ID: 921525747

View in Genome Browser
Species Human (GRCh38)
Location 1:216215556-216215578
Sequence TTTTGACCTCCTCTGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921525744_921525747 8 Left 921525744 1:216215525-216215547 CCTATTATCAGTGTCCATCACTC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 134
921525742_921525747 12 Left 921525742 1:216215521-216215543 CCCTCCTATTATCAGTGTCCATC 0: 1
1: 0
2: 2
3: 9
4: 137
Right 921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 134
921525741_921525747 13 Left 921525741 1:216215520-216215542 CCCCTCCTATTATCAGTGTCCAT 0: 1
1: 0
2: 0
3: 8
4: 157
Right 921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 134
921525745_921525747 -6 Left 921525745 1:216215539-216215561 CCATCACTCTAGCTATGTTTTGA 0: 1
1: 0
2: 1
3: 7
4: 178
Right 921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 134
921525743_921525747 11 Left 921525743 1:216215522-216215544 CCTCCTATTATCAGTGTCCATCA 0: 1
1: 0
2: 1
3: 9
4: 112
Right 921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921525747 Original CRISPR TTTTGACCTCCTCTGAAGGC AGG Intronic
902191632 1:14767298-14767320 TTTTCACCTGAGCTGAAGGCTGG + Intronic
904635946 1:31881525-31881547 CTTTGAGCTGCTCTGAATGCAGG + Intergenic
905339488 1:37268517-37268539 TTTAAACCTCCTCCTAAGGCTGG + Intergenic
905479965 1:38254888-38254910 TTTTGCCCTCCTCTGAGCTCTGG - Intergenic
907341791 1:53740273-53740295 TTTCGAACTCCTTTGAAGTCTGG + Intergenic
910682865 1:89885147-89885169 TTTTGATATCCTCTGAAATCTGG + Intronic
913384728 1:118247234-118247256 TTCTCCCCTCCTTTGAAGGCAGG + Intergenic
913432165 1:118807413-118807435 TTTTCACTTTCTCTGAATGCAGG - Intergenic
913432228 1:118808018-118808040 TTTTCACTTTCTCTGAATGCAGG - Intergenic
914948249 1:152086004-152086026 TATTGCCTTCCTCTGAAGCCAGG + Exonic
915115834 1:153598929-153598951 CTCTGACCTCCTCTGAAGTTCGG + Intergenic
915551109 1:156634979-156635001 TTTTTTCCTCCTCTAAAGCCTGG + Intergenic
919824610 1:201494458-201494480 TTCTGGCCTCCTTTGCAGGCTGG + Intronic
921525747 1:216215556-216215578 TTTTGACCTCCTCTGAAGGCAGG + Intronic
923523073 1:234751078-234751100 TTTTGTCCTCCTCTAAACACAGG + Intergenic
1066046023 10:31596316-31596338 TAGTGACTTTCTCTGAAGGCTGG + Intergenic
1072169092 10:92843071-92843093 TTTTGAACTCCTCTGAGGACTGG + Intronic
1072212264 10:93257298-93257320 ATTTCAGCTACTCTGAAGGCTGG + Intergenic
1074457930 10:113611716-113611738 CTTAGCCCTCCTCAGAAGGCGGG + Intronic
1076211246 10:128646717-128646739 ATCTGTCCTCCTCTGAAGGAAGG - Intergenic
1076479581 10:130776139-130776161 GTTTGTCCTACTCTGAGGGCTGG - Intergenic
1076496864 10:130903294-130903316 TTTTCACATCCTCTTAAGCCAGG + Intergenic
1079711315 11:23685590-23685612 TTTTGACATCCTCTGCACTCTGG + Intergenic
1080579513 11:33630842-33630864 TTTTTACCTACTCTGCTGGCTGG + Intronic
1080710682 11:34744967-34744989 TTTTGACCTCCTCAGTAGCTGGG - Intergenic
1080723722 11:34874371-34874393 CTTTGAACCCCTCTGTAGGCAGG + Intronic
1083587068 11:63867967-63867989 TTGTTACCTTCTTTGAAGGCTGG + Intronic
1084378037 11:68791847-68791869 TTTAGAGAACCTCTGAAGGCAGG + Intronic
1085193005 11:74645458-74645480 TTTTGACCTACTAGGGAGGCAGG + Intronic
1085259397 11:75195695-75195717 CTTTGGCCTCCTCTGCAGCCTGG + Intronic
1086208950 11:84294832-84294854 TTTTGACCTCCTTTGAAATTTGG - Intronic
1086327593 11:85719660-85719682 TTTTAACCTCCCCTCAATGCAGG - Intronic
1087591853 11:100199368-100199390 CTTTGGCCTGCTCTGAACGCTGG + Intronic
1089341508 11:117761150-117761172 GTGAGACCTCCTCTGGAGGCTGG - Intronic
1090643241 11:128746978-128747000 TTTTGACCCCATCTGCAGCCAGG + Intronic
1090825332 11:130381101-130381123 TTTTGACCTCTTACAAAGGCTGG + Intergenic
1091165603 11:133473164-133473186 CTTTGACCTCCCCCTAAGGCAGG + Intronic
1092755568 12:11760087-11760109 TTCTGATCTCTTCTGAAGGAGGG + Intronic
1094806571 12:34100109-34100131 GTATGACCTTCTCTGAAGTCTGG + Intergenic
1095125415 12:38471569-38471591 GTATGACCTTCTCTGAAGTCTGG + Intergenic
1095642962 12:44505873-44505895 TTAGGACTTCCTCTGAAGGTCGG - Intergenic
1095673750 12:44891861-44891883 TTCTGAGATCCTCTCAAGGCAGG - Intronic
1097743813 12:63277079-63277101 TTTTTACGTCCTTTGAAGACAGG - Intergenic
1099787563 12:87285913-87285935 TTTTCACATCCTCAGCAGGCAGG + Intergenic
1100446996 12:94670119-94670141 TTTTGACCTCCTTTGAAGTCAGG - Intergenic
1102290341 12:111694064-111694086 TTTTGACCTTCTGTGGTGGCTGG + Intronic
1102489321 12:113279716-113279738 TTTTGCCCTCCTCTTATGGCAGG + Intronic
1102583535 12:113907583-113907605 TGTTGACCCCCTCGGAGGGCTGG - Intronic
1103376279 12:120458609-120458631 TTTTTATCTCCTCTGCAGGTAGG + Intronic
1103440750 12:120961150-120961172 TGTGGGCCTCCCCTGAAGGCTGG + Intergenic
1103459501 12:121092749-121092771 ATATCATCTCCTCTGAAGGCAGG - Intergenic
1117226424 14:53665187-53665209 TTTTAACCTCCTGTGAAAACAGG - Intergenic
1118170515 14:63384458-63384480 TTTTGAAATCCTATAAAGGCTGG + Exonic
1118999889 14:70872280-70872302 TTCAGACTTCTTCTGAAGGCAGG - Intergenic
1119718181 14:76873462-76873484 GCCTGACCACCTCTGAAGGCTGG - Intergenic
1120186023 14:81394746-81394768 TGTTGACAGCCTCTGAAAGCTGG + Intronic
1121916981 14:97844356-97844378 CTTTGACCTCCTCTGGGAGCAGG - Intergenic
1122614750 14:103009504-103009526 TTTTGAGCTCCTCTGATTGAAGG - Intronic
1129302801 15:74635748-74635770 TTTTGTCCCCCTCTGGAGCCTGG - Intronic
1129565829 15:76622684-76622706 TTGTGACCTCATCTGAAAGGTGG + Intronic
1129898926 15:79130536-79130558 CTCTGACCTGCTCTGAGGGCAGG + Intergenic
1132303003 15:100788023-100788045 TTTTGGCATCCTGTGATGGCAGG + Intergenic
1133972105 16:10575577-10575599 TGATAACCTCCTCTGAAGACAGG + Intronic
1133981465 16:10635958-10635980 TTCTGACCTCCTCTGACTGGGGG + Intronic
1137483045 16:48868319-48868341 CTTTCACCACCTCTGAAGGCTGG + Intergenic
1139599567 16:67978492-67978514 TTGTGACCTCAGCTGAAGGTGGG - Exonic
1141723219 16:85768402-85768424 TTTTGAGCTCCTCAGAAAGCTGG + Intergenic
1142282610 16:89156471-89156493 TTTTGACCTCCTAGGGAGGCTGG + Intergenic
1144046021 17:11455442-11455464 TTTTGTTCTCCTAAGAAGGCTGG - Intronic
1145870796 17:28271534-28271556 TTTCCACCTCCTCTGGAGACTGG + Intergenic
1146265262 17:31448673-31448695 ATTTTGCCTCCTCTCAAGGCTGG + Intronic
1146522390 17:33536111-33536133 TTTTTTCCACCTGTGAAGGCTGG + Intronic
1147232459 17:39029318-39029340 CTTCCACCTCCTCTGGAGGCTGG - Intergenic
1149417517 17:56475284-56475306 TTTTGACCTCCTCAAAAGTAGGG + Intronic
1150787605 17:68175578-68175600 GTCTGACCTCCTGTGAAGGAAGG - Intergenic
1152371802 17:79892938-79892960 TCTTGACCTCCCCTGGAGGCTGG + Intergenic
1163137780 19:15325174-15325196 TTTTAACCTCATCTGAAAGATGG + Intronic
1166807966 19:45498345-45498367 CTTTGACCTGCTCTTTAGGCGGG - Intronic
1167735845 19:51294117-51294139 TTTTCTCCCCCTCTGGAGGCTGG + Intergenic
925808319 2:7674058-7674080 ATTTTACCTACTCAGAAGGCTGG + Intergenic
925883792 2:8376786-8376808 TTTTGCCCTCCTCAGAATGGAGG + Intergenic
927060290 2:19412360-19412382 TTTAGACTTCCTCCCAAGGCAGG - Intergenic
930799922 2:55433359-55433381 TTTTGACCTCCTATGAATCGTGG + Intergenic
932192499 2:69752654-69752676 CTTTGAGCTCCACTGAGGGCAGG + Intronic
933823620 2:86138569-86138591 GTCTGCCATCCTCTGAAGGCCGG + Exonic
934040703 2:88125659-88125681 TTGTGACCACCCCTGAAGGCAGG + Intronic
935451094 2:103210400-103210422 TTTTGACTTCTTCTTAAGGGTGG + Intergenic
937274457 2:120674960-120674982 TTTGGACACCCTGTGAAGGCAGG - Intergenic
938143777 2:128817477-128817499 TTTCTACCTCCTCTGCAGCCAGG + Intergenic
939563053 2:143754373-143754395 TTTTTCCCACCTCTGCAGGCTGG + Intronic
940184568 2:150969195-150969217 TTGTCACCTACTCTGAAGGCTGG - Intergenic
943072677 2:183160281-183160303 TTTTGACTTCCTCTGAAATTTGG + Intronic
945471079 2:210228619-210228641 TCTTGACCCCCTTTGCAGGCAGG + Intergenic
946141236 2:217692396-217692418 TGTGGACCGCCTCTGAGGGCTGG - Intronic
1169672624 20:8120006-8120028 TTTTAAAGTCTTCTGAAGGCTGG - Intergenic
1172831280 20:37837258-37837280 TTTTGTCTTCCTGTGAAGGCAGG + Intronic
1178109177 21:29353591-29353613 TTTCAACCACCTCTGTAGGCTGG - Intronic
1178275255 21:31231004-31231026 TTCTGGCCCCCTCTGAAGCCAGG + Intronic
1182993317 22:34789246-34789268 TATAGACCACCTCTGGAGGCAGG + Intergenic
1183076955 22:35433360-35433382 CTGTGATCTCATCTGAAGGCTGG - Intergenic
1185401887 22:50623242-50623264 TGTTGGCCTCCTCTGCAGGGAGG - Intronic
953436552 3:42881801-42881823 TTATTACCTGCTCTAAAGGCAGG - Intronic
956351527 3:68342089-68342111 TTTTGACCAATTCTGAAAGCTGG + Intronic
956878057 3:73483081-73483103 AATTGACCTCCTCTGAAGTACGG - Intronic
961433652 3:126901282-126901304 TTTTGCCGTCCTCTGACGGGAGG + Intronic
961869839 3:129979239-129979261 CATAGACCGCCTCTGAAGGCAGG + Intergenic
963046785 3:141108430-141108452 CTTTGGCCTCATCTGAATGCTGG - Intronic
966470005 3:180278528-180278550 TAGTGAACTCCACTGAAGGCAGG + Intergenic
967014976 3:185473523-185473545 TTCTGGCCTGCACTGAAGGCAGG - Exonic
967438794 3:189482077-189482099 TTTTGGCATGCTCTGAAAGCTGG - Intergenic
967808295 3:193734395-193734417 TGGAGACCTCCTGTGAAGGCAGG - Intergenic
969470024 4:7382160-7382182 CTTTGCCCTGCTCTGAGGGCTGG - Intronic
970593821 4:17581761-17581783 TCTGGACCACCTCTGAAGGCAGG + Exonic
970613032 4:17743123-17743145 TCTTGACCTCCTTTGTGGGCAGG - Intronic
980084919 4:128380790-128380812 GGTTGACCTCTTCTGCAGGCTGG + Intergenic
988698119 5:33644715-33644737 TTATGAACTCATCTGAAGGGTGG + Intronic
991300204 5:65122233-65122255 TTTTCTCCTCCTCTGAGAGCTGG - Intergenic
991522283 5:67514516-67514538 TTTAGACTTCCTCTGATGACTGG + Intergenic
992742466 5:79787721-79787743 TGTTGTGCTCCTCAGAAGGCAGG - Intronic
995226114 5:109703084-109703106 TTTGGAAAGCCTCTGAAGGCAGG - Intronic
998620625 5:143790477-143790499 TTTTGGCTTGATCTGAAGGCTGG + Intergenic
999880260 5:155855171-155855193 TTCTGACCTGCTCTGAATGTGGG - Intergenic
1000458855 5:161486898-161486920 TTTTGATATCCTCTGAAGTCAGG + Intronic
1003293511 6:4803461-4803483 TTTTATCCTGCTCTGAAGCCTGG + Intronic
1003752220 6:9071883-9071905 TTCTTACCTCCTATGAATGCTGG - Intergenic
1003757464 6:9137683-9137705 TTTTTTCCACTTCTGAAGGCTGG - Intergenic
1006786858 6:36673943-36673965 TCTGGACCACCTCTGAAGGCAGG + Intergenic
1007746763 6:44047901-44047923 TCTTGGCCTCCCATGAAGGCTGG + Intergenic
1010932275 6:81817605-81817627 TTTTCATTGCCTCTGAAGGCAGG + Intergenic
1011248478 6:85344800-85344822 TTATGACCTCCTCTGGAAACAGG + Intergenic
1011765390 6:90614298-90614320 TTATGACCTCCTTTGAGGGCAGG + Intergenic
1012455186 6:99395477-99395499 TATTGACCTCCTCCTAAGGGTGG + Intergenic
1015343200 6:132126299-132126321 TTTTGCACAGCTCTGAAGGCTGG + Intergenic
1030655839 7:112166916-112166938 TTCTCAGCTACTCTGAAGGCTGG - Intronic
1032464920 7:132138131-132138153 TTTTCACCTGCTCTGAAGAGAGG + Intronic
1033621325 7:143064380-143064402 TTTTGTCCTCCTCTGAGTCCCGG + Intergenic
1035830794 8:2692156-2692178 TGTGGACCTCCTCTGGAGACGGG + Intergenic
1038420492 8:27431145-27431167 TTTTGACTTCCACCGACGGCAGG - Intronic
1043295662 8:78659609-78659631 TTTTGTTCTCCTCTGTTGGCTGG - Intergenic
1043778013 8:84294910-84294932 TTTTGCCCTGCTTTGAATGCAGG - Intronic
1045320086 8:101075747-101075769 ATTAGAGCTCTTCTGAAGGCTGG - Intergenic
1045328235 8:101133205-101133227 TTTGGACCACCTCTGAGGACAGG + Intergenic
1046228326 8:111316617-111316639 TTCTGACTTTCTCTGAGGGCAGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1187108234 X:16267456-16267478 TTTTGTATTCCTTTGAAGGCTGG + Intergenic
1189295957 X:39917911-39917933 TTTTAGCCTCCTTTGCAGGCTGG - Intergenic
1189587745 X:42477991-42478013 TTTTGACCTCCTCAAAAGGAGGG - Intergenic
1190246300 X:48692797-48692819 TTTTCTCCTCCTCTAAAGGTAGG - Intergenic
1193049825 X:77087931-77087953 TTTTGTCCCCCTCTGAAGTCAGG - Intergenic
1195942079 X:110175129-110175151 TTTTGGCCCTCTTTGAAGGCAGG + Exonic
1198750685 X:139933542-139933564 TTTTCACCGCCCCTTAAGGCGGG + Intronic
1200897653 Y:8392740-8392762 TTTTAACCTCCTTTGTAGGCAGG + Intergenic