ID: 921549422

View in Genome Browser
Species Human (GRCh38)
Location 1:216515515-216515537
Sequence CTGTTGTTCTTAAGGACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921549422_921549424 -8 Left 921549422 1:216515515-216515537 CCATTTGTCCTTAAGAACAACAG 0: 1
1: 0
2: 1
3: 23
4: 221
Right 921549424 1:216515530-216515552 AACAACAGAATGCTGTCATGAGG 0: 1
1: 0
2: 2
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921549422 Original CRISPR CTGTTGTTCTTAAGGACAAA TGG (reversed) Intronic
901298484 1:8180393-8180415 CCATTCTTCTTAAGGACACATGG - Intergenic
901372895 1:8815894-8815916 CTGTTGTTGTTGAGGTCGAAGGG - Intronic
902359251 1:15933211-15933233 CTCTTGTTCGGAAAGACAAAGGG + Exonic
903911344 1:26728258-26728280 CTGTTCTTCTTAATATCAAAGGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
909636412 1:77821292-77821314 CAGTTGTTCTTTTGGACCAAGGG + Intronic
911184448 1:94889064-94889086 GTTTGGTTCTTAAAGACAAAAGG - Intronic
911421522 1:97647170-97647192 CTGTTGACTTTAAGGAGAAATGG + Intronic
911519164 1:98908224-98908246 CTGTAGTTCTTTAGGAGCAAAGG + Intronic
912911283 1:113760898-113760920 CTGTTGAGCTTCAAGACAAATGG + Intergenic
913271622 1:117099628-117099650 TTGTTGTTTTTAAAGACAAGGGG - Intronic
914895430 1:151667436-151667458 CTTTTATTGTTAAGGCCAAAAGG - Intronic
915184019 1:154088632-154088654 CTGTTGTTCTTCATAATAAAAGG + Intronic
916000237 1:160608276-160608298 CTGATGTTCTGAAGTACAACTGG - Exonic
916155743 1:161845240-161845262 CTGTGGTTCTAAAGGAAAAGCGG - Intronic
916869459 1:168896940-168896962 CTGTGGTTCTTAAGGAAAAGTGG - Intergenic
917104316 1:171477180-171477202 CTGTTGTTCATAAAGTAAAAGGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917633050 1:176908669-176908691 CTGTTATTCTGAAGGTTAAATGG + Intronic
919603954 1:199657102-199657124 ATGGTGTTCTTAAAGATAAAAGG - Intergenic
919894367 1:201999794-201999816 CTGTTCTTCTTGAGGCCACAAGG + Intronic
921221967 1:212979829-212979851 CTGTGGTTCGTAAAGAGAAAGGG + Intronic
921549422 1:216515515-216515537 CTGTTGTTCTTAAGGACAAATGG - Intronic
923804165 1:237240033-237240055 CTCTTGTGCTTAAGCACTAATGG - Intronic
1062865637 10:850665-850687 ATATTCTTCTCAAGGACAAATGG + Intronic
1063456693 10:6188174-6188196 CTGAAGTACTTAGGGACAAAAGG - Intronic
1063597146 10:7445759-7445781 CTGTTGTTCTAGAAGAAAAAAGG - Intergenic
1065836296 10:29661217-29661239 CTGGTTTGCTTAAAGACAAAGGG + Intronic
1066034024 10:31462532-31462554 CTTTAGTTCTTAAGGACCGATGG + Intronic
1067791418 10:49290917-49290939 CTGTTCTTTTTAATGAGAAATGG + Intergenic
1068205095 10:53840066-53840088 TCCTTGTTCTTAAGTACAAAAGG + Intronic
1070277862 10:75024961-75024983 CTTTTCTTCTTTAGTACAAAAGG - Exonic
1070342184 10:75507821-75507843 CTTCTGTGCCTAAGGACAAATGG - Intronic
1070648098 10:78215477-78215499 CTGTTGTCCTTAAGGATTTAGGG + Intergenic
1072552183 10:96487424-96487446 CTGTATTCCTTTAGGACAAATGG + Intronic
1074611440 10:115025845-115025867 GGGTTGTTCTGAAGGTCAAAGGG - Intergenic
1075879463 10:125837957-125837979 CTGTCCTTCTTAAAGACACATGG + Intronic
1076430086 10:130395588-130395610 CTGTTGTTCTAAAGAACAAAAGG + Intergenic
1076623068 10:131805209-131805231 TTGTTATTATTAAGGATAAAGGG + Intergenic
1077268220 11:1662517-1662539 CTGTTATTCTTCACTACAAAAGG - Intergenic
1077272662 11:1689101-1689123 CTGTTATTCTTCACTACAAAAGG + Intergenic
1077340185 11:2022971-2022993 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1078131179 11:8615399-8615421 ATGATGTTGTCAAGGACAAAAGG + Exonic
1078275810 11:9844979-9845001 GTGATGTACTTAAGGATAAAGGG + Intronic
1080957818 11:37121242-37121264 CTCATTTTCTTAAGGACAAAGGG - Intergenic
1087277353 11:96173917-96173939 CTGTTTCTCTTCAGGACAAGGGG + Intronic
1088710049 11:112499731-112499753 CTGCTGTTCCAGAGGACAAAAGG + Intergenic
1090324214 11:125870814-125870836 TAGTTGTTTTTAAGGAAAAAAGG + Intergenic
1090718737 11:129453589-129453611 CTGTTGATCTCAATAACAAAGGG - Intergenic
1091163632 11:133450086-133450108 CTTTTGTTCTTATGGTCACAAGG - Intronic
1091199207 11:133760001-133760023 GTGTTATTCTTTAGGACATAAGG - Intergenic
1202823170 11_KI270721v1_random:78160-78182 CTGGTGGTCTCGAGGACAAATGG + Intergenic
1093273256 12:17092647-17092669 CTTTTATTCTTATGAACAAAAGG - Intergenic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1094314748 12:29127290-29127312 ATGTTCTTCTTAAGGTCATATGG - Intergenic
1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG + Intergenic
1100660064 12:96687066-96687088 CTGTTGGTCTTGAAGACAGAAGG - Intronic
1100708677 12:97229809-97229831 CTGGTGTTCTTAAGCACAGAAGG - Intergenic
1103277621 12:119725959-119725981 GTGTTGTTCTTAAGGCCACGGGG + Intronic
1104526480 12:129528215-129528237 GTGTTTTTCTTAAGGATAATTGG - Intronic
1105505309 13:21004818-21004840 TTGCTGTTTTTAAGGACAACAGG + Intronic
1105520291 13:21125122-21125144 TTGTCATTCTTCAGGACAAAGGG - Intergenic
1106001781 13:25730368-25730390 CTTTTGTTTTGAAGAACAAAAGG + Intronic
1106100352 13:26689955-26689977 TTGTTGTTCATAGGGAAAAAGGG + Intergenic
1107014811 13:35699648-35699670 GTGTTGTCATTAAGGAAAAAGGG - Intergenic
1108944856 13:56009376-56009398 TTATTTTTCTTATGGACAAAGGG + Intergenic
1110820580 13:79910596-79910618 CTGTTGTTCTTAAAGCCCCAGGG - Intergenic
1111750687 13:92328025-92328047 CTGTGCTTCTTCAGGGCAAAAGG + Intronic
1113139882 13:107135442-107135464 GTGATGTTATTAAGGACAGAAGG - Intergenic
1113575592 13:111393173-111393195 CTGTAGTTCATAAGGAGAGAGGG - Intergenic
1115408688 14:33048368-33048390 GTGTAGCCCTTAAGGACAAAGGG + Intronic
1115797426 14:36954365-36954387 CTGTAGTTAGTAAGGAGAAATGG - Intronic
1119555328 14:75548269-75548291 CTGTCCCTCTAAAGGACAAATGG - Intergenic
1119678974 14:76577707-76577729 CTTCTGGTCTGAAGGACAAATGG - Intergenic
1121100842 14:91249083-91249105 CTGAGGTTCTAAATGACAAACGG + Intronic
1126296631 15:47144930-47144952 CTGTTCTTCTTAAGCACACATGG + Intergenic
1127745567 15:61967829-61967851 CTGTTGTTTTTAAGTTAAAAAGG - Intronic
1128676498 15:69613018-69613040 CAGTTCTTCTGAAGGGCAAAGGG - Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130766423 15:86876048-86876070 CTCTTATTCTTAGTGACAAAAGG - Intronic
1131638507 15:94263572-94263594 CTGGTGTTCCTAAGGACAGAAGG - Intronic
1138500838 16:57443048-57443070 CTGTTTTCCTTAATGACAGAGGG + Intronic
1140710021 16:77668992-77669014 TTGTTGTTCAGAAGGAGAAAGGG - Intergenic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1143977255 17:10838966-10838988 CTGTTGTTCCTCAGGATAACTGG + Intergenic
1147477902 17:40730976-40730998 CTTTTGTTTTTAATGACAAATGG + Intergenic
1148044449 17:44734174-44734196 CTGCTGAACTGAAGGACAAATGG + Intronic
1149303151 17:55324135-55324157 CTGTTGTATTTGAAGACAAAAGG - Exonic
1152171379 17:78751384-78751406 CTATTGTTCCTAAGTACAAGAGG - Intronic
1153696068 18:7643292-7643314 CTATGTTTCTTAAGGCCAAAAGG + Intronic
1153786392 18:8538813-8538835 GTTTTGTTATTAAGGAGAAAGGG - Intergenic
1155469099 18:26171934-26171956 CTGTGGGTCTTGAGGATAAAGGG - Intronic
1155601785 18:27557307-27557329 CTTTTGTTATTATGGATAAAGGG + Intergenic
1155986982 18:32240072-32240094 CTGCTGTTTTTAAGACCAAATGG - Intronic
1159194885 18:65100640-65100662 CTGTTATTCTTTAGGTCACATGG - Intergenic
1159567186 18:70064971-70064993 TTGATCTTCTTAAGAACAAAAGG - Intronic
1159897049 18:74007382-74007404 CTTTTCTTCTTAATGACAATGGG - Intergenic
1163299567 19:16435361-16435383 CTGCTGTTCTGAAAGACATAGGG + Intronic
1167720097 19:51173474-51173496 CTGTTGTTCTGAAGAGCAGAAGG + Intergenic
925522534 2:4763037-4763059 CTTTTTTTCTCAAGGAGAAAAGG + Intergenic
927317896 2:21706881-21706903 CTTTTTTACCTAAGGACAAATGG - Intergenic
928214989 2:29353974-29353996 CTCTTGTGCTTAAGGACCAAAGG - Intronic
928598761 2:32883343-32883365 CACATGTTCTTAAGAACAAAGGG + Intergenic
929179522 2:39020599-39020621 CAGTAGTTCTTAAAAACAAATGG + Intronic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930780996 2:55224739-55224761 CTGATGTTCTCATGGACACAAGG - Intronic
930817673 2:55616271-55616293 CTTTTGTTCTTAATGAGGAAAGG - Intronic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932059848 2:68485259-68485281 CTGATGTCATTAAAGACAAAAGG - Intronic
933544128 2:83688397-83688419 ATGTTCTTCCTAATGACAAATGG - Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935982275 2:108639074-108639096 CTGGTGTTCTTAAGGAGATGAGG + Intronic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
937633815 2:124133285-124133307 TTGTTTTTTTTAAGGACCAAAGG - Intronic
937652140 2:124331121-124331143 GTGTTGTCATTAAGGACATATGG - Intronic
938681499 2:133696387-133696409 CTGTTTTTCTCAAGGAAAAAGGG + Intergenic
938801483 2:134767333-134767355 CAGTTTTTCTTAAATACAAATGG - Intergenic
938936284 2:136130477-136130499 CAGTCGTTCTTAAGGAAAATAGG + Intergenic
940484580 2:154281365-154281387 TTGTTGATCTAAAGGACAATTGG + Intronic
941661781 2:168202869-168202891 TTGTTGCTCTTAAGGGCAAATGG - Intronic
942207910 2:173640710-173640732 CTGTTGTTCTGCATGACATATGG - Intergenic
942526031 2:176853873-176853895 CTATTATTCTAAAGGGCAAAAGG + Intergenic
943356944 2:186867680-186867702 CTCTTCTTCTTAAGGTCAATCGG + Intergenic
943371472 2:187022183-187022205 CTCCAGTTCTTAAGTACAAAGGG + Intergenic
943702812 2:191004788-191004810 TTTGTGTTCTTAAGGACTAATGG - Intronic
943919527 2:193686032-193686054 GTTTTATTTTTAAGGACAAATGG + Intergenic
944611036 2:201408058-201408080 CTGGTGTTCTTAAGCACCATAGG - Intronic
944855853 2:203765808-203765830 ATAATGTTCTCAAGGACAAAAGG + Intergenic
1170191635 20:13650691-13650713 CTGTTGTTATTGGGAACAAAAGG - Intergenic
1170220851 20:13940100-13940122 CTGTATTTCTTACAGACAAATGG - Intronic
1172864373 20:38084348-38084370 CTGTTGTGCTACAGGACATATGG - Intronic
1175755162 20:61525081-61525103 CTGTTGTCATTAAGCTCAAATGG + Intronic
1176700341 21:10040332-10040354 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1177805389 21:25869955-25869977 CTGGTGTTCTGAAGGATGAATGG + Intergenic
1180898610 22:19355163-19355185 CTTTGGTTCTTAAGGACCAAAGG + Intronic
1181879112 22:25963495-25963517 CTGGTGTCCTTGAGGACACATGG - Intronic
950085414 3:10254157-10254179 CTGTTGTTGCCAAGGACAATCGG + Intronic
950396456 3:12737746-12737768 CTCTTGTTCTTAAGGAGAAGTGG - Exonic
954963132 3:54583794-54583816 CTTTGGGTCTTAAAGACAAAAGG + Intronic
955046590 3:55366834-55366856 CTGATGTTCTCAAGGACACTGGG + Intergenic
956258018 3:67305045-67305067 ATGTTGTTAGTAAGGACAAAGGG - Intergenic
956410909 3:68978427-68978449 CAGTTGTACCTAAGGACACAAGG + Exonic
956844457 3:73169624-73169646 CTGTTCTTCTTGTGTACAAATGG + Intergenic
957529578 3:81424104-81424126 CTGTAGATCTCAAGGCCAAATGG - Intergenic
957717782 3:83953409-83953431 CTATTGTTCTTAAACATAAAAGG - Intergenic
961067354 3:123886956-123886978 TTCTGGTTCTCAAGGACAAAAGG + Intergenic
962621797 3:137187550-137187572 CTGTTGTTGTTTCTGACAAAGGG + Intergenic
963397004 3:144747962-144747984 CTGTTGTTCTTTAGTGCAAAGGG + Intergenic
963949716 3:151185554-151185576 CTTTTGCTCTTGAGGAAAAAAGG + Intronic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
965610926 3:170543341-170543363 CTGTGCTTCTTAAAGACAGAGGG - Intronic
967986073 3:195096154-195096176 CTTTTCTGCTTAAGGTCAAAGGG - Intronic
968402600 4:311589-311611 TTTGTGTTCTTGAGGACAAAGGG + Intergenic
968528732 4:1078671-1078693 CTGTTGGTGTCAAGGAGAAAGGG - Intronic
971174173 4:24264823-24264845 CTGTTGTTTTTGTGGCCAAATGG + Intergenic
972097194 4:35363357-35363379 TTGGTGTTCTTGAGGAAAAAGGG - Intergenic
972937739 4:44159382-44159404 ATTTTTTTCTTAAGGACAATGGG - Intergenic
974978273 4:68919272-68919294 CTGTTGGTGGTAATGACAAATGG + Intergenic
976106955 4:81629519-81629541 GTGAGGTTCTTGAGGACAAAGGG - Intronic
976350195 4:84051982-84052004 CCGTTGTTCCTTAGGAAAAAAGG + Intergenic
976360679 4:84174517-84174539 GTGTTGTTGCTAAGGTCAAATGG + Intergenic
977455351 4:97252740-97252762 CTTTTGTTGTTGATGACAAAAGG - Intronic
979087836 4:116436331-116436353 CTTTTGTTCTGAAGGAGAAATGG + Intergenic
980296124 4:130920160-130920182 CTGTTGTTTTGAAGTAAAAATGG - Intergenic
980372754 4:131899111-131899133 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
981838007 4:149077914-149077936 CTGCTGTTTTTAAGGGAAAATGG - Intergenic
983276007 4:165618513-165618535 CAATTGTTCTTAAGGACATCTGG - Intergenic
984130976 4:175875832-175875854 CTTTTGTTATTAAGTGCAAACGG + Intronic
984133373 4:175905845-175905867 CTTTTTTTCTTAATGACGAAAGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
988211478 5:28210178-28210200 CTGTTGTTATGAAGGACAACGGG - Intergenic
989265129 5:39464629-39464651 GTTTTTATCTTAAGGACAAAGGG - Intergenic
990205203 5:53421426-53421448 ATGTTGTTGTTAAAGACAACAGG - Intergenic
990979140 5:61586123-61586145 CTTTCGGTCTGAAGGACAAAGGG - Intergenic
997473154 5:134127908-134127930 ATTTTGTTCTTAAGTAAAAAAGG + Intronic
998309148 5:141109430-141109452 GTGCTGTTATTAAGGACAAGTGG + Intronic
998365545 5:141628446-141628468 CAGTTGTCCTTAAGGATGAATGG - Intronic
999583251 5:153062827-153062849 CTGCTTTTCTTAAGCAAAAATGG - Intergenic
999788783 5:154917757-154917779 CTGTAGTTCTCAAAGACACAAGG + Intronic
999816613 5:155183457-155183479 CTGTTATTCATAAGGACTATTGG + Intergenic
1000025012 5:157351244-157351266 CTGTTATTATTAAGAAGAAAAGG + Intronic
1000702627 5:164472491-164472513 CTGATGTTTATAAGGACACAAGG - Intergenic
1004049071 6:12056317-12056339 ATGATGTTCTTAAGGAAAAGTGG + Intronic
1004843652 6:19614683-19614705 CTGTTGTTCTTAGGGTAAGATGG - Intergenic
1004963208 6:20816132-20816154 CTGTTGTCCTTAAAAAAAAAAGG - Intronic
1005347630 6:24906034-24906056 CTGTTGTTTTTCAGTACATAAGG + Intronic
1007807034 6:44458129-44458151 TTGTTGTTCTAAAGGGCAGATGG + Intergenic
1008299557 6:49818437-49818459 CTTTTCTTCCTTAGGACAAATGG - Intergenic
1008509488 6:52262961-52262983 CTTTGGTTCGTTAGGACAAAGGG - Intergenic
1008845157 6:55953910-55953932 TTGTTGTTTTTAATGATAAAAGG - Intergenic
1013788115 6:113805989-113806011 CTGTTGTTAATACGGACAAATGG - Intergenic
1014268699 6:119312111-119312133 CTGCTGTTCTTGGGGACACAAGG + Intronic
1019951159 7:4373868-4373890 CTGGTGTTTGTAAGGACAACAGG + Intergenic
1020733644 7:11917523-11917545 ATATTGTTGTAAAGGACAAAGGG - Intergenic
1022194775 7:28054336-28054358 CAGTTGTTATAAAGGACAACTGG - Intronic
1023478648 7:40608716-40608738 CTATTGTACTAAAGTACAAAAGG - Intronic
1023488639 7:40713629-40713651 CTGTTGTGGTTAAGGCCCAAAGG - Intronic
1023895814 7:44431977-44431999 CTGTGGTTTTTAAAAACAAATGG - Intronic
1024867290 7:53918723-53918745 CTCTTGCTCTTAATAACAAATGG - Intergenic
1029863978 7:103605583-103605605 CTGTGGTTCTTTTGGTCAAAGGG + Intronic
1031441338 7:121798319-121798341 CTGTTGTGCTTAAGCACAATGGG + Intergenic
1032163322 7:129526984-129527006 CTGTTGCTTTTAAAGACCAATGG - Intergenic
1032554484 7:132817445-132817467 CTATTCTCCTTAGGGACAAAAGG + Intronic
1033110753 7:138572920-138572942 CTGTTGTTTTGTAGGAGAAAAGG - Intronic
1033188932 7:139258170-139258192 CTACTATTCTTAATGACAAATGG - Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1038113491 8:24526251-24526273 CAGTTGTCCTTAAGGGAAAAAGG - Intronic
1038369258 8:26971235-26971257 CTGTTATAATTAAGGACAGATGG - Intergenic
1038732363 8:30138899-30138921 CTTTTCTTCTGAAGAACAAAAGG - Intronic
1040676373 8:49756042-49756064 CTGCTGTTGTTACTGACAAAGGG + Intergenic
1041488346 8:58404059-58404081 CTGGTGTTCCTAAGTACAAGAGG + Intergenic
1041681627 8:60598818-60598840 ATGTTATACTTAAGGGCAAAAGG + Intronic
1042833244 8:73054391-73054413 GTTTTGTTTTTAAGGACACAGGG + Intergenic
1043029883 8:75120962-75120984 CTTTTATCCTTAAGGATAAAAGG + Intergenic
1043064314 8:75547601-75547623 GTGTTGTTGACAAGGACAAAAGG + Exonic
1044790382 8:95841082-95841104 CTGTGGCTCTTAAGGATGAAGGG - Intergenic
1048457345 8:134590347-134590369 CTCTTTCTATTAAGGACAAAAGG - Exonic
1048628031 8:136208135-136208157 CTGTTTTTCTCAAGCCCAAAAGG + Intergenic
1048766423 8:137849001-137849023 CTGTGACTCTTCAGGACAAATGG + Intergenic
1049581656 8:143414344-143414366 CTTTTTTTTTTAAGGATAAAGGG + Intergenic
1049655257 8:143794361-143794383 CTGTTGTTCATGAGGATGAAGGG + Intronic
1050978843 9:11980942-11980964 TTGATGTTCTTAAAGACCAATGG + Intergenic
1052308413 9:27037725-27037747 ATTTTGTTCTTAAGGACCCAGGG - Intronic
1053637542 9:40027154-40027176 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1053768539 9:41438085-41438107 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1054318327 9:63623724-63623746 CTGTTGTTGTTAAGAATATAAGG - Intergenic
1054547207 9:66349566-66349588 CTGTTGTTGTTAAGAAAATAAGG + Intergenic
1055240139 9:74173969-74173991 CTGTTGTATTTAAGAAAAAATGG + Intergenic
1059536189 9:115083279-115083301 ATGTTATTATTAAGGAAAAAAGG + Intronic
1060870551 9:127036463-127036485 CTGTTGTTATGAAGAACAAATGG + Intronic
1202785351 9_KI270719v1_random:10397-10419 CTGTTGTTGTTAAGAAAATAAGG - Intergenic
1186058280 X:5674763-5674785 CTGTTTTTCTTAATGATAAATGG + Intergenic
1192024972 X:67440237-67440259 CTGTTTATTTTAAAGACAAATGG + Intergenic
1192197037 X:69035285-69035307 GTCTTTTTCTTAAGAACAAAGGG - Intergenic
1194821825 X:98517737-98517759 CTTTTGTTCATAACGACAAAGGG + Intergenic
1195405524 X:104508980-104509002 GTGATGTGCTTAAGGACACAGGG + Intergenic
1195827479 X:109018022-109018044 GTGATGGTCTTAAGGAAAAAGGG - Intergenic
1195842246 X:109186970-109186992 CTGTTTTTGGTAAGGATAAAAGG + Intergenic
1196512097 X:116523840-116523862 CTGTTTTTCTCAAGCAAAAAGGG + Intergenic
1201545055 Y:15152805-15152827 CAGTTGCTTTTAAGGACTAAAGG + Intergenic