ID: 921528408

View in Genome Browser
Species Human (GRCh38)
Location 1:216247136-216247158
Sequence CCCTGCCAGTGTAACCTCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921528408_921528410 5 Left 921528408 1:216247136-216247158 CCATGGAGGTTACACTGGCAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
Right 921528410 1:216247164-216247186 ATCCAACATCATTAAAGCTTCGG 0: 1
1: 0
2: 0
3: 13
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921528408 Original CRISPR CCCTGCCAGTGTAACCTCCA TGG (reversed) Exonic
900120140 1:1045361-1045383 GCCTGCCAGTGCAACCCCCATGG + Exonic
900163457 1:1235448-1235470 CCCTGACACTGTCCCCTCCATGG - Intergenic
900325655 1:2107606-2107628 CCCTCCCTGTGTTTCCTCCAGGG - Intronic
900405412 1:2490802-2490824 CCCTGCCAGTGCAGCCCCCCGGG - Intronic
900622688 1:3594619-3594641 CCCCGCCAGTGAAACCGCCTGGG - Intronic
901759423 1:11461029-11461051 CCCTGAGACTGTAACCTCCCTGG + Intergenic
902936477 1:19768483-19768505 CCCTGGAAATGTAAGCTCCAGGG + Intronic
903186337 1:21631339-21631361 CAATGCCAGTGTAAGCTCCAGGG - Intronic
904255367 1:29251316-29251338 CCCGGCCAAGGTGACCTCCAAGG - Intronic
907053514 1:51345101-51345123 TGCTGCCACTGTAGCCTCCACGG - Exonic
907525780 1:55053210-55053232 CCTGGCCAGTGTGACCTGCAGGG - Intronic
907961228 1:59283625-59283647 CCCTGCCACTGTAAAGTGCAGGG - Intergenic
908548967 1:65190336-65190358 CCCTGCAAGTGCAAACTCCTGGG + Intronic
908640695 1:66220012-66220034 GCCTGCCAATTTACCCTCCAAGG + Intronic
910201424 1:84704231-84704253 AACTGCCAGTTTAACCTCCAAGG - Intergenic
912177001 1:107171605-107171627 CCCTGTGTGTGGAACCTCCATGG + Intronic
912679646 1:111720977-111720999 CCCACCCAGTTTACCCTCCAAGG - Intronic
915065302 1:153219850-153219872 CACTGCCTGTGTTTCCTCCATGG - Intergenic
917931962 1:179828804-179828826 CCCAGCCAGTGGAGACTCCAGGG + Intergenic
919679653 1:200421684-200421706 CCAGGCCAGAGTTACCTCCAAGG + Intergenic
919811980 1:201414503-201414525 ACCTGCCAGGCTAACCTGCAGGG + Exonic
920376590 1:205512081-205512103 CCCTGCCTGTGTGTCCCCCAAGG - Intronic
920848300 1:209611594-209611616 CCCTGCCAGCCCAGCCTCCAGGG - Intronic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
921528408 1:216247136-216247158 CCCTGCCAGTGTAACCTCCATGG - Exonic
1063031294 10:2237948-2237970 CCAGGGCTGTGTAACCTCCAAGG + Intergenic
1063133984 10:3200657-3200679 CCCTGCCTGTTTAACCTCACTGG + Intergenic
1064125120 10:12652682-12652704 ACTTCCTAGTGTAACCTCCAGGG - Intronic
1064298879 10:14104202-14104224 CAGTGGCAGTGTAACCCCCATGG - Intronic
1064298882 10:14104237-14104259 CCATGGCAGTGTAAACTCGATGG - Intronic
1064298896 10:14104324-14104346 CAATGGCAGTGTAACCTCGATGG - Intronic
1066186658 10:33016091-33016113 GCCTGCCAGTGCAGCCTGCAAGG - Intergenic
1067153338 10:43753919-43753941 CCCTGCCTCTGCAGCCTCCATGG + Intergenic
1067719986 10:48721072-48721094 CCCTGCCAGACTAATCTCCTTGG - Intronic
1067913454 10:50371282-50371304 CCTTTCCATTGTAACCACCATGG + Intronic
1069005983 10:63317918-63317940 CACTGCCACTCCAACCTCCAAGG + Intronic
1070644786 10:78194424-78194446 CCCTGCCAATTTAAACTCAAAGG - Intergenic
1072783362 10:98264922-98264944 CCCTGCCACTCTCACTTCCATGG + Intronic
1074885241 10:117688305-117688327 CCCAGGCAGTGTAACCCCCTGGG - Intergenic
1075543896 10:123338972-123338994 CCCTGCCAGTGTCTCCTACAGGG + Intergenic
1075597949 10:123746018-123746040 CCCTACCTGGGGAACCTCCAGGG + Exonic
1076782878 10:132734126-132734148 CCATGCCCGTGCAGCCTCCAGGG + Intronic
1077587142 11:3462437-3462459 CCCTCCCACTTCAACCTCCACGG - Intergenic
1079103116 11:17553564-17553586 CCAGGCCAGTGCAGCCTCCAGGG - Intronic
1080837199 11:35950169-35950191 CTCTGCCAGTGTAATCTCGGAGG + Intronic
1084243133 11:67836449-67836471 CCCTCCCACTTCAACCTCCACGG - Intergenic
1084770620 11:71340686-71340708 CCCTGAGAGTGTAAACCCCAGGG - Intergenic
1084829853 11:71760493-71760515 CCCTCCCACTTCAACCTCCACGG + Intergenic
1088984787 11:114896153-114896175 CCTTGCCTGTGTATCCTCCGGGG - Intergenic
1089311607 11:117561720-117561742 CCCTTCCTGAGTGACCTCCAAGG - Intronic
1089374259 11:117983379-117983401 CACTGCCAGGGAAACCTCCCAGG + Intergenic
1089444953 11:118544630-118544652 TCCTCCCAATCTAACCTCCATGG + Exonic
1090764656 11:129866031-129866053 ACCAGCAAGTGTCACCTCCAGGG + Intronic
1092413384 12:8271185-8271207 CCCTCCCACTTCAACCTCCACGG - Intergenic
1094403156 12:30084393-30084415 CACTGCCACTGTAGCCTCCTGGG - Intergenic
1095725277 12:45445642-45445664 GCATGCCACTGTAAACTCCACGG + Intergenic
1099385927 12:82013108-82013130 CACTGCAGCTGTAACCTCCAAGG - Intergenic
1102219626 12:111185819-111185841 ACCTGCCTGTGTCAGCTCCACGG + Intronic
1106059010 13:26267844-26267866 TTCTGCCAGTGTATCATCCATGG - Intronic
1108251213 13:48569906-48569928 GCCTGCCACTGTTACCTGCAAGG - Intergenic
1113973657 13:114210599-114210621 CCCTGCCTGTCTGTCCTCCATGG + Intergenic
1117320981 14:54623108-54623130 TTCTGCCAGTGTATCCCCCAGGG + Intronic
1117665798 14:58054503-58054525 ACTTGCCAGTGAAACCACCAAGG + Intronic
1119757580 14:77129770-77129792 CACTTCCAGTCTATCCTCCAAGG + Intronic
1122275079 14:100587085-100587107 CCGGGCCAGTGAAGCCTCCACGG + Intronic
1122857197 14:104565619-104565641 AACAGCCAGTGTGACCTCCATGG - Intronic
1124139993 15:27068677-27068699 CCCTGCCAGTGCAACATGTAAGG - Intronic
1127528417 15:59817132-59817154 CAATGCCAGAGTAACCTGCAAGG - Intergenic
1132653285 16:1031094-1031116 TCCTGCCAGTGTGGCCTGCATGG - Intergenic
1133335463 16:5004191-5004213 CCCTGCTACTGAACCCTCCATGG - Intronic
1133354595 16:5126689-5126711 CCCTCCCACTTCAACCTCCAGGG - Intergenic
1136775892 16:32871666-32871688 CTCGGCAAGGGTAACCTCCAGGG - Intergenic
1136894724 16:33989846-33989868 CTCGGCAAGGGTAACCTCCAGGG + Intergenic
1138337897 16:56267359-56267381 CCGTGCCAGTGCCAGCTCCAGGG + Intronic
1141752702 16:85969768-85969790 CCCTGCAAGTTTAACCTCTGTGG + Intergenic
1142134195 16:88444156-88444178 CCCTGCCTGCGTCTCCTCCACGG - Intergenic
1203078308 16_KI270728v1_random:1133775-1133797 CTCGGCAAGGGTAACCTCCAGGG - Intergenic
1143720396 17:8805124-8805146 TCCTCCCAGTGGATCCTCCATGG - Intronic
1145057137 17:19710118-19710140 TTCTGACAGTGTAGCCTCCATGG - Intronic
1145193424 17:20867313-20867335 CGCTGGCAGTGTAGCCCCCATGG + Intronic
1145298600 17:21613768-21613790 CGCTGGCAGTGTAGCCCCCATGG - Intergenic
1145351642 17:22089583-22089605 CGCTGGCAGTGTAGCCCCCATGG + Intergenic
1148436589 17:47690447-47690469 CCCTGCCAGTGTTTCCTCCTTGG - Intergenic
1148746954 17:49923913-49923935 CCCTGCCATTGGAACCTTCAGGG + Intergenic
1149070399 17:52535614-52535636 CCCTGCCACAGTGACCTCAAAGG + Intergenic
1149447818 17:56727368-56727390 CCCTGGCAGTGGAGCCTCCTAGG - Intergenic
1151895993 17:76981360-76981382 CCCTGCCAGTGTTTCCTAAATGG - Intergenic
1152403848 17:80085463-80085485 CCCTGCCAGCGCACCCACCATGG + Intronic
1152895271 17:82907305-82907327 CCCTGCCAATGTGACCACCTTGG - Intronic
1154147070 18:11875195-11875217 CCCTGCCAGTGCTGCCCCCAGGG + Intronic
1154356635 18:13626747-13626769 CCCTCCCAGTGTCAACCCCAGGG - Intronic
1156208480 18:34912146-34912168 CCCTGGCAGTCCTACCTCCAGGG + Intergenic
1158609783 18:58928605-58928627 CTCTGCCACTGTCTCCTCCAAGG - Intronic
1160958544 19:1706597-1706619 CCCTGCCAGTGTGCTCTCCGCGG + Intergenic
1164887861 19:31798617-31798639 CCCTGCTAGGGCCACCTCCATGG + Intergenic
1165698167 19:37916881-37916903 CACTGCAACTGTCACCTCCAGGG - Intronic
1166380645 19:42353542-42353564 CCCTGCCAGTGCAACGGGCACGG + Exonic
1166388943 19:42398091-42398113 CCCTGCCAGAGCCACCTCCTGGG - Intergenic
1167116867 19:47493492-47493514 CCCTTCCTGTGTCCCCTCCAGGG - Exonic
1167388651 19:49179845-49179867 CTTGGCCAGTGTAACCTCCAAGG - Intronic
1167894877 19:52572685-52572707 CCCTGGCAGGGAACCCTCCATGG + Intronic
1168393285 19:56028086-56028108 GCCTGCCTGTTTAAGCTCCATGG - Exonic
926700519 2:15800315-15800337 CCCTCACAGTGTAACCTCCCGGG - Intergenic
928115796 2:28544497-28544519 CCCTGCCCTTGTACCCTCCATGG + Intronic
928645917 2:33352527-33352549 TCCTGCCAGTTCTACCTCCAGGG + Intronic
930025022 2:47024553-47024575 CCCTTCCTGTGTACCCACCACGG - Intronic
930995314 2:57710197-57710219 CCCTGCCATTTTTACCTCTAGGG + Intergenic
934916267 2:98303232-98303254 CCATGCCACTCTAGCCTCCAGGG - Intronic
936244244 2:110812912-110812934 TCCTGCCAGTGTAACCACAGAGG - Intronic
936974919 2:118209236-118209258 CCCTACCCTTGTAACCTCCAGGG - Intergenic
937706139 2:124922880-124922902 CCCTGACCATGTAATCTCCATGG - Intergenic
938626674 2:133117409-133117431 CACTGTCAGTGTAATCTCCAAGG + Intronic
942222869 2:173788533-173788555 CCCTGCCAGGATCACCTCCAGGG + Intergenic
1170707930 20:18762200-18762222 CCATGGCAGTGCCACCTCCATGG - Intronic
1171561986 20:26134808-26134830 CGCTGGCAGTGTAGCCCCCATGG + Intergenic
1176649334 21:9530826-9530848 CACTGGCAGTGTAGCCCCCATGG - Intergenic
1183545607 22:38453628-38453650 CCCTGCCCCAGTGACCTCCAAGG - Intronic
1183690001 22:39383064-39383086 CCCTGCCCTTGTGACCTCCCAGG + Exonic
953293139 3:41686679-41686701 CTCTGTGAGTGTGACCTCCAGGG - Intronic
953693282 3:45137958-45137980 CCCTGCCAGGTTTCCCTCCATGG + Intronic
955480625 3:59385734-59385756 CCCTGCCACTCAAACCTCTAGGG - Intergenic
957058483 3:75462374-75462396 CCCTCCCACTTCAACCTCCAGGG - Intergenic
957230833 3:77511839-77511861 CCCTGCAAGTGTAACCTCCCAGG + Intronic
960761935 3:121081557-121081579 CCCTGCCATTCTAACCCCCTAGG - Intronic
961012493 3:123445865-123445887 TCTGTCCAGTGTAACCTCCATGG - Intronic
961294965 3:125877328-125877350 CCCTCCCACTTCAACCTCCAGGG + Intergenic
961345983 3:126263678-126263700 CCCTACCTGTGTTGCCTCCAAGG + Intergenic
961380864 3:126495853-126495875 CCCTCCCAGTGTGGCCACCATGG + Intronic
961890939 3:130129836-130129858 CCCTCCCACTTCAACCTCCACGG - Intergenic
962120412 3:132554929-132554951 TCCTGCAAATGTAACCTCCCAGG - Intergenic
965089360 3:164143313-164143335 CCCTTCAAATGTAACCTTCAAGG - Intergenic
968458265 4:709859-709881 CTCGCCCAGTGTAACCGCCAGGG + Intronic
969326682 4:6448340-6448362 CCCTCTCCGTGTGACCTCCAAGG - Intronic
969751679 4:9116259-9116281 CCCTCCCACTTCAACCTCCACGG + Intergenic
969811592 4:9652558-9652580 CCCTCCCACTTCAACCTCCACGG + Intergenic
971127320 4:23768515-23768537 CCCTGGAAATGTAAGCTCCATGG - Intronic
975700737 4:77063722-77063744 GCTTGCCAGGGTAACCCCCAGGG - Intronic
991967328 5:72106661-72106683 CCCTGCCAGAGTAGAATCCAAGG + Intergenic
992186831 5:74252275-74252297 TCCTGCCAGGGCAAGCTCCAGGG + Intergenic
993506535 5:88715678-88715700 CCCTACCATTGCAACCTCCCAGG + Intergenic
995973655 5:118004422-118004444 TCCTCCCAGTGTAAACACCAAGG + Intergenic
997283636 5:132663492-132663514 CTCTTCCAGTGAAACCTCCTGGG - Intergenic
997321835 5:132984054-132984076 CACTGCCACTTTAACCTCCTGGG + Intergenic
997846007 5:137286569-137286591 CCCTGCTAGTGTACCTCCCAGGG + Intronic
1001225174 5:169938102-169938124 TCTTGCAAGTATAACCTCCATGG - Intronic
1001299489 5:170523650-170523672 CCCTGCACGTGTCACCTCCCTGG + Intronic
1002844494 6:934914-934936 CCCTGCCAGTGTCCCCTGAAGGG - Intergenic
1013601799 6:111712131-111712153 CCCTGCCAGTGTCAGTCCCATGG - Intronic
1015650653 6:135455001-135455023 CCCTTCCAGTGTAAGCTAGATGG - Intronic
1016078093 6:139821386-139821408 CCCTAGCAGTGTACCCTCCTGGG - Intergenic
1018835078 6:167477062-167477084 CCCTGCCACATTAACCTTCAGGG - Intergenic
1019917183 7:4141110-4141132 CCGAGGCAGTGTATCCTCCAAGG + Intronic
1020029752 7:4924588-4924610 CCCAGCCATTGTAGCCTTCACGG - Intronic
1024302003 7:47893972-47893994 CCCTGTCAGTGTGATCTCCGAGG - Exonic
1025275880 7:57580885-57580907 CACTGGCAGTGTAGCCCCCATGG - Intergenic
1026910823 7:74090802-74090824 CCCTCCCAGTGGAACTTCCTAGG + Intronic
1029871467 7:103697411-103697433 CCCTGCCTTTGTAACCCCCCAGG + Intronic
1030310889 7:108068138-108068160 GCCTGCAAGTGTCACCCCCAGGG - Exonic
1033602377 7:142897474-142897496 CCTGGCCAGTGTCACCTTCATGG + Intergenic
1035412007 7:158652095-158652117 CCCTCTCAGTGTATCCACCATGG + Intronic
1035743113 8:1944033-1944055 CCCTGACTGTGTCACCTCCCTGG + Intronic
1036374891 8:8191690-8191712 CCCTCCCACTTCAACCTCCACGG + Intergenic
1036736078 8:11317885-11317907 CCCTGCCAGAGTACAGTCCAGGG - Intronic
1036876011 8:12473954-12473976 CCCTCCCACTTCAACCTCCACGG - Intergenic
1037581791 8:20249764-20249786 CCCTTCCAGGTCAACCTCCAAGG + Exonic
1037649642 8:20824771-20824793 CCCTGCCAGTGCAACCAAGAGGG - Intergenic
1037907562 8:22724420-22724442 CCCTGCCAGTCTATCCTCATGGG - Intronic
1039127700 8:34221750-34221772 CTCTCCCAGTGAAAGCTCCAGGG + Intergenic
1043197185 8:77310665-77310687 TCCTGCCATAGTTACCTCCAGGG - Intergenic
1046811513 8:118538389-118538411 CCCTGCCACTGTAAGCTAAAGGG - Intronic
1048581285 8:135731611-135731633 CCCCTCCACTGGAACCTCCAGGG - Intergenic
1049563577 8:143325665-143325687 CCCTGCCCCTGCAACCTCCATGG - Intronic
1049646556 8:143738327-143738349 CACGGCCACTGTAGCCTCCAGGG - Intergenic
1050170996 9:2816559-2816581 CCCTGGCAGTGTGAGCTCCATGG - Intronic
1051144124 9:14008103-14008125 CCCTGCTGGTGAAACCTCTAGGG - Intergenic
1056807456 9:89740054-89740076 CCCTGCCTGTCTGACCACCAGGG - Intergenic
1057383481 9:94588861-94588883 CCCAGCCTCTGAAACCTCCAAGG + Intronic
1059698715 9:116754590-116754612 CTCTGCCAGTGTAATACCCAAGG - Intronic
1060217028 9:121744545-121744567 CCCTGCCTTTGTCACCTCCTGGG - Intronic
1062016292 9:134292877-134292899 CCCTGCCCTTGTAACCTACATGG - Intergenic
1062180417 9:135188433-135188455 CCCTGCCTGAGAAGCCTCCAGGG - Intergenic
1062309587 9:135928778-135928800 CCCTCCCAGTGCCACCTCCCGGG - Intergenic
1203627075 Un_KI270750v1:34374-34396 CACTGGCAGTGTAGCCCCCATGG - Intergenic
1187253939 X:17623901-17623923 CACTGTCAGTGTAGCCTGCAGGG + Intronic
1190954030 X:55173713-55173735 CCCTACCATTCGAACCTCCAGGG - Intronic
1197891265 X:131272922-131272944 ACCTGCCAGTGTCGCCTCCCAGG - Intergenic
1200103994 X:153702372-153702394 CTCGGCAAGGGTAACCTCCAGGG + Intronic