAAAGTCACATCTCACATGGTGG + Intergenic
1078348085 11:10569210-10569232 CACATTTACATAACACAAGTAGG + Intronic
1079126311 11:17720670-17720692 CAAATTTACATTTTGGAAGTAGG - Intronic
1079466006 11:20731642-20731664 CAGACTTACAATTCACAAGCCGG + Intronic
1079588793 11:22157351-22157373 CTCACTTATATTTCACAAGTAGG + Intergenic
1079669858 11:23155004-23155026 CAAAGTCACATTTTACATGGTGG - Intergenic
1080132364 11:28811865-28811887 CAAAGTACCATCTCTCAAGTTGG - Intergenic
1080846420 11:36030983-36031005 CAAATTTATATTTGACAAGGGGG - Intronic
1084444399 11:69195388-69195410 CAAAGTAACATTTCAGAGGGAGG + Intergenic
1089914793 11:122143115-122143137 AAAAGTTACATTTTAGAAATAGG - Intergenic
1090004189 11:122985247-122985269 GAAAGTCACATTTAAAAAGTAGG + Intergenic
1090164509 11:124533489-124533511 CAAAGTTCCATGTCAGAAGGTGG + Intergenic
1091208894 11:133840198-133840220 CAAAATTACCTTTCAAAAGAAGG + Intergenic
1091316590 11:134618203-134618225 CAAAGTTTCATGTCTCACGTGGG - Intergenic
1092054609 12:5498470-5498492 AAAAGTTACATTTCACTACCTGG - Intronic
1093650239 12:21634894-21634916 CAAATTTACATGTCATATGTAGG - Intergenic
1094801053 12:34036402-34036424 CAAAGTCACATTTTACATGGTGG + Intergenic
1095114187 12:38332414-38332436 CAAAGTCACATTTTACATGGTGG + Intergenic
1096929182 12:55185717-55185739 AAAAGTTTCATTCCACCAGTGGG - Intergenic
1098149413 12:67530859-67530881 CAAAGTTACATCTTACATGGTGG - Intergenic
1098253088 12:68589432-68589454 CAAAGTTACATTTCAAAGCAAGG + Intergenic
1098983783 12:76987854-76987876 CACAGTTATTTTTCACAACTTGG + Intergenic
1099983664 12:89637331-89637353 CTAAGTTTAATTTCAGAAGTTGG - Intronic
1100650017 12:96575974-96575996 CTAAATAACATTTCAAAAGTAGG - Intronic
1100789522 12:98115217-98115239 CAGAGTCACATTTAACAACTTGG + Intergenic
1101756170 12:107622172-107622194 TAAAGCCACATTTCACCAGTAGG - Intronic
1103141383 12:118551696-118551718 TAAAGCTACATTTCTCAAGATGG + Intergenic
1103577177 12:121886774-121886796 CATATTTAGATTTCACCAGTTGG + Intergenic
1104206541 12:126643936-126643958 CAAAGTCACATCTCACATGGTGG + Intergenic
1106622149 13:31381073-31381095 CATTGTTTCATTTCACAAGGTGG - Intergenic
1108584466 13:51857702-51857724 AAAAGTAACATTTAACAGGTAGG + Intergenic
1109283817 13:60388237-60388259 CACAGTTACTTTTCTCTAGTGGG + Intergenic
1109561727 13:64058367-64058389 CAAAGTTACATTTAACATCAAGG + Intergenic
1109812833 13:67537694-67537716 CAAAGGCACACTTTACAAGTGGG - Intergenic
1109883332 13:68510800-68510822 CAAAGTCACATCTCACATGGTGG - Intergenic
1110289228 13:73785019-73785041 CAAAGTTACATTTTCATAGTAGG + Intronic
1110520029 13:76464780-76464802 CAAAGTTACATCTTACATGGTGG - Intergenic
1110929075 13:81193476-81193498 CAAAGTCACATCTCACATGGTGG + Intergenic
1111044873 13:82801911-82801933 TTAAGTTACTTATCACAAGTGGG - Intergenic
1111191761 13:84817608-84817630 CAAAGCTTCATTCCACAGGTTGG + Intergenic
1111749273 13:92307117-92307139 AAAAGTTACATTTCAAAATGAGG - Intronic
1112175088 13:97014429-97014451 CAAAGTAACATTTTACACGGCGG - Intergenic
1112341912 13:98559406-98559428 CAAAGTCACGTCTCACATGTCGG - Intronic
1115771854 14:36671707-36671729 CAAAGTTACTTTTAAAAAATTGG + Intronic
1116077226 14:40126125-40126147 CAAAGTTACATTACGGAGGTTGG - Intergenic
1118054990 14:62070467-62070489 TAAATTTACATTTCACAAAGGGG + Intronic
1121128647 14:91425826-91425848 CAAAGTCACATCTCACAAGGCGG - Intergenic
1122667633 14:103344119-103344141 CATAGTGACATTCCATAAGTGGG + Exonic
1124194514 15:27609485-27609507 CAAATTCACATTTCACAAACAGG + Intergenic
1125125730 15:36218336-36218358 CATATTTACATTTAAAAAGTGGG - Intergenic
1125166466 15:36711834-36711856 CAAAGTTCCATTTCAAACCTGGG - Intronic
1126309115 15:47295863-47295885 CAAACTCACCTGTCACAAGTAGG + Intronic
1127039639 15:54960474-54960496 CAAAGTTACATCCCACATGCTGG + Intergenic
1129281885 15:74491872-74491894 AAAAGTCCCATTTCACAACTGGG + Intergenic
1130169278 15:81495136-81495158 AGAATTTACTTTTCACAAGTTGG - Intergenic
1133565752 16:6991838-6991860 CACATTAACATTTCAGAAGTGGG - Intronic
1135208484 16:20503275-20503297 AAATGATACATTACACAAGTGGG + Intergenic
1135657421 16:24263027-24263049 CAAAGTTACATTTCCCCTGAGGG - Intronic
1141370159 16:83479369-83479391 CAAACTTACATTTCTCAGCTGGG + Intronic
1144281906 17:13734695-13734717 CAAAGGTACATTTTACATGGTGG - Intergenic
1151105004 17:71602936-71602958 CAAAGTCACATCTCACACGGTGG + Intergenic
1152289798 17:79433389-79433411 CAAAGTCACATGACAGAAGTGGG - Intronic
1153337243 18:3937349-3937371 CAAAGTTACGTCTTACAAGGTGG + Intronic
1153597122 18:6738707-6738729 CAAAGTTACATGTCAGTGGTTGG + Intronic
1157495248 18:48152512-48152534 CAAATCTACATTTAACAAATAGG + Intronic
1157940986 18:51929043-51929065 CAAAGTTACATCTTACATGGTGG - Intergenic
1160546662 18:79661490-79661512 CAAATTTACATTTTACAACTAGG - Intergenic
1168392509 19:56021993-56022015 CAACATTACATTGCACAGGTGGG - Intronic
926356627 2:12046714-12046736 AAAAGTAACATTTAAAAAGTTGG + Intergenic
926993884 2:18712719-18712741 TAAAATTACATTTAAAAAGTAGG - Intergenic
927919049 2:26957529-26957551 CAAAGTGACATTTAAAAAGAAGG + Intergenic
928479110 2:31663617-31663639 CATAGTTAAATTTTAAAAGTGGG + Intergenic
930256367 2:49097609-49097631 CAGAGATACATTTTCCAAGTTGG - Intronic
931610684 2:64096340-64096362 CCAAGTTACAAGTTACAAGTTGG - Intronic
935932153 2:108139009-108139031 CAAAGTGACATTTCACAGTCTGG + Intergenic
936150819 2:110021359-110021381 CCAAATTACATTTCACTGGTGGG - Intergenic
936193857 2:110350010-110350032 CCAAATTACATTTCACTGGTGGG + Intergenic
937498686 2:122453537-122453559 CAAAGTCACATTTTACATGGTGG + Intergenic
938107215 2:128540988-128541010 CAAACTTACATTTAAAATGTTGG + Intergenic
938134402 2:128742503-128742525 CAAAGTAACATGGCAAAAGTTGG + Intergenic
939289081 2:140169849-140169871 CAAAGCTACATACCACAAATAGG - Intergenic
939672366 2:145028708-145028730 TAAAGTAACATTTCACAAACAGG - Intergenic
941314433 2:163974923-163974945 CAGAGTTGCATTACACAAGCTGG + Intergenic
942639220 2:178043152-178043174 TTAAGTTCCATTTCACAAATGGG - Intronic
943192467 2:184696280-184696302 GAAAGTTAGATTTCACAAGCTGG + Intronic
947601539 2:231453855-231453877 CACAGTTTGATTTCACTAGTTGG + Exonic
948131148 2:235601494-235601516 CAAAGTTACATCTAACATGGGGG + Intronic
1172080502 20:32337043-32337065 CAAACTCAAATTTCACAAGAAGG + Intergenic
1172201013 20:33125952-33125974 CGAATTCCCATTTCACAAGTGGG + Intergenic
1172687674 20:36768758-36768780 TAAAGTTCCATTTTACAAATGGG + Intronic
1172750968 20:37251025-37251047 CATAGTTACATTTCCCAAAGTGG - Intergenic
1173713486 20:45180803-45180825 CAAAGTCACATCTCCCAAATTGG - Intergenic
1175337227 20:58204586-58204608 CAAAGTCACATTTTACATGGTGG - Intergenic
1177316951 21:19474603-19474625 CAAATTTTCATTTAACAAGCAGG + Intergenic
1177794042 21:25754234-25754256 AATAGTTACATTTAAAAAGTTGG - Intronic
1177978355 21:27880262-27880284 CAAAGGTACATGTCCCAGGTAGG + Intergenic
950737255 3:15019799-15019821 CAAAGTTACAGTTAAGTAGTAGG + Intronic
955351133 3:58194140-58194162 CAAACTAACATATCCCAAGTTGG + Intronic
956540632 3:70334458-70334480 CAAAATTATGTTTCACTAGTAGG + Intergenic
958684320 3:97373149-97373171 CAAAGTTGCAATTCATAAATAGG - Intronic
959732910 3:109624531-109624553 CAAAGTTACATCTTACATGGTGG - Intergenic
960705681 3:120478459-120478481 CAAAGTTTCAATTAAAAAGTGGG + Intergenic
964967421 3:162514066-162514088 CTAAAATATATTTCACAAGTTGG - Intergenic
970293983 4:14608019-14608041 CACAGCTACATTTCACAACACGG + Intergenic
971077915 4:23171619-23171641 CAAAGTCACATTTTACATGGAGG - Intergenic
971827818 4:31649285-31649307 CAAAGAAACATTCCAGAAGTTGG + Intergenic
972246979 4:37255610-37255632 CAAAGTTCCCTTTCTGAAGTGGG + Intronic
972832836 4:42833822-42833844 CAAAGTCACATTTTACATGGCGG - Intergenic
974131479 4:57761613-57761635 CATAGTTACATTTTTCAAGTCGG + Intergenic
974178551 4:58357241-58357263 CAAAGTCACATCTTACAAGGTGG - Intergenic
974953128 4:68605184-68605206 CAAATTCACATATCACAAGGTGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976112979 4:81696791-81696813 GAAAGTTTCATTTCACTATTAGG + Intronic
976247810 4:83021113-83021135 CGAAGTTACAGTGCACCAGTTGG - Intergenic
976354378 4:84099270-84099292 AAAAGGTACATTTAACAATTCGG + Intergenic
976418298 4:84805595-84805617 TAAAATTACATTTCATAATTTGG + Intronic
976557368 4:86465042-86465064 GAATGTACCATTTCACAAGTTGG - Intronic
976872771 4:89814971-89814993 CAAAGTTACCTGACATAAGTAGG + Intronic
978043742 4:104100627-104100649 CAAAGTTATGTTTCACATGGTGG - Intergenic
979442493 4:120767921-120767943 CAAAGTCACATTTTACATGGCGG - Intronic
980234996 4:130093509-130093531 CAGAGTTAGATTACACATGTTGG - Intergenic
980452568 4:132994024-132994046 AAAAATTAATTTTCACAAGTAGG - Intergenic
982477093 4:155867368-155867390 CAAAGTTACATCTAACATGGAGG + Intronic
983107124 4:163700808-163700830 TCAAGTAACATTTCAAAAGTAGG - Exonic
984333290 4:178354919-178354941 CAGAGTCTCATTTCACAAGCTGG + Intergenic
984800553 4:183712242-183712264 CAAGGTTCCATTCCACATGTGGG + Intronic
986154249 5:5158011-5158033 CAAAGTGACATTTAACCAGAAGG - Intronic
986292750 5:6413021-6413043 GAATGTTACATTTCTCAAGGAGG - Intergenic
986378423 5:7158658-7158680 CAAAGTTAAAATTGACAAATGGG - Intergenic
986684067 5:10260239-10260261 CAAAGTCACTTTTCCCAATTAGG - Intronic
987782208 5:22453620-22453642 CAAAGTTACACTTCGCTAGGAGG + Intronic
990528109 5:56648425-56648447 CCAAGCTTCATTTCACAAGAGGG - Intergenic
991447681 5:66717564-66717586 TAGAGTTAAATTTCCCAAGTTGG + Intronic
993175927 5:84485289-84485311 CAGATTTTCATTTCACAAGTTGG - Intergenic
995540827 5:113184396-113184418 CAAAGTAAAGTTTTACAAGTTGG - Intronic
996011540 5:118486247-118486269 AAAAGTTACATTTTACAGGCAGG - Intergenic
997101828 5:130978177-130978199 CAATGATACATTACAGAAGTTGG - Intergenic
997143088 5:131403956-131403978 CAAAGTAAAAATACACAAGTTGG + Intergenic
997367881 5:133337292-133337314 CAAAGGTACATTTTCCAACTAGG + Intronic
997838161 5:137213519-137213541 TCAAGTCACATTACACAAGTGGG + Intronic
998730535 5:145070623-145070645 AAAAGTCTCATTTTACAAGTAGG - Intergenic
998778645 5:145631437-145631459 CAAATTTACATTTACAAAGTGGG + Intronic
1000470963 5:161641342-161641364 GACAGTTACATTTTACAAGAGGG - Intronic
1001004142 5:168035205-168035227 AAATTTTACATTTCATAAGTGGG + Intronic
1010783799 6:79976177-79976199 CAAAGTTACATCTTACATGATGG - Intergenic
1011165559 6:84442057-84442079 CAAAATATCATTTCATAAGTGGG - Intergenic
1012138987 6:95597501-95597523 CAAAGATACATTTTAAAAATTGG + Intronic
1012299536 6:97568701-97568723 CAAAGTTACAATTCTGAATTAGG - Intergenic
1012768066 6:103395034-103395056 CAAACCTACATTTTATAAGTAGG - Intergenic
1012894513 6:104933209-104933231 CAGATTTTCAATTCACAAGTAGG - Intergenic
1013152157 6:107456938-107456960 TAAAGTTACAATTCTTAAGTTGG + Intronic
1013743795 6:113320629-113320651 CAAAGTCACATTTTACATGGAGG - Intergenic
1014218937 6:118780815-118780837 CAAATTTCAATTTCACAATTTGG + Intergenic
1015721608 6:136248488-136248510 CAAAGTCACATTTTACATGGTGG - Intronic
1015721717 6:136249735-136249757 CAAAGTCACATTTTACATGGTGG - Intronic
1016180725 6:141144855-141144877 CAAAGTTACATGTCAAGACTAGG + Intergenic
1016439901 6:144072215-144072237 CAAAGTTAGTTTTCAAATGTAGG - Intergenic
1017969805 6:159302274-159302296 TAAAGTCACATTTTTCAAGTGGG + Intergenic
1021169473 7:17381223-17381245 CAAAGTTACAATAAACAAGTTGG - Intergenic
1021697260 7:23287130-23287152 CAAAGTTACCTTTTAAAAGATGG - Intergenic
1022334656 7:29411258-29411280 CAAAGTGACATTGAACAAGGAGG + Intronic
1024360694 7:48464327-48464349 CAAAGTTATGTCTCATAAGTAGG - Intronic
1027304496 7:76878468-76878490 CCAAGTTACAGTTCATAATTGGG - Intergenic
1027584663 7:80043825-80043847 CAAAGTTACATCTTACATGGTGG + Intergenic
1027676256 7:81162111-81162133 CAAAGTAACATTTAACATGAAGG - Intergenic
1028872038 7:95780809-95780831 CCAACTGACATTCCACAAGTTGG - Intronic
1029854114 7:103496086-103496108 CAAAGTTTGATTTCTCACGTTGG - Intronic
1030201984 7:106915171-106915193 CAATCTTACATTTTAAAAGTGGG - Intergenic
1030250571 7:107439799-107439821 CAAAATGACATTTCAAAAATGGG + Intronic
1030275554 7:107717479-107717501 CAAAGTTACGTTTTACAACAAGG + Exonic
1031748334 7:125535621-125535643 TAAAGTTACCTTTCCCCAGTTGG - Intergenic
1032104202 7:129011661-129011683 CATATTCACATTTCACCAGTTGG - Intronic
1032878762 7:136066179-136066201 AAAAGGTACATTTCACTAGCTGG - Intergenic
1033869443 7:145732700-145732722 CAGAGTTGAATTTCACAAGCTGG + Intergenic
1036434476 8:8720660-8720682 CAAAGTCACATTTTACATGGTGG - Intergenic
1037088886 8:14887958-14887980 CAAAGTTACAGTTCAATAGGAGG + Intronic
1037358124 8:18044459-18044481 CAAAGTTCCATTTGCCACGTAGG + Intergenic
1038967554 8:32592276-32592298 CAAAGTTAAATTTCTCAAGCAGG - Intronic
1039640183 8:39211193-39211215 CAAAATTTCATTTCAAATGTGGG + Exonic
1039851912 8:41375522-41375544 AAACGTTACTTTTCACATGTAGG - Intergenic
1041168567 8:55116496-55116518 GAACGTTACATTTCTCACGTAGG - Intronic
1041426294 8:57724411-57724433 CAAAGTTAATTTTCTCTAGTGGG - Intergenic
1041910602 8:63085438-63085460 CAAAGTAACAGCTTACAAGTTGG - Intronic
1042034384 8:64515565-64515587 CAAAATAACATTTGACAGGTAGG - Intergenic
1043094539 8:75949725-75949747 CAAAGTTACATTTAAACAGGAGG + Intergenic
1043371469 8:79598854-79598876 CAAAGTAAAATTTTATAAGTGGG - Intergenic
1046275387 8:111952208-111952230 CTAAATTAAATGTCACAAGTTGG + Intergenic
1046528157 8:115408076-115408098 CAAAGTTAAACTTCATAAGCAGG + Intergenic
1047671399 8:127151014-127151036 CCAAGTTGCATTTCAGAAGAGGG + Intergenic
1048979025 8:139693201-139693223 CCAAAGTCCATTTCACAAGTAGG + Intronic
1050156827 9:2676201-2676223 TAAAGTTACATCTCACATGCTGG - Intergenic
1050535581 9:6627887-6627909 CAAAGTGATATTTCATGAGTGGG - Intronic
1051292707 9:15561447-15561469 CAAAGTTAAAATACACAATTTGG - Intronic
1051617779 9:19022834-19022856 CAAAGTTACTTTGAACAAGCTGG + Intronic
1051903625 9:22069764-22069786 CAAAGTTACAATTCAATAGGAGG - Intergenic
1052331336 9:27272061-27272083 AAAAGATACATTTAACAAGATGG - Intergenic
1053292503 9:36890610-36890632 CACAGTAACATTCCATAAGTCGG + Intronic
1053565350 9:39243926-39243948 CAAAGTTACATTTCACTATCTGG + Intronic
1053831116 9:42081768-42081790 CAAAGTTACATTTCACTATCTGG + Intronic
1054131802 9:61375113-61375135 CAAAGTTACATTTCACTATCTGG - Intergenic
1054599431 9:67105670-67105692 CAAAGTTACATTTCACTATCTGG - Intergenic
1055194544 9:73572650-73572672 TAAAGTTGCATTTCCCCAGTAGG + Intergenic
1058222102 9:102314905-102314927 CAAAGCTACATTTTACATGGTGG - Intergenic
1059905373 9:118978475-118978497 CAAAGTTTCATCACAAAAGTTGG + Intergenic
1060146999 9:121261477-121261499 CTTATTTACATTTCACAACTAGG - Intronic
1189137801 X:38567330-38567352 CAAAGTTACATCTTACATGGTGG + Intronic
1189565268 X:42235156-42235178 CAAAGTTGCAATTCAAAAATTGG - Intergenic
1191929546 X:66355078-66355100 CAAGGTTTCATTTGAAAAGTCGG - Intergenic
1193776138 X:85644128-85644150 CACAGTTACATGTCACAGGCTGG + Intergenic
1194443047 X:93955908-93955930 CAAAGTCACATCTAACAAGGTGG - Intergenic
1194463197 X:94197756-94197778 CAAAGTGACATCTCACATGGTGG - Intergenic
1194799935 X:98260622-98260644 GCAAGTTACATTTAACATGTTGG + Intergenic
1194844448 X:98787190-98787212 CAAAGTAACATTTCAAGAATAGG + Intergenic
1196514346 X:116551641-116551663 CAAAGTTGAATTTTAAAAGTTGG + Intergenic
1197741605 X:129899195-129899217 CCAACTTACATTTCACAAAAAGG - Intergenic
1199316873 X:146389636-146389658 CAAACTTACTTTTAACAAATGGG - Intergenic
1201912319 Y:19145398-19145420 CAAAGGTACATTTTACATGGTGG - Intergenic