ID: 921535697

View in Genome Browser
Species Human (GRCh38)
Location 1:216346286-216346308
Sequence TGGGACTCCTTGGGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 341
Summary {0: 1, 1: 14, 2: 22, 3: 58, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921535691_921535697 26 Left 921535691 1:216346237-216346259 CCATTAAAAGTCAGCTTAATTAA 0: 1
1: 1
2: 3
3: 30
4: 336
Right 921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG 0: 1
1: 14
2: 22
3: 58
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921535697 Original CRISPR TGGGACTCCTTGGGAAAAAA AGG Intronic
900807641 1:4778226-4778248 TGAGATTCCCTGGGCAAAAAGGG - Intronic
902724563 1:18326047-18326069 TGCTACTCCCTGGAAAAAAAAGG - Intronic
903452378 1:23463014-23463036 AGGGAATGCTTGGTAAAAAATGG + Intronic
903867273 1:26409102-26409124 TGGGACTTCGTGGGGTAAAAAGG - Intergenic
903951756 1:26999686-26999708 TGGGACTCCTGGGGAAGCAGAGG - Intronic
904847979 1:33435166-33435188 TGGGACAGCTCGAGAAAAAATGG - Intergenic
905037409 1:34927158-34927180 TGGGACTCCTTGCCAAAGAGAGG - Intronic
906935257 1:50208998-50209020 TTTGAATCCTTGGGAGAAAAAGG + Intergenic
906964798 1:50445705-50445727 TGGGACTCCTTGGGGGAGAAGGG + Intronic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
908478940 1:64517919-64517941 TTGTATTCCTTGGGAAACAAAGG + Intronic
910726802 1:90348457-90348479 TGAGACCCCTTGTGAAGAAAGGG + Intergenic
911208982 1:95119814-95119836 TGGGACTAATTTGGAAAGAAGGG - Intronic
912115389 1:106400387-106400409 TGAGACTGCTTGAGAACAAAGGG + Intergenic
912526106 1:110283991-110284013 TTGGTTTCCTTGGGATAAAATGG + Intergenic
912526323 1:110286012-110286034 TTGGTTTCCTTGGGATAAAATGG - Intergenic
915873612 1:159588423-159588445 TGGGACACCTTTGGTGAAAAAGG + Exonic
917293692 1:173496302-173496324 CTGGACTCCTTGGGAAAAATAGG + Intergenic
918296674 1:183163569-183163591 TGAGACTCCTTGATACAAAAGGG + Intergenic
918814902 1:189169852-189169874 TAGGTCTCCTTGGGGAAAAATGG - Intergenic
919104064 1:193127439-193127461 TGGGACTACTTGGGAAAATAAGG + Intronic
919404629 1:197163437-197163459 TTGGAATCTATGGGAAAAAAAGG + Intronic
919967364 1:202541476-202541498 TGTGGCTCCTTGGGAAAAAAAGG - Intronic
920748693 1:208653427-208653449 CTGAACTCCTTGGGAAAGAATGG - Intergenic
921535697 1:216346286-216346308 TGGGACTCCTTGGGAAAAAAAGG + Intronic
921802929 1:219422081-219422103 ATGGAAACCTTGGGAAAAAATGG - Intergenic
922440911 1:225653861-225653883 TGGGATTCCTCGGGAAGAAAAGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
922919495 1:229290122-229290144 TGGGACTCCAGAGGAAGAAATGG - Intronic
923982742 1:239343662-239343684 TGGGACTCTTTTGGAACAAATGG + Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924808620 1:247381721-247381743 TGGGACTTCTTGGGAAAAACAGG - Intergenic
1063218082 10:3942074-3942096 TGAGACTCTGTGGAAAAAAAAGG + Intergenic
1064122400 10:12631176-12631198 TGGCGCTGCTTAGGAAAAAAAGG + Intronic
1065312151 10:24426856-24426878 TGGGACGCTTCGGGAAAATAAGG + Intronic
1067220477 10:44340560-44340582 TGAGACTCACTGGTAAAAAATGG + Intergenic
1067332955 10:45338818-45338840 GAGGTCTCCTTGGGAAAAAATGG - Intergenic
1070640575 10:78166026-78166048 TGAGCCTACTTGGGACAAAAAGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071560727 10:86645120-86645142 GGGGACTCCTTGGGAGACCAAGG - Intergenic
1072084983 10:92070020-92070042 TGGGACACATTTGGAAAAAAAGG + Intronic
1075741744 10:124700232-124700254 TGGGAAGCCTGGGGAAAAAAAGG - Intronic
1077859047 11:6158816-6158838 CTGGACTACTTGGGAAAAACAGG - Intergenic
1077920572 11:6639139-6639161 TAGGACTACTTGGGAAGCAAAGG - Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080892797 11:36424075-36424097 TGAGTCTCCGTGGAAAAAAATGG + Intronic
1081254330 11:40873548-40873570 TGGGACACTTTGAGAAAACAGGG + Intronic
1082834527 11:57641854-57641876 TAGGCCTCCTTGAGAAAAAAAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083104085 11:60340823-60340845 ATTGACTTCTTGGGAAAAAACGG + Exonic
1084572110 11:69966089-69966111 TGACACTGCTTGGGAAACAAAGG + Intergenic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1084878608 11:72153281-72153303 TATGACTCCCTGGGAAAAACAGG - Intergenic
1085026764 11:73240859-73240881 TGGGACTCAGTGGGGAGAAAGGG - Intergenic
1086299626 11:85412521-85412543 GGGGACTCCGTGGAAAAGAATGG - Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087462843 11:98466974-98466996 TGGAATTTATTGGGAAAAAAGGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1088461398 11:110087113-110087135 TGGGAATCCTTGAGCAATAATGG + Intergenic
1088504832 11:110517503-110517525 TGGGAATCTTTGGGAAAGACTGG - Intergenic
1088761541 11:112933752-112933774 TGGGCATTCTAGGGAAAAAATGG + Intergenic
1091585556 12:1814275-1814297 TGAGGCTCCTTGGGCAGAAATGG + Intronic
1093220126 12:16410852-16410874 TGGAACATCTTGGGAAAAAATGG - Intronic
1093506461 12:19872228-19872250 GGGGACTCAGTGGGGAAAAAGGG + Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1093922026 12:24869435-24869457 TGGAACTTATTGGGAAAAAAGGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095353019 12:41237173-41237195 AGGCACTTCTTGGGAAAAATGGG + Intronic
1096687840 12:53300453-53300475 AGGGACTCCCTGGGAACCAAAGG - Intronic
1096861302 12:54530420-54530442 TGGGACTACTAGAGAAAAGAAGG + Intronic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1097806124 12:63966941-63966963 TGGAAATTCTTAGGAAAAAAAGG - Intronic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099400260 12:82194837-82194859 TGGGTCTCCTTGGGAAAGGATGG - Intergenic
1100341319 12:93682414-93682436 TGGGAGGCCTTGAGAACAAATGG + Intronic
1101188549 12:102307063-102307085 CTGGATTCCTTGGGAAAAACAGG + Intergenic
1101289492 12:103353260-103353282 TGGAACTCCATGAGAACAAAAGG - Intronic
1101318257 12:103649701-103649723 TGGGATGCCTTGGGAAAAATGGG - Intronic
1101591948 12:106132606-106132628 TGAGGCTGCTTGGGAAACAAAGG + Intronic
1101905365 12:108820776-108820798 TGGTAATTCTAGGGAAAAAAAGG + Intronic
1102407926 12:112690343-112690365 TGGAAAACCTTGGGACAAAAGGG - Intronic
1103635583 12:122302472-122302494 GGGGACCCATTGGGAAAAATTGG - Intronic
1103758733 12:123232766-123232788 CGGGGCACCTTGGCAAAAAATGG + Intronic
1104436506 12:128761182-128761204 TGAGACTTCTTGGGAGAAGATGG + Intergenic
1105885731 13:24639545-24639567 TGGAATTCATTGGGTAAAAAGGG + Intergenic
1106189380 13:27437912-27437934 TGGAACTCATTAAGAAAAAAAGG + Intronic
1107311525 13:39083363-39083385 TGGGACTTCTTGGGAAAAACAGG + Intergenic
1108920105 13:55662326-55662348 GGGGTCTCCTTGGCCAAAAAGGG + Intergenic
1109585691 13:64399901-64399923 GGGGAGTACTTGGGAAGAAATGG - Intergenic
1110413327 13:75226493-75226515 TGGGATTTATTGGGCAAAAAAGG - Intergenic
1111034788 13:82657952-82657974 GGGGTCTCCTTGGTAAAGAAGGG + Intergenic
1113968685 13:114171386-114171408 TGGGACTCTTTAAGAAAAACAGG - Intergenic
1114405594 14:22453152-22453174 TGTGAGTCCCTGGGAGAAAATGG - Intergenic
1115631284 14:35248243-35248265 TGAATCTCTTTGGGAAAAAATGG - Intronic
1116329647 14:43579147-43579169 CTGGACTCTTTGGGAAAAACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1116803020 14:49463382-49463404 TGGGACACTTTGGGTAATAAAGG + Intergenic
1117901617 14:60539500-60539522 TGGGCCTACTTGAGAATAAAGGG - Intergenic
1119114670 14:72008405-72008427 TGGGAGTCCTTGGGAGCCAAAGG + Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1120269881 14:82297856-82297878 TAGGTGTCCTTGGAAAAAAAGGG - Intergenic
1120667887 14:87328687-87328709 TGGGATTCTGTGAGAAAAAAAGG + Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1121358549 14:93234636-93234658 TGGGACAACTTGAGAAAAGAGGG - Intergenic
1121976197 14:98406211-98406233 TGGGCCTCCTAGGGAAATAAAGG + Intergenic
1122573493 14:102725371-102725393 TGGGAGTCCTTTTTAAAAAATGG + Intronic
1124952266 15:34334780-34334802 TGGGACTACAGGGGTAAAAATGG - Intronic
1125747312 15:42005636-42005658 TGGGACTCTGAGGGAAGAAAAGG + Intronic
1126085477 15:45007295-45007317 TGGAACTCTTAGGGAAAAACAGG + Intergenic
1127228328 15:56959607-56959629 TTAGACTCTTTGAGAAAAAAAGG - Intronic
1127927046 15:63557080-63557102 TGGGACTCCATCTCAAAAAAAGG - Intronic
1128527132 15:68420247-68420269 TGGGACTTCCTAGGAAACAAGGG - Intronic
1130082310 15:80744674-80744696 AGTGACTTGTTGGGAAAAAAGGG - Intronic
1131747509 15:95464903-95464925 TGGTATTTCTTGAGAAAAAAAGG - Intergenic
1131755154 15:95551514-95551536 TGAAACTCTTTGGGAAGAAAAGG + Intergenic
1134288022 16:12879288-12879310 TGAGACTCCTTCTCAAAAAAGGG - Intergenic
1134647783 16:15884178-15884200 AAGGACACCTTGGAAAAAAAGGG - Exonic
1135245028 16:20848232-20848254 TGGGAAACGTTGGGGAAAAAAGG + Intronic
1135655371 16:24243867-24243889 TGGGACTACTGGGGAGAAATTGG - Intergenic
1135740408 16:24970352-24970374 TGAGACTCCTTGGGAGAAAGTGG - Intronic
1137381428 16:48003081-48003103 TGGGTAGCCTTGGGAGAAAATGG + Intergenic
1137720010 16:50622289-50622311 AGGGAGTCTTTGGGAAAAGAAGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138121072 16:54401516-54401538 CGGGCATCCTTGGGAAGAAAAGG + Intergenic
1141228852 16:82145623-82145645 TGCGACTCCTAGGGAAGAGAGGG + Intergenic
1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG + Intergenic
1144481326 17:15631800-15631822 TGGGCTTCCTGGGGAAAGAAGGG + Intronic
1144916979 17:18731931-18731953 TGGGCTTCCTGGGGAAAGAAGGG - Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1145405294 17:22585055-22585077 TGGGATTTATTGGGAAAAAAGGG + Intergenic
1149102325 17:52921867-52921889 TGGAATTTATTGGGAAAAAAAGG + Intergenic
1150028968 17:61711474-61711496 TGGGATTTCTAGGGAAAAAAGGG + Intronic
1150099095 17:62406230-62406252 TGGGAAGCCTTGGGGAAAAAAGG + Intronic
1153272879 18:3340847-3340869 TTGGACTCCATGGGAAAGTAGGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1155590157 18:27418843-27418865 TGGTTCTCTATGGGAAAAAAGGG - Intergenic
1156954723 18:42948602-42948624 TAGGACTCCTTGGGCAAACTGGG - Intronic
1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG + Intergenic
1159663442 18:71127953-71127975 TGGGACTACTTAGGTGAAAATGG - Intergenic
1161092078 19:2366064-2366086 TGAAACTGCTTGGAAAAAAAGGG + Intergenic
1162322615 19:9978942-9978964 CAGGACCCCTTGGGAAAGAAGGG - Exonic
1163520280 19:17787932-17787954 TGGGGATCCTTGGGAAAGATAGG + Intronic
1163834006 19:19562478-19562500 TGAGACTCGGTGGGAAAAAGGGG + Intronic
1165164214 19:33840153-33840175 TGGGACTCCTTAGGGAGAAGTGG + Intergenic
1165397137 19:35570656-35570678 TGGGAGACCTTGGGAAGAAGTGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166426421 19:42682885-42682907 TGGGACCACTTAGGAAAAACAGG - Intronic
1166496098 19:43304395-43304417 TGGGTCTCCTGGGGAAAATGGGG - Intergenic
1166900910 19:46062081-46062103 TGGAACTCCTTGGGAAAAACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168552680 19:57310824-57310846 TGGGACTGATTGAGAAAAGAAGG + Intergenic
926651501 2:15351663-15351685 TGAGACTCCATAGAAAAAAAAGG + Intronic
926659705 2:15450993-15451015 TGGGACTGTTTGGGAGAAAAAGG + Intronic
926825783 2:16903772-16903794 AGGGTCTCCTTGGGAAAGATGGG + Intergenic
927374799 2:22401337-22401359 TAGGACTCCTTGTGAAGACAGGG - Intergenic
928833902 2:35521019-35521041 AGGAACTCCTTGGGAAAAGCAGG - Intergenic
930065345 2:47323621-47323643 TGGCACCCCTTGGCAAAACAAGG + Intergenic
933725122 2:85422500-85422522 AGGGAGTCCCTGGGAAACAATGG + Intronic
934061447 2:88297908-88297930 TGGGTCTCCCTGGGCTAAAAAGG + Intergenic
934889027 2:98049524-98049546 CTAGACTCCTTGGGAAAAACAGG + Intergenic
935517382 2:104057730-104057752 TGAGACTCTTTGGGAAATTAGGG + Intergenic
935724479 2:106011080-106011102 TGGGATTTATTGGGAAAAAAGGG - Intergenic
936987395 2:118324407-118324429 TGCTACTCCTTGAGAAATAATGG + Intergenic
939669007 2:144986695-144986717 TGAGACTCCTTGTGAAATTAAGG - Intergenic
941249958 2:163148863-163148885 TGGGATTTATTGGGCAAAAAGGG - Intergenic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941741612 2:169041188-169041210 TGAGACTCTTTGGGGAATAAGGG + Intergenic
942023583 2:171891466-171891488 TGGGACTCAGTGGGACATAAAGG - Intronic
943720063 2:191194647-191194669 TGGGGTTCCTTGGGAAGAAAAGG - Intergenic
943726474 2:191256545-191256567 AGGGACCCCTTTGGAAAATATGG + Intronic
944088914 2:195882873-195882895 TGGCACTCCTTGGGCCAGAACGG + Intronic
944248797 2:197560509-197560531 TAGGAATCCCTGGGAAAGAATGG - Intergenic
944377620 2:199065536-199065558 TGTGTCCCTTTGGGAAAAAAAGG - Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945913479 2:215677268-215677290 TGGGCCTTTTTGGGAAAAAAAGG - Intergenic
948471239 2:238181500-238181522 TTGGACTTCTTGGGAACAACTGG - Intronic
948620274 2:239230223-239230245 TGGGACCCCTTGGTCAAGAAGGG + Intronic
1169655526 20:7918549-7918571 GGGGATTCCTTGGGGAGAAAAGG - Intronic
1171442156 20:25173829-25173851 TGGAACTCCTTGAGAAAAATAGG - Intergenic
1173497955 20:43532757-43532779 GGGGACTCTAGGGGAAAAAAAGG - Exonic
1178627151 21:34227680-34227702 TTGGACTCCCAGGGAAAAATAGG - Intergenic
1178822921 21:35991698-35991720 TGAGACTCCATCTGAAAAAAGGG + Intronic
1182024448 22:27107036-27107058 AGGGAAGCCTTGGGAAAAGAGGG - Intergenic
1182483736 22:30626815-30626837 TCAGACTCCTTGGCAAAAAACGG + Exonic
1185269797 22:49924114-49924136 TGGAACTCTTTGGGAGAAACTGG - Intronic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950368898 3:12510507-12510529 TGGGAATGCTTGGAAACAAAGGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951010301 3:17669584-17669606 TAGGGCTCCTTGGTAAAATAAGG + Intronic
952094935 3:29939594-29939616 TGGGAGTTCTTGGGACAAACTGG - Intronic
952953603 3:38543220-38543242 TGGGACTGCTGGTGAGAAAAGGG + Intergenic
953675378 3:44997367-44997389 TGGGATTAGTTGGGAAAAGATGG + Intronic
956247715 3:67202935-67202957 TGGGATTGATTGGGCAAAAAAGG - Intergenic
956591954 3:70924542-70924564 TGGGCATACTTGGGAGAAAATGG - Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
958482846 3:94666199-94666221 TGGGACTCTTTGGGAAGGACAGG - Intergenic
960073418 3:113457668-113457690 TGAGACTCTGTGTGAAAAAAAGG - Intronic
960537649 3:118830917-118830939 TGGGAGTCTTTTGGAAAAGAGGG - Intergenic
960584268 3:119306225-119306247 TTGGACTCCTTGAGACAAAATGG + Intronic
960594436 3:119395424-119395446 TGGGACAGCTGGGGAAAACATGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962454387 3:135551850-135551872 TGGGACTGCTAGAGAAGAAATGG - Intergenic
962908313 3:139825225-139825247 TGGGAAGCCTTGGGAAGAATTGG + Intergenic
963160732 3:142149062-142149084 TGGGACTCGTGGGGGAACAAGGG + Intronic
963763385 3:149308081-149308103 TGACACACCTTGGGCAAAAAGGG - Intergenic
964753069 3:160069871-160069893 TAAGAATCCTTGGGAAAAATAGG - Intergenic
964763950 3:160160298-160160320 GAGGACTCCTTGGGAAAATCAGG - Intergenic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967385702 3:188908768-188908790 TGGGACTCCTATGGAGAAAAGGG + Intergenic
969280534 4:6167582-6167604 TGGGGCTCCTTGTTAAAAAATGG - Intronic
969420078 4:7088923-7088945 CTGGACTCCTTGAGAAAAACAGG - Intergenic
971179992 4:24320988-24321010 TGGGACTCGGTGAGAGAAAACGG - Intergenic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
971998297 4:33995284-33995306 TGGGATTTATTGGGAAAAAAGGG - Intergenic
972614482 4:40685125-40685147 TGGCCTTCCTTGGGAAAAAGTGG - Intergenic
972818986 4:42677212-42677234 CTGGACTCCTTGGGAAAAATGGG + Intergenic
972985795 4:44763012-44763034 TGGTACTCAGAGGGAAAAAAAGG + Intergenic
973100253 4:46258788-46258810 GGGGATTCCTTGAGAAAAATAGG + Intronic
975546364 4:75564262-75564284 TGGGCCTTCGTGGAAAAAAATGG - Exonic
975662096 4:76698410-76698432 TGTCATTCATTGGGAAAAAATGG - Intronic
976787684 4:88840438-88840460 TGGGACTCATCTAGAAAAAATGG + Intronic
977465797 4:97381968-97381990 TAGGTCTCCTTGGGGAAGAATGG - Intronic
979291309 4:118981781-118981803 GGGGCCTTCTTGGGAAATAAAGG + Intronic
980402930 4:132316063-132316085 GGGGACCCCTTGGGAAAGAGGGG + Intergenic
981036246 4:140172185-140172207 TGGGATTCTTTGAGATAAAAAGG + Intergenic
981362075 4:143858548-143858570 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981372809 4:143979384-143979406 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
981381897 4:144082622-144082644 TAGGACTTCTTGGGTAAAAAAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
989336996 5:40329861-40329883 CTGGACGCCTTGGGAAAAACAGG - Intergenic
990290593 5:54346761-54346783 CTGGACTTCTTGGGAAAAACAGG + Intergenic
990692530 5:58379409-58379431 TGGGACTCCTTGGTTAAAACAGG + Intergenic
994401414 5:99285078-99285100 TGGGACTCCTTTAGAATGAAAGG + Intergenic
994606873 5:101979059-101979081 TGGGGATCCTTGAGAAACAAAGG - Intergenic
996077008 5:119207967-119207989 TGGGAATCCTTTGGTAAAATAGG + Intronic
996153299 5:120066419-120066441 TGGGAAAGCTTGGGAAAAAATGG - Intergenic
997210698 5:132075093-132075115 TCTGACTCCTTGGGATGAAATGG - Intronic
999739485 5:154539240-154539262 TGGGACTCAATTGGAAAGAATGG - Intergenic
1000191772 5:158917944-158917966 TGGGTCCCTTTGGGAAGAAAGGG + Intronic
1003379786 6:5613978-5614000 TGGGAGTCCTGGGGGGAAAAGGG + Intronic
1003867386 6:10375775-10375797 TGGGACTCATTGCCAACAAAGGG - Intergenic
1004821314 6:19371107-19371129 AGCTTCTCCTTGGGAAAAAAAGG + Intergenic
1007000126 6:38303696-38303718 TCAAACTCTTTGGGAAAAAAAGG + Intronic
1008540973 6:52546215-52546237 TGTGACTCCCTGGGAAAATGAGG + Intronic
1009716783 6:67408063-67408085 TGGAACTCCTTGGGAAAAACAGG + Intergenic
1009990765 6:70840437-70840459 TGGCCCTTCTTGGAAAAAAATGG - Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1010653623 6:78484777-78484799 TGTGACCACTTGGAAAAAAATGG - Intergenic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1010823727 6:80447614-80447636 ATGGATTCCTTGGGACAAAAGGG - Intergenic
1011039731 6:83015997-83016019 AGGGATTAATTGGGAAAAAATGG - Intronic
1012026546 6:94001097-94001119 TGTTATTCTTTGGGAAAAAAAGG - Intergenic
1013054057 6:106565926-106565948 TGTGACTCAATTGGAAAAAATGG + Intronic
1013081231 6:106815229-106815251 TAAGACTCCTTGGGAGAAACAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1015894794 6:138006994-138007016 TGGGGCTCCTTGGGAAAGATGGG - Intergenic
1016694234 6:146974234-146974256 TGAGACACCTTGGGTACAAAAGG - Intergenic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018195861 6:161355899-161355921 TGGGACTCGTTGGGTAAAGGGGG + Intronic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1019380633 7:720732-720754 TGAAATTCCTTGGGAAAAAGAGG - Intronic
1020350549 7:7214286-7214308 TGGAACTCCTTGGGAAAAACAGG - Intronic
1020426403 7:8071059-8071081 TGGGATTCCGGGGGACAAAAAGG - Exonic
1023249008 7:38237535-38237557 TGAGACTCCTTCTCAAAAAAAGG + Intergenic
1024112605 7:46162392-46162414 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1024827170 7:53404194-53404216 TGGGCGTCCTTGGAAAAAATAGG + Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1028235897 7:88361281-88361303 TGGGATTTATTGGGCAAAAAGGG + Intergenic
1029521803 7:101067524-101067546 TGTGAATCTTTGGGAAAAGAGGG + Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032906422 7:136372719-136372741 TGGGACTATCTGGGAAAACAGGG - Intergenic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1035456792 7:159014063-159014085 TGGGACTCCTTGGGAGACCGAGG + Intergenic
1037772485 8:21810716-21810738 AGGGACTCTATGGAAAAAAAAGG + Intronic
1038038615 8:23706191-23706213 TTGGACTCCTCGAGAGAAAATGG + Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1040870829 8:52098871-52098893 TGGTAATCCTTGGGAGAAACAGG + Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045154600 8:99453343-99453365 TAGGATTCCTTGGGGAGAAAAGG + Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1048162051 8:132030486-132030508 TTGAACCCCTTGGGAAAAAGTGG - Intronic
1048686954 8:136915565-136915587 TGGGACTCCTTAGGAAAATGGGG - Intergenic
1049020972 8:139957509-139957531 TGGGTGTCCTCGGGAATAAAAGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1050401601 9:5262007-5262029 TGGAACTCCTTGGGGAAAAGAGG - Intergenic
1050524604 9:6534585-6534607 TGGGGCACCTTGTGAAATAAGGG - Intronic
1050657902 9:7849035-7849057 CTGGACTCCTTGGTAAAAACAGG + Intronic
1051310715 9:15768054-15768076 TGGGACTGCTCGGGACAACAAGG - Intronic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1052743485 9:32416435-32416457 AGACACTCCTTGGGAAAAAAGGG - Intronic
1053013478 9:34648473-34648495 AGGGACTCCTTGGGGACACAGGG - Intronic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056052285 9:82781869-82781891 TCGATCTCCTTTGGAAAAAAAGG + Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1056990547 9:91406352-91406374 TGTAACTCCTTAGGAATAAAAGG - Intergenic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058981363 9:110173655-110173677 TGGAAATCCTGGGGAGAAAAAGG - Intergenic
1060038931 9:120283168-120283190 TGGGACTCATTGGAAAAATTTGG - Intergenic
1062065107 9:134522497-134522519 AGGGGCTTCTGGGGAAAAAACGG - Intergenic
1185435153 X:38153-38175 TGGGTCTCATTGAGGAAAAATGG + Intergenic
1186752473 X:12635485-12635507 TTGGACTCATTGGGAAATGATGG - Intronic
1187258759 X:17666012-17666034 GGGGAGTCCTGGGGAAAGAATGG + Intronic
1187856649 X:23643330-23643352 TAGGACACCTTGCGAAGAAATGG + Intergenic
1188518149 X:31009648-31009670 TGGAACTTATTGGGCAAAAAGGG - Intergenic
1190962784 X:55268819-55268841 CAAGACTCCTTGGGAAAAACAGG + Intronic
1191134145 X:57045379-57045401 GAGGACTCCTTGGGGAAGAATGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192077911 X:68018713-68018735 TGGGAGCCCTTGGGACTAAAGGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194379907 X:93178943-93178965 TGGGACTCCTTGGGAAAAATAGG + Intergenic
1194456963 X:94116618-94116640 TGGGTCCCCTTGGCAAAAAGGGG + Intergenic
1194508067 X:94758078-94758100 TGGGACTCAGTGTAAAAAAATGG - Intergenic
1194513607 X:94823670-94823692 GAGGTCTCCTTGGGAAAGAAGGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1198492944 X:137161790-137161812 TGAGAATCCTAGGGAAAATATGG + Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1199076808 X:143534686-143534708 TGGGACAACTTGGGAGAAAAGGG - Intergenic
1199157085 X:144562998-144563020 TGGGACTCCTGGGTCAAAGACGG - Intergenic
1200684552 Y:6246841-6246863 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200990081 Y:9338100-9338122 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200992743 Y:9358415-9358437 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200995396 Y:9378693-9378715 TGTGACTCTTTGGGGAACAAAGG + Intronic
1200998061 Y:9399039-9399061 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201000571 Y:9467573-9467595 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201003237 Y:9487903-9487925 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201005894 Y:9508185-9508207 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201008551 Y:9528498-9528520 TGTGACTCTTTGGGGAACAAAGG + Intronic
1201011133 Y:9548667-9548689 TGTGACTCTTTGGGGAACAAAGG + Intergenic
1201749324 Y:17415247-17415269 TGGAACTCCTTGGAGAAACAGGG + Intergenic
1202115929 Y:21468718-21468740 TGCGACTATTTGGGGAAAAACGG + Intergenic
1202302964 Y:23437238-23437260 TGTGGCTCCTTGGGAAAAAGAGG - Intergenic
1202567847 Y:26233356-26233378 TGTGGCTCCTTGGGAAAAAGAGG + Intergenic