ID: 921546265

View in Genome Browser
Species Human (GRCh38)
Location 1:216478446-216478468
Sequence AACAGGACATTGACCGCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921546259_921546265 5 Left 921546259 1:216478418-216478440 CCGCTCACTTCCGTGCGGCCCAG No data
Right 921546265 1:216478446-216478468 AACAGGACATTGACCGCTACTGG No data
921546257_921546265 9 Left 921546257 1:216478414-216478436 CCCACCGCTCACTTCCGTGCGGC No data
Right 921546265 1:216478446-216478468 AACAGGACATTGACCGCTACTGG No data
921546258_921546265 8 Left 921546258 1:216478415-216478437 CCACCGCTCACTTCCGTGCGGCC No data
Right 921546265 1:216478446-216478468 AACAGGACATTGACCGCTACTGG No data
921546260_921546265 -5 Left 921546260 1:216478428-216478450 CCGTGCGGCCCAGTTCCTAACAG No data
Right 921546265 1:216478446-216478468 AACAGGACATTGACCGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921546265 Original CRISPR AACAGGACATTGACCGCTAC TGG Intergenic
No off target data available for this crispr