ID: 921527371

View in Genome Browser
Species Human (GRCh38)
Location 1:216234437-216234459
Sequence ACATATCCAGAAATAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 267}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921527368_921527371 2 Left 921527368 1:216234412-216234434 CCTGACAGCAATTTCCCTTATAT 0: 1
1: 0
2: 0
3: 13
4: 137
Right 921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG 0: 1
1: 0
2: 0
3: 20
4: 267
921527367_921527371 5 Left 921527367 1:216234409-216234431 CCACCTGACAGCAATTTCCCTTA 0: 1
1: 0
2: 0
3: 11
4: 152
Right 921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG 0: 1
1: 0
2: 0
3: 20
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921527371 Original CRISPR ACATATCCAGAAATAGAGCA TGG Intronic
900854291 1:5168335-5168357 AAATATCTAGAATTTGAGCAGGG + Intergenic
901815441 1:11790989-11791011 ACATTTCCCGGAATAGAACAAGG + Intronic
902151018 1:14443403-14443425 ACACATCCAGAGATGGAGGATGG + Intergenic
902305218 1:15532498-15532520 ACAGATCCTGAAACAGAGGAGGG - Intronic
905643539 1:39608945-39608967 ATATGGCCAAAAATAGAGCATGG + Intergenic
905978943 1:42205280-42205302 ATATAGCCAGAAATAGTACATGG - Intronic
906552231 1:46674552-46674574 ACATATCCTGTGATAGAGCTGGG - Intergenic
909683361 1:78317915-78317937 AGATATGAAGAAATAGAACAAGG - Intronic
909813198 1:79957629-79957651 ACATATCCAGCAGTAGAGACTGG + Intergenic
910298516 1:85678171-85678193 TCCTGTCCAGAAATACAGCATGG - Intronic
910341298 1:86191028-86191050 ACATAGTCAGAAACAGAGTAGGG - Intergenic
910404996 1:86878766-86878788 AGATATTCTGAAATAGAACATGG - Intronic
911472874 1:98340027-98340049 ACATATCAACAAATAAAGCAAGG - Intergenic
911488212 1:98528598-98528620 ACATGGCCAGAAAAGGAGCAGGG - Intergenic
916563787 1:165955690-165955712 ACAAATACAGAAAGAGAACATGG - Intergenic
918246284 1:182662484-182662506 AGATATCCAGTAATAGAGCTGGG + Intronic
918655301 1:187018431-187018453 ACATATCCATTAGTAGAGCTGGG - Intergenic
919389914 1:196970486-196970508 AGATATGCAGAAATAAAACAAGG + Intergenic
919529597 1:198700628-198700650 ACAGATCCAGAAATAGTGGAGGG + Intronic
920672528 1:208015479-208015501 ACTGAGACAGAAATAGAGCAAGG - Intergenic
921527371 1:216234437-216234459 ACATATCCAGAAATAGAGCATGG + Intronic
921740023 1:218673458-218673480 ATATAACCAAAAACAGAGCAGGG + Intergenic
924199889 1:241647742-241647764 TCATATTCAGAAATAGGGCCTGG - Intronic
1064456500 10:15492187-15492209 ACATATCCAGAAAGAAATCTGGG - Intergenic
1064729195 10:18311969-18311991 ACATACCCAGAAGTATAGAAGGG - Intronic
1065146543 10:22774201-22774223 ACATATCCAGATATACACAAGGG - Intergenic
1068547248 10:58361407-58361429 ATAATCCCAGAAATAGAGCAAGG - Intronic
1068846506 10:61682301-61682323 ACCTAACCAGAAAAAAAGCAAGG + Intronic
1070730498 10:78824543-78824565 ACACATCCATAAACAGAGCTTGG + Intergenic
1073635342 10:105192480-105192502 ACATCTTCAGAAACAGAGCAGGG - Intronic
1073798569 10:107015344-107015366 ACACACACACAAATAGAGCAGGG + Intronic
1073821176 10:107265988-107266010 ATATATTCAAAAATAGAGGAAGG - Intergenic
1073918087 10:108429195-108429217 ACACATCCAGAAATAAAACCAGG + Intergenic
1074132597 10:110594716-110594738 ACATATACAGAAACAAAGCTTGG - Intronic
1074511476 10:114116555-114116577 ACAGCTCCAGACCTAGAGCAAGG + Intergenic
1074626426 10:115192925-115192947 ACATATCCAGTAATGTTGCAGGG - Intronic
1074716923 10:116228389-116228411 CCATAGCCAGAAATAGAGAGTGG - Intronic
1076451304 10:130558732-130558754 ACAAATACAGAAAAAGAACATGG - Intergenic
1076784081 10:132740695-132740717 ACATGTCTAGAAATAAAGAAGGG - Intronic
1078875426 11:15390575-15390597 AAATATAAAGAAATACAGCAGGG + Intergenic
1080111619 11:28574487-28574509 ATGCATCCAGAAACAGAGCAAGG - Intergenic
1080582223 11:33653041-33653063 ACATATCCAGAGAAAGTGAATGG + Intronic
1080852991 11:36087492-36087514 ACATATACAAAAATACAGCCTGG - Intronic
1081114057 11:39176020-39176042 ACAAGTCTAGAAATAGAGCCTGG + Intergenic
1083974174 11:66103826-66103848 AAATATACAAAAATAGAGAAAGG + Intronic
1085239760 11:75043483-75043505 AGATAGTCAGCAATAGAGCAAGG - Intergenic
1086280566 11:85182693-85182715 ACATATTCAGAAATTTAGCTGGG + Intronic
1087396354 11:97604773-97604795 ACATCTGCAGTAATGGAGCAGGG + Intergenic
1091518190 12:1208461-1208483 ACAGAACAAGATATAGAGCAGGG - Intronic
1093492703 12:19723705-19723727 ACATATCCAGAAGCAAAGAAAGG + Intergenic
1096766110 12:53891265-53891287 TCATATCCAAAACTAGAGCAAGG - Intergenic
1096951889 12:55481551-55481573 AAATTTCCAACAATAGAGCATGG - Intergenic
1098896773 12:76071656-76071678 ACATTTCTAGAACTAGGGCAAGG + Intronic
1099123272 12:78719480-78719502 ACATATCAAGAAACAAAACATGG - Intergenic
1099717819 12:86319012-86319034 ACATCTTAAGAAATAGAGCTTGG - Intronic
1100301244 12:93309901-93309923 AAATATCCCAAAATAAAGCAAGG + Intergenic
1102793082 12:115664136-115664158 ACAAATCCAAAAATAGACAAGGG + Intergenic
1103550431 12:121733152-121733174 AAATATCCAGCAATAGGGGAAGG + Intronic
1105254724 13:18736027-18736049 ACAAGTCCAGAAATAGTCCAGGG - Intergenic
1106625674 13:31418646-31418668 ACATATGCAGTAATAGAACCAGG - Intergenic
1108069236 13:46610681-46610703 ACATATACAGAGATAGATAATGG - Intronic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108971680 13:56383233-56383255 ACATATAATTAAATAGAGCATGG - Intergenic
1109616905 13:64847439-64847461 ACATATCTAAACATAGAGAAAGG - Intergenic
1109694998 13:65943219-65943241 ACCTTTCCAGAAATAGAGAATGG + Intergenic
1110110562 13:71739651-71739673 ACAGCTCTAGAAATAGAGCTAGG + Intronic
1110481767 13:75986370-75986392 AAAGATCCAGGAAAAGAGCATGG - Intergenic
1111640097 13:90957776-90957798 AAATATCTACAAATAGAGCAAGG + Intergenic
1112040821 13:95546075-95546097 ACATATACAGAAATGAAGTAAGG + Intronic
1112256754 13:97841042-97841064 ACATAGAGAGAAATAGAGAAGGG - Intergenic
1112490200 13:99855946-99855968 ACATTTCCAAAAACAGAGGATGG - Intronic
1112962839 13:105149190-105149212 ACATAACCAAAAGTAGATCAAGG - Intergenic
1116233656 14:42250169-42250191 ACATAACAAGATATAAAGCAAGG + Intergenic
1116372487 14:44153986-44154008 ATATATTCAGAAATTGAGAATGG + Intergenic
1116598923 14:46893309-46893331 AAATACACAGAAATAGAACATGG + Intronic
1118228041 14:63921406-63921428 AAATATCTAGAAAAAGAGAAGGG + Intronic
1118536430 14:66771507-66771529 ATATAGCCAGAAAGAGATCAAGG + Intronic
1118798792 14:69169924-69169946 ACAATTTCAGAAATAAAGCAGGG - Intergenic
1118949454 14:70420728-70420750 AAATGTGCAAAAATAGAGCAAGG - Intergenic
1119702707 14:76766116-76766138 AGATACCCAGTAATGGAGCAGGG + Intronic
1120064669 14:80027146-80027168 AAATATGCACAAATAGACCAAGG + Intergenic
1120239118 14:81929026-81929048 ACTTGTCTAGAAATAGAGTAAGG - Intergenic
1121191329 14:92032961-92032983 ACTTATACAGAAATAGAGATGGG + Intronic
1121885160 14:97536045-97536067 ACCCATCCAGAATAAGAGCATGG + Intergenic
1126727789 15:51650410-51650432 ACATTTTTAGAAATAGAGAAAGG + Intergenic
1126857220 15:52850389-52850411 AGGTACCCAGAAATAAAGCATGG - Intergenic
1127303167 15:57677422-57677444 ACATAGCCAGAATTAGAACCAGG + Intronic
1129416586 15:75386370-75386392 AGATATCCAAAAAGAGAGTATGG - Intronic
1131772792 15:95758649-95758671 CCATGTCCAGAAATAGAACATGG - Intergenic
1136632261 16:31495770-31495792 ACAGATGAAGAAATAAAGCATGG - Intronic
1137841009 16:51640870-51640892 ACAGTTCCAGGAAAAGAGCAGGG + Intergenic
1137907801 16:52342018-52342040 ATATATAGAGAAAAAGAGCAGGG - Intergenic
1139430009 16:66906058-66906080 ACATAAACAGAAAGAGAGAAAGG - Intergenic
1139909791 16:70390627-70390649 ACATCACCAGAAAGATAGCAAGG - Intronic
1140339657 16:74145343-74145365 TCAGATTAAGAAATAGAGCATGG + Intergenic
1143252275 17:5532580-5532602 ACATATACAAAAATAGTACAAGG - Intronic
1146115123 17:30129506-30129528 AAATATCAAGAAATAGTGAAAGG - Intronic
1147162282 17:38575152-38575174 AGACATCCAGAAACAGAGCAGGG - Intronic
1147931723 17:43985658-43985680 ATATATCCAGAGATAGCACAAGG + Intronic
1149586975 17:57796660-57796682 CCATATCAAGAAACAGAACATGG + Intergenic
1150158511 17:62874191-62874213 ACATTTCAAGAAAGAAAGCAGGG - Intergenic
1150537888 17:66063222-66063244 AGAAATCGAGAAAAAGAGCAAGG - Intronic
1150977885 17:70109424-70109446 ACAGATCCAGATATGGAGCTGGG - Intronic
1152458082 17:80427438-80427460 AAGCATCTAGAAATAGAGCAAGG + Intronic
1153839747 18:8996063-8996085 AAATTACCAGAAATAGAGCTTGG + Intergenic
1154436304 18:14344588-14344610 ACAATTCCAGAAATAGTCCAGGG + Intergenic
1155495835 18:26440713-26440735 ACTCATTCAGAAATGGAGCAGGG - Intergenic
1156391655 18:36656197-36656219 ACAAAGGCAGAAATAGAGAAGGG - Intronic
1156528200 18:37788489-37788511 ACATATCAAGAAACAGAACATGG - Intergenic
1156570442 18:38246262-38246284 TGATATCCAGAAAAAGAGCAAGG - Intergenic
1158039153 18:53071531-53071553 ACACATGCACAAATAGAGGATGG + Intronic
1159090265 18:63840374-63840396 CCAGATCCAGAAATGTAGCAGGG + Intergenic
925061985 2:898409-898431 AAATATCTAGAAAAGGAGCAGGG + Intergenic
925591488 2:5514341-5514363 GCAAATCCAGAAATGCAGCAAGG + Intergenic
926450380 2:12996541-12996563 ACATATTCAGAAAAAAATCAAGG + Intergenic
926781071 2:16472351-16472373 ACACAGCCAGTAATAGAACAGGG + Intergenic
928012258 2:27620741-27620763 ACGTATCTAGAAACAGAGCTGGG + Intronic
928279467 2:29931484-29931506 ACATGTCCAAAAATAGAGATTGG - Intergenic
929598778 2:43192169-43192191 ACACAGCCAGAAACAGATCAAGG + Intergenic
930001338 2:46863736-46863758 TCAAATCCAGAAAGAGAACAAGG + Intergenic
931595426 2:63937527-63937549 ACATTTCCACCAATAGTGCAGGG - Intronic
932626253 2:73298562-73298584 ACAGATGGAGAAATTGAGCATGG + Intergenic
932631535 2:73347559-73347581 AAATCTCCAGACATAAAGCAAGG - Intergenic
934485198 2:94701280-94701302 ATATACCAAGAAATAGAGCTGGG + Intergenic
935114042 2:100119095-100119117 ACAAATCCAGAATTAGGGCTAGG - Intronic
935579294 2:104742843-104742865 AAATATCCAGAAATATCCCAGGG + Intergenic
935757023 2:106284163-106284185 CCGTATCCAGAAATAGATGATGG + Intergenic
939086875 2:137730363-137730385 ACATATGCAGAAGTATTGCATGG + Intergenic
939499326 2:142963015-142963037 ACGTTTTCAGAAATAAAGCATGG + Intronic
939635057 2:144571717-144571739 AAATATCTAGATCTAGAGCAAGG - Intergenic
939879516 2:147614089-147614111 AAATATGCTGAAATAGAACAGGG - Intergenic
939920917 2:148112077-148112099 ACATACCCAGAAATAAGGGAAGG + Intronic
940914654 2:159240976-159240998 ACATTTCCAGAACTAGTGAAAGG + Intronic
941267454 2:163380214-163380236 ACATATCAAAACATAGAACAGGG + Intergenic
941459885 2:165757192-165757214 ACATGTCCAACAACAGAGCAAGG + Exonic
942482574 2:176404891-176404913 AAATAACCAGAAATAGAGGTAGG - Intergenic
942896578 2:181063268-181063290 ACATACTCAGAAATAGATCTGGG - Exonic
943028433 2:182656816-182656838 ACACATACTGAAATAGAGCTTGG + Intergenic
943068842 2:183117570-183117592 TCATCTTCAGAAAGAGAGCAAGG - Intronic
943692552 2:190882473-190882495 ACAAAGCCAGAAAAAGAGTAAGG - Intronic
944283096 2:197921157-197921179 ACATATCTAAAAATAGAAAAGGG + Intronic
946525369 2:220513226-220513248 GAATATTCAGAAATAGAGTAAGG + Intergenic
947710508 2:232311423-232311445 CCATGTCAAGAAATAGAACATGG + Intronic
947961776 2:234245605-234245627 AAATAACCAGAAATAGAGGGTGG - Intergenic
1169135370 20:3194108-3194130 ACCTCTCCTGAAAGAGAGCAGGG - Intronic
1170205301 20:13791683-13791705 AGGGATCCAGAAATAGAGCCAGG + Intronic
1172591801 20:36122948-36122970 ACATCTCCAGGAAGCGAGCAAGG - Intronic
1172981062 20:38942069-38942091 ACATATCCAGAAATTGAGAGAGG - Exonic
1173171707 20:40730808-40730830 ACATATACAAAAATAGAGAAGGG - Intergenic
1175759966 20:61555556-61555578 ACATAACCAGAAAGACAGAAAGG - Intronic
1176840734 21:13841063-13841085 ACAAGTCCAGAAATAGTCCAGGG - Intergenic
1177397384 21:20555000-20555022 ACATAGCCAGTAATAATGCACGG + Intergenic
1178374388 21:32055010-32055032 AAATTTCCAGCAATAGAGGACGG - Intergenic
1179271786 21:39857141-39857163 TCAGATCTAAAAATAGAGCAAGG + Intergenic
1180097892 21:45568749-45568771 ACATATCCACAAATAAATGAAGG + Intergenic
1180114043 21:45684598-45684620 ACATAAACAGAAAGAAAGCAAGG - Intronic
952993334 3:38852628-38852650 TCATTTCCAGTAATAGAACAAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955365805 3:58308897-58308919 ACCTATCCAGAGGGAGAGCAAGG + Intronic
956275170 3:67491656-67491678 CCAGATCAAGAAATAGAACATGG - Intronic
956338309 3:68190302-68190324 ACTTATCCAGAAGTATAGCCAGG - Intronic
957579777 3:82056057-82056079 AAATATTCAGAAACATAGCAGGG - Intergenic
959109555 3:102105566-102105588 ACAGATCCTGGAGTAGAGCAAGG - Intronic
959981915 3:112527201-112527223 ACATAACCAGTAATAGCACAGGG - Intergenic
962491194 3:135895682-135895704 GCTTATCAAGAAAGAGAGCAAGG + Intergenic
962798266 3:138867438-138867460 ACAACTACAGAAATAGAGAATGG - Intergenic
965455891 3:168900020-168900042 ATATATCCAGAAATAGCCTATGG - Intergenic
965550171 3:169956435-169956457 TTAGACCCAGAAATAGAGCATGG - Intergenic
965925139 3:173969536-173969558 ACATATATAAAACTAGAGCAAGG + Intronic
966040076 3:175472976-175472998 AAGTATCCAGAAATAGAGGAGGG + Intronic
966134722 3:176685300-176685322 ACATATACAGAAAGACAGAAGGG + Intergenic
966635295 3:182126343-182126365 CCTCATGCAGAAATAGAGCAAGG - Intergenic
970215910 4:13760398-13760420 AAACATACAGAAATAGAACAAGG - Intergenic
970347292 4:15164972-15164994 ACTGATCCAGGAAGAGAGCATGG + Intergenic
971229352 4:24787434-24787456 ACATATCAAGCTATAGAGGATGG - Intergenic
971773901 4:30934874-30934896 ACATTTCCAGAAAGAGAACCTGG + Intronic
972191405 4:36596112-36596134 ACATATCATGAAATGGGGCAGGG + Intergenic
972211646 4:36845553-36845575 AAATATTCTGAATTAGAGCAAGG + Intergenic
972425992 4:38933338-38933360 ACATATACATGAATAGAGAAAGG + Intronic
975745686 4:77472298-77472320 ACATGTCCAGGCATGGAGCAGGG - Intergenic
976853054 4:89571061-89571083 AAACATACAGAAGTAGAGCATGG + Intergenic
978227457 4:106354460-106354482 ATAAATCCAGAAATAGATCCAGG + Intergenic
979120938 4:116900105-116900127 ATATATACAGAGAGAGAGCAAGG - Intergenic
980205201 4:129710075-129710097 TTATTTCAAGAAATAGAGCAGGG + Intergenic
981014229 4:139956785-139956807 ACAGATCTAGAAGTAGGGCAAGG + Intronic
982574571 4:157093373-157093395 ACATATGCATACATACAGCATGG - Intronic
982936130 4:161478385-161478407 ACATATACATACATAAAGCAAGG - Intronic
984046525 4:174806510-174806532 AAATATTCAGAAAAAGAGGATGG + Intronic
984442507 4:179791280-179791302 ATATATCCTGATATAGTGCATGG + Intergenic
986206488 5:5629483-5629505 ACATATTCAGAAAGAGACCATGG - Intergenic
986973361 5:13364022-13364044 ACATATCCAGAAATAAAGTGTGG + Intergenic
987383523 5:17308001-17308023 ACAGATCCAGAAATGGATTAAGG + Intergenic
987638756 5:20583227-20583249 ACAAATCCAGAAAAGTAGCAAGG + Intergenic
987729513 5:21750644-21750666 ACATATCAAATAATAGAGGATGG - Intergenic
988529287 5:32013633-32013655 AGAAACCCAGAAATAGAGCCAGG - Intronic
988688821 5:33551100-33551122 CCATAGCCAGAAAGACAGCATGG - Intronic
988836938 5:35042830-35042852 ACCTATTCAGAAATAGACCTTGG - Intronic
990772630 5:59266603-59266625 ATATATTGAGAAATAGAACATGG - Intronic
990809737 5:59709495-59709517 AGATAGCCAGAAACACAGCAGGG + Intronic
993074296 5:83208467-83208489 ATATATCCAGAAGTAGAGTAGGG + Intronic
993482081 5:88436278-88436300 ACATATCCAGAACTCGAGATGGG - Intergenic
996134670 5:119825639-119825661 ACAAAGCCAGAAATAGAACCTGG + Intergenic
997311833 5:132892315-132892337 AAAGATCCAAAAACAGAGCATGG - Exonic
997466461 5:134091225-134091247 GAAGATCAAGAAATAGAGCACGG + Intergenic
998696827 5:144650420-144650442 ACAAATATAGAAATAGAGAAGGG + Intergenic
998830763 5:146155916-146155938 AAATATCCATTAATAGAGAATGG + Intronic
998924394 5:147105925-147105947 ACAGGTCCAAAAATAGAGAAGGG + Intergenic
999220905 5:149976646-149976668 AAATAGCCAGAAAAAGAGAAAGG - Intronic
999721356 5:154401325-154401347 AGACGTTCAGAAATAGAGCAGGG + Intronic
1000877459 5:166658611-166658633 CCATATTTAGAAATAGACCAAGG - Intergenic
1003377168 6:5590331-5590353 ACATCTCCAGGAATAGTGCTGGG - Intronic
1003447996 6:6202400-6202422 ACATCTCCAGCACTAGAGCAGGG + Intronic
1003486920 6:6588052-6588074 CCAAACCCAGAAATAGAACACGG + Intergenic
1003922065 6:10841793-10841815 ATATATACAGAAATAGAAGAAGG + Intronic
1005235261 6:23754325-23754347 CCCTATCCAGAAATACAGCAAGG + Intergenic
1005580054 6:27225236-27225258 CCATATTCTGAAACAGAGCAAGG + Intergenic
1006167958 6:32076497-32076519 AAATATCCAGCATTAGAACATGG + Intronic
1007499145 6:42281998-42282020 ACATACCCAGGAGTAGAGGAAGG + Intronic
1008451748 6:51659759-51659781 ACTGACCCAGAAGTAGAGCAGGG + Exonic
1008882412 6:56394467-56394489 ACACATGCAGAGCTAGAGCATGG + Intergenic
1008908675 6:56708962-56708984 ACATATCCAAAAAGAGAAAAAGG - Intronic
1009530997 6:64815347-64815369 ACATATCTAGAAACAGAGTTAGG - Intronic
1010225136 6:73481871-73481893 CCATATTCAGAAATAGAATATGG - Intronic
1010312969 6:74409507-74409529 ACATATAAAGAAGTACAGCAAGG + Intergenic
1010940630 6:81912687-81912709 ACATTTCTAAAAATTGAGCAGGG - Intergenic
1011360773 6:86522295-86522317 AAATATCTAGTAATACAGCAAGG - Intergenic
1012228455 6:96732189-96732211 ACATATCAAGACCTAGAGGAAGG - Intergenic
1012709897 6:102585571-102585593 AATTCTCCAGAAATAGAGGAGGG - Intergenic
1016471111 6:144375560-144375582 ACATATCCAAACAAAGAGCCTGG - Intronic
1017116506 6:150982303-150982325 AAATATCAAGTTATAGAGCAGGG - Intronic
1017274560 6:152551092-152551114 TTATATCCACAAATAGAGGAAGG - Intronic
1018738924 6:166712668-166712690 ACACATCAAGAGATAGTGCAGGG - Intronic
1020058803 7:5136934-5136956 TCAAAGCCAGAAACAGAGCATGG - Intergenic
1022321311 7:29290512-29290534 ACATATCTAGAAAGCCAGCAAGG + Intronic
1025111303 7:56218524-56218546 ACACTTCCACAAATAGAGGATGG + Intergenic
1026223708 7:68422635-68422657 ACTTAGCCAGAAATAGAGGCTGG + Intergenic
1026362229 7:69612807-69612829 ATATATACAGAAAGAGTGCAGGG - Intronic
1028399688 7:90411438-90411460 CCATATACAGAAAAAGAACATGG + Intronic
1028442124 7:90875678-90875700 AAATATCTAAAAATAGAGAAAGG - Intronic
1030490741 7:110230990-110231012 AGATATCCTGAAATGAAGCAAGG - Intergenic
1031970226 7:128059623-128059645 GCATCTCCAGAAAGACAGCAGGG - Intronic
1032665776 7:134034811-134034833 ACATATACACAAATAGTGCTTGG - Intronic
1033649479 7:143329957-143329979 AGATCTACAGAAAAAGAGCAAGG - Intronic
1037074051 8:14690494-14690516 ATAAATACAGAAATACAGCAAGG + Intronic
1037095993 8:14988837-14988859 AAATATCCAGAAATAAATGAGGG - Intronic
1037433295 8:18837037-18837059 AAATATCCAGAAGGAGAGAAAGG + Intronic
1039893908 8:41702630-41702652 AAATCACCAGAAATACAGCAAGG + Intronic
1041797557 8:61761296-61761318 GCTTTTCCAGAAGTAGAGCATGG + Intergenic
1042074577 8:64977762-64977784 ATATTTACAGAAATAGAACACGG + Intergenic
1042411520 8:68472040-68472062 AAAAAGCCAGAAAAAGAGCATGG - Intronic
1042950930 8:74200118-74200140 ACATTAGCAGAAAAAGAGCAAGG - Intergenic
1043023292 8:75033481-75033503 ACATATTTAGAAACACAGCAAGG + Exonic
1044096695 8:88075035-88075057 ACATATCCACAAATCTGGCAGGG - Intronic
1044849652 8:96416176-96416198 AAATATCCATCAATAGAGAAAGG + Intergenic
1047580991 8:126215082-126215104 CCTTATCCAGAAATAGGGTATGG + Intergenic
1049318346 8:141981620-141981642 AGATATCCAGAAAGAGAACTTGG + Intergenic
1050238254 9:3605851-3605873 AGATATCAAGAAATAGAGGCCGG - Intergenic
1051004393 9:12325291-12325313 ACATTTCAAGAAAGAAAGCAAGG - Intergenic
1052664691 9:31479960-31479982 ACAGAAGAAGAAATAGAGCATGG + Intergenic
1053668103 9:40331357-40331379 ACAAGTCCAGAAATAGTCCACGG + Intergenic
1053917908 9:42957652-42957674 ACAAGTCCAGAAATAGTCCAGGG + Intergenic
1054379246 9:64471413-64471435 ACAAGTCCAGAAATAGTCCACGG + Intergenic
1054516508 9:66044936-66044958 ACAAGTCCAGAAATAGTCCACGG - Intergenic
1055665973 9:78553522-78553544 TCATCTTCAGAAGTAGAGCAGGG - Intergenic
1056469651 9:86893299-86893321 ACATATAGGGAAAGAGAGCATGG - Intergenic
1057101292 9:92362823-92362845 ACATATACATACATAGAGAATGG - Intronic
1059393724 9:114017465-114017487 AAATATCCAGAAAAGGAGCTGGG - Intronic
1059904028 9:118961718-118961740 ACACAGGCAGAAATAGATCAAGG + Intergenic
1060296663 9:122347840-122347862 ACATCTCCCAAAACAGAGCAGGG - Intergenic
1061035707 9:128113282-128113304 ACAAATAAAGAAATAGAGAAGGG + Intergenic
1185660452 X:1724329-1724351 ACATACCTAGACATAGAACAGGG - Intergenic
1188346402 X:29071878-29071900 ACATACCCAGAAATGGAACTGGG + Intronic
1188685301 X:33062335-33062357 ACATATTCAAAAATAGAGGTTGG - Intronic
1189351972 X:40282291-40282313 ACATATCCAGGAAGCGGGCAGGG + Intergenic
1189699217 X:43699431-43699453 ACCCAGCCAGAAATGGAGCAAGG + Intronic
1191016591 X:55815559-55815581 ACACATCCAGGGAAAGAGCAAGG - Intergenic
1192241884 X:69338083-69338105 AAATCCACAGAAATAGAGCATGG - Intergenic
1194056709 X:89144089-89144111 ACATAAGCATAAATAGAGCCAGG + Intergenic
1194306665 X:92257129-92257151 ACATGGCCAGAAAAGGAGCAAGG + Intronic
1194332276 X:92598586-92598608 ACATTCCCACAAATAGTGCATGG - Intronic
1194543590 X:95204934-95204956 ACACACACAGAAATATAGCATGG - Intergenic
1195907386 X:109858269-109858291 AAATATGCAGAGATAGAACAAGG - Intergenic
1196295951 X:113997744-113997766 ACATATGTAGAGTTAGAGCATGG + Intergenic
1197639156 X:128948984-128949006 GCATAACCACAAATAGAGCAAGG + Intergenic
1199038600 X:143082867-143082889 CCAAATTCAGAAATAGATCATGG + Intergenic
1199329683 X:146544098-146544120 ACATGGCCAGAATGAGAGCAAGG + Intergenic
1200640981 Y:5717637-5717659 ACATTCCCACAAATAGTGCATGG - Intronic
1200768096 Y:7097761-7097783 AGATATCCCCAAATAGAGGAAGG + Intergenic