ID: 921549424

View in Genome Browser
Species Human (GRCh38)
Location 1:216515530-216515552
Sequence AACAACAGAATGCTGTCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921549422_921549424 -8 Left 921549422 1:216515515-216515537 CCATTTGTCCTTAAGAACAACAG 0: 1
1: 0
2: 1
3: 23
4: 221
Right 921549424 1:216515530-216515552 AACAACAGAATGCTGTCATGAGG 0: 1
1: 0
2: 2
3: 13
4: 191
921549421_921549424 22 Left 921549421 1:216515485-216515507 CCTTGAAATTACACAACTCTGCA 0: 1
1: 0
2: 0
3: 18
4: 200
Right 921549424 1:216515530-216515552 AACAACAGAATGCTGTCATGAGG 0: 1
1: 0
2: 2
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921549424 Original CRISPR AACAACAGAATGCTGTCATG AGG Intronic
900946928 1:5836192-5836214 AACAAGGGAATGGAGTCATGTGG + Intergenic
902068913 1:13715122-13715144 AAAAACAGAATAATGTAATGGGG + Intronic
902444841 1:16455961-16455983 AACACCAGAAGGCAGGCATGTGG - Intronic
905391833 1:37640867-37640889 AACCACAGAATGCGGTGATAAGG - Intergenic
907324518 1:53628251-53628273 AACACTAAAATGCTGTCATCTGG - Intronic
907544024 1:55243640-55243662 AATAACAGAATGCTTTCAACAGG - Intergenic
910133436 1:83937056-83937078 TACACCAAAATGCTGTTATGTGG - Intronic
912011842 1:104976507-104976529 AACTACTGAATGTTGTCATTGGG - Intergenic
912826375 1:112907532-112907554 AACAACACAACACTGTGATGTGG + Intergenic
915015639 1:152730663-152730685 AACAACATAATCCATTCATGAGG - Intergenic
915782901 1:158573026-158573048 AGCAACAGAATGGAATCATGTGG - Intergenic
915854986 1:159373609-159373631 AACAACAGAATTTTGCCCTGTGG + Intergenic
917243720 1:172977014-172977036 AAGAACAGAATGAAGTGATGGGG + Intergenic
918316368 1:183326050-183326072 ATGAACAGAATGCAGTCATCAGG + Intronic
918880216 1:190109903-190109925 AACCAGAGAATCCAGTCATGAGG - Intronic
918915538 1:190632357-190632379 AACAACAAAATGCTAAAATGCGG - Intergenic
920728380 1:208459291-208459313 AGAAACAGAATGCAGTCAGGAGG - Intergenic
921549424 1:216515530-216515552 AACAACAGAATGCTGTCATGAGG + Intronic
923407145 1:233673292-233673314 AATAGAAGACTGCTGTCATGAGG + Intergenic
924446695 1:244139433-244139455 TACAGTAGAATGGTGTCATGTGG + Intergenic
1063787439 10:9401752-9401774 AACAAAAGAAAGCTTTCATAAGG + Intergenic
1064334088 10:14422879-14422901 AACCACTGAAAGCTGTCAAGAGG - Intronic
1066259530 10:33715633-33715655 AACCACACACTGCTGTCAGGTGG + Intergenic
1067010624 10:42709617-42709639 AAAAGTAGAATTCTGTCATGTGG + Intergenic
1067928967 10:50540492-50540514 ACCAACAGACTGCTATCAAGGGG + Intronic
1070238770 10:74656829-74656851 AAACACAGAACGCTCTCATGTGG - Intronic
1070351128 10:75593075-75593097 AAAAACGGAATGATGTCATGCGG + Intronic
1071894621 10:90051861-90051883 ATCAGCTGAATGCTGTCACGGGG + Intergenic
1072704029 10:97667092-97667114 ATAAGCAGATTGCTGTCATGCGG + Exonic
1074548925 10:114425301-114425323 AAAAAAAGAATGAAGTCATGTGG - Intergenic
1076273037 10:129172796-129172818 AACATGAGAATGATGTCCTGTGG - Intergenic
1080731305 11:34957324-34957346 AACTACTTAATGCAGTCATGGGG + Intronic
1086842658 11:91706500-91706522 CTCAACACAATGCTGCCATGTGG - Intergenic
1087525748 11:99309752-99309774 AACAACTGACGGCTGTCATTGGG - Intronic
1087704311 11:101471941-101471963 AACATCAGTAAGGTGTCATGGGG - Intronic
1087918789 11:103842430-103842452 AATAACTAAATCCTGTCATGTGG - Intergenic
1089859106 11:121572957-121572979 CAGAACAGAATGCTGGCACGGGG - Intronic
1092087935 12:5779761-5779783 ATCATCTGAATGCAGTCATGAGG + Intronic
1093305674 12:17514501-17514523 AAAAACAGCATCATGTCATGAGG - Intergenic
1095691685 12:45096421-45096443 AACAACAGAATTTGGTCATTTGG - Intergenic
1097591952 12:61585550-61585572 AACAACAATTTGCTGTCATTTGG + Intergenic
1098664042 12:73137405-73137427 AACAGCAGAATGCTGTCATAAGG - Intergenic
1099756050 12:86850287-86850309 AAGAATGAAATGCTGTCATGGGG - Intergenic
1101322873 12:103688695-103688717 AGCAACAGGAAGCTGTCCTGGGG - Intronic
1101522911 12:105501711-105501733 AAGAACAAAATTCTGTCATTTGG + Intergenic
1104390831 12:128389479-128389501 GAAAACAGAATGCAGGCATGCGG - Intronic
1106004250 13:25753710-25753732 AGCAACACATGGCTGTCATGTGG - Intronic
1106355493 13:28978704-28978726 AACAAAAGGATGTTATCATGAGG - Intronic
1108927967 13:55777226-55777248 AAGAACAGAATGCAGTCTGGTGG - Intergenic
1109148146 13:58808612-58808634 AACAACAGATTGCTGTGAAAAGG - Intergenic
1110263894 13:73516712-73516734 AATAAGATAATGCTGTGATGTGG - Intergenic
1110333631 13:74301374-74301396 AATAACAAAATGCTGTATTGGGG - Intergenic
1110839394 13:80124361-80124383 CCCAACTGAATGATGTCATGTGG + Intergenic
1114728637 14:24966537-24966559 AACAAGAGAAGGCTGTTGTGAGG + Intronic
1116195894 14:41724111-41724133 ATCAGCCAAATGCTGTCATGGGG + Intronic
1116498841 14:45595698-45595720 TACTACAGTATGCTGTCAGGTGG + Intergenic
1118263415 14:64269919-64269941 AACTACAGCAGGCTGTCATCTGG - Intronic
1118417772 14:65561724-65561746 AACAACAGAATGAAGACTTGAGG + Exonic
1118452034 14:65911824-65911846 AAAAACAGAGTTCTATCATGTGG + Intergenic
1120784329 14:88517347-88517369 AATAAGAGACTGCTGTCATTTGG - Intronic
1122146436 14:99691642-99691664 ACCAAAAGAGTGCTGTCCTGGGG - Intronic
1122182656 14:99967255-99967277 AACCAGAAAATTCTGTCATGGGG + Intergenic
1123182818 14:106485496-106485518 AACTAAACCATGCTGTCATGGGG + Intergenic
1124003889 15:25780945-25780967 AGCCCCAGAAGGCTGTCATGGGG + Intronic
1128591018 15:68897310-68897332 AGTAAAAGAAAGCTGTCATGAGG + Intronic
1130131596 15:81147948-81147970 TACAACAAAATGCTGTGATTGGG + Intronic
1130608626 15:85340066-85340088 AACAACAGAAGATTGTCATAAGG - Intergenic
1133579842 16:7132849-7132871 AGCAAGAGAATGCTGCCACGTGG + Intronic
1133859843 16:9584239-9584261 AACTACAAAATTGTGTCATGGGG - Intergenic
1135106767 16:19656459-19656481 AACAGCAGAATGTTGGGATGAGG + Intronic
1139024863 16:62804012-62804034 AAGAAGAGAATCCTGTCATATGG - Intergenic
1141029393 16:80574470-80574492 AACCTCATAATGCTGTTATGAGG - Intergenic
1142803972 17:2362041-2362063 AACCCCAGAATGCTGGCATTGGG - Intronic
1144066850 17:11632175-11632197 AAAAACAGAATTCTGACTTGGGG + Intronic
1144321072 17:14120493-14120515 ATTAATAGAATGCTGTCATAAGG + Intronic
1145752641 17:27366387-27366409 AACACTTGAAGGCTGTCATGAGG + Intergenic
1146128004 17:30244182-30244204 AAAAACAAACAGCTGTCATGGGG + Intergenic
1149376295 17:56047507-56047529 CACAACTGAATGCTGTTATGTGG + Intergenic
1151041334 17:70864040-70864062 AACAAGAGGGTGATGTCATGGGG + Intergenic
1151097168 17:71511590-71511612 AGCTAGAGATTGCTGTCATGGGG - Intergenic
1152385803 17:79973933-79973955 AAGAACAGAATTCTGTGCTGAGG - Intronic
1152927501 17:83094074-83094096 AACAGCAGAAAGCTGCCAAGGGG - Intronic
1153094601 18:1386000-1386022 AACAACAGAATGTAGCCACGTGG + Intergenic
1155535664 18:26814360-26814382 AAGAATAAAATGCTGTCATTTGG - Intergenic
1156512831 18:37655480-37655502 AACCCCAGAATCCTGCCATGGGG + Intergenic
1156653073 18:39251092-39251114 AAAAACAGAATGATGTCAATAGG + Intergenic
1158382135 18:56943423-56943445 AGCAACCGAATGCTGACATAAGG - Intronic
1158856343 18:61546295-61546317 TACAGCAGAAAACTGTCATGTGG - Intronic
1159297421 18:66512986-66513008 AACAAGAGAATATTTTCATGAGG - Intronic
1165610655 19:37149499-37149521 ATTAACAGGATGCTGTCATTGGG + Exonic
1167563754 19:50242982-50243004 AACACAAGAAGGCTGCCATGTGG + Intronic
925193363 2:1903316-1903338 AACAACAGCTTGCTTTCCTGTGG + Intronic
925732229 2:6927554-6927576 AAAAACAGAATGCAGACAGGTGG + Intronic
927164506 2:20303831-20303853 AACAACAGATTGCTGTGAAAAGG - Intronic
929650425 2:43674990-43675012 AAAAAAAAAATGCTGCCATGTGG + Intronic
929887552 2:45892308-45892330 AACAGCTGAATGCTGTCCAGTGG - Intronic
932213012 2:69947616-69947638 AACAAGAGGATACTGCCATGCGG + Intergenic
934782433 2:96979968-96979990 AACAGGAGAATTCTGACATGTGG - Intronic
937743297 2:125381105-125381127 AACAAAAGAATGATGTCAGTAGG - Intergenic
938253882 2:129838149-129838171 AAAACCAGAATTCTGTCATTTGG + Intergenic
938411086 2:131065160-131065182 AACAGCAGAAACATGTCATGTGG + Intronic
940300713 2:152174334-152174356 AACAAAAGAATACTGCAATGAGG + Intronic
942588571 2:177514520-177514542 AACAACTGAATGCCTTAATGAGG - Intronic
945022764 2:205590624-205590646 AAGAACAGAAGGCTGTCACCAGG + Intronic
945630166 2:212264842-212264864 AACAACAAAATGCTGTCTACAGG + Intronic
945728231 2:213500157-213500179 ACCCACAGAATGCTTTCATGGGG + Intronic
945929276 2:215839230-215839252 CAAAACAGAATGCAGTCTTGAGG - Intergenic
948911149 2:241003271-241003293 AACACCAGAATGGTGGCATGAGG - Intronic
1170978877 20:21192247-21192269 AACAACAAAATGGTATCATTTGG - Intronic
1173085148 20:39908997-39909019 ATCAACAGAATGAGGCCATGTGG + Intergenic
1178085671 21:29109456-29109478 AACAACCGAATGCTGAGATGGGG - Intronic
1178781737 21:35609833-35609855 AAAAGCAAAATGCTGTCTTGTGG - Intronic
1178869281 21:36359092-36359114 AACAACAGAATTCTGTTTTCTGG + Intronic
1179278491 21:39913462-39913484 CACATCAGAATGTTGTCATAAGG - Intronic
1181890015 22:26054201-26054223 TACAACAGAACTCTGTCCTGGGG - Intergenic
1182013240 22:27018107-27018129 AATCTCAGAAGGCTGTCATGAGG - Intergenic
1183188182 22:36304490-36304512 AACAACAGGATGCTGGGAAGGGG + Intronic
1184994927 22:48198701-48198723 AACTGCAGAATGCAGTCAGGGGG + Intergenic
953731754 3:45455818-45455840 AACAATAAAATTCTGTCATTTGG + Intronic
955545717 3:60027411-60027433 ACCAACAGTCTTCTGTCATGGGG + Intronic
957781461 3:84822738-84822760 AACAACAAAACCCTGTGATGGGG + Intergenic
957955059 3:87175822-87175844 AAAAAAAAAATGCTGACATGTGG - Intergenic
959511135 3:107213848-107213870 AAAAAAAGCTTGCTGTCATGTGG - Intergenic
959607203 3:108254732-108254754 AACAAAAAAATGCTGTCCTTTGG - Intergenic
961463191 3:127066034-127066056 AAGAACAGCGTGCTGTCATCTGG - Intergenic
962857953 3:139366652-139366674 AATACCAGACAGCTGTCATGCGG - Exonic
965088177 3:164126341-164126363 AACAACAGAATGAGATAATGGGG - Intergenic
967582968 3:191181137-191181159 AACAACATATAGCTGGCATGTGG + Intergenic
970986919 4:22169772-22169794 AAAAATACAAGGCTGTCATGAGG + Intergenic
973717556 4:53692228-53692250 AGCAAAAGAATGTTTTCATGTGG - Intronic
975809837 4:78155980-78156002 AACAACATAATTCTTTCATGTGG + Intronic
978930427 4:114304322-114304344 ATCCACAGAATGCTTTCATTGGG + Intergenic
980302657 4:131014256-131014278 ATCAACAGAGTGCTCTCCTGTGG + Intergenic
981549490 4:145928943-145928965 TACAGCAGATTGCTGCCATGTGG + Intronic
982843893 4:160224950-160224972 ATCAGCTGGATGCTGTCATGGGG + Intergenic
983777286 4:171623586-171623608 CAAAACAGAAAACTGTCATGTGG - Intergenic
983839307 4:172436717-172436739 AAAAACAGAAAGCTGTCAAGAGG - Intronic
984653356 4:182292074-182292096 AACAACAGAAGGCACTCATATGG - Intronic
985954418 5:3252744-3252766 AACTGCAGAATGCTGTAGTGAGG + Intergenic
986141455 5:5034338-5034360 AGCAACAGAATACTGTGCTGAGG + Intergenic
986969163 5:13311786-13311808 AACAACATAAAGCTGGCCTGGGG + Intergenic
987520615 5:18978155-18978177 AAGATCAAAATGCTGTCATCTGG + Intergenic
988098689 5:26650930-26650952 AATAACTGAATGCTATCCTGAGG - Intergenic
991457254 5:66817125-66817147 CCCACCAGAATGCAGTCATGGGG - Intronic
992298725 5:75355160-75355182 AACAACAGAAGGTTGTCTTGTGG + Exonic
993668767 5:90734082-90734104 AAGAACAAAATTCTGTCATTTGG - Intronic
994214478 5:97122240-97122262 AAGAGCAGAATGCAGTCCTGGGG - Intronic
994902153 5:105787680-105787702 AACATCTGATTGCTGTCATAAGG + Intergenic
995051110 5:107705034-107705056 AGTAACAGAATGCTTTCATGGGG - Intergenic
995422014 5:111978320-111978342 AACAACAGAATGTGATCAAGCGG + Intronic
995791285 5:115891015-115891037 TACAACAGACTCCTGTTATGAGG - Intronic
996713870 5:126570517-126570539 AATAACAAACTGCTGTAATGGGG - Intronic
998921972 5:147079503-147079525 AAGAATAAAATCCTGTCATGTGG + Intronic
1001207145 5:169774879-169774901 AACAACAAAAAACAGTCATGGGG - Intronic
1002586907 5:180254441-180254463 AAGAACAGAATGCTGTAAAAAGG + Intronic
1002719589 5:181250115-181250137 GACAACAGAATGCTTTCTGGGGG - Intergenic
1007377245 6:41465264-41465286 AACAAAAGAATTCTGGCCTGTGG - Intergenic
1010720257 6:79275552-79275574 AACAACAGAATGCTGCTAAGAGG - Intergenic
1011094261 6:83641884-83641906 AAGACTAGAATGCTGTCATTAGG + Intronic
1013324880 6:109035217-109035239 AACAAATGAATGCTGTTTTGGGG - Intronic
1013735020 6:113215753-113215775 GAAAACAGAATGCTGTCATGGGG - Intergenic
1015115041 6:129638536-129638558 AAAAACACAATGCTTTCCTGTGG + Exonic
1017396845 6:154010760-154010782 AACAAGAGAATTCGGTCAAGTGG + Exonic
1018309080 6:162489959-162489981 AGCAAGAAAATGCTGGCATGAGG + Intronic
1018360502 6:163062935-163062957 AACCCCAGAAGGCTGTCACGTGG - Intronic
1018584916 6:165346868-165346890 AAGACCAGAATTCTGTTATGAGG + Intronic
1019165653 6:170095969-170095991 GACACAAGAATGCTGTCCTGGGG - Intergenic
1019725195 7:2598285-2598307 TACAAGAGACCGCTGTCATGTGG + Intronic
1022070508 7:26909032-26909054 AACAACTGAATGGTGTAAGGTGG + Intronic
1022073694 7:26944364-26944386 AATTGCATAATGCTGTCATGAGG - Intronic
1024531229 7:50394090-50394112 AACAACACAGTGCTCTGATGAGG + Intronic
1026418489 7:70208330-70208352 AATAACATAGTGATGTCATGGGG - Intronic
1028747128 7:94339844-94339866 AATAACAAAATGCTTGCATGGGG + Intergenic
1033601649 7:142893029-142893051 GACCACAGAATCCTGTCATTCGG - Intergenic
1033991850 7:147297673-147297695 AAGAACAGAAAGCTGTTATAGGG + Intronic
1039928988 8:41965821-41965843 AACAGCAAAAAGATGTCATGGGG - Intronic
1040063585 8:43125781-43125803 AATATCAAAATACTGTCATGTGG + Intergenic
1040447969 8:47515403-47515425 ATCAACTGAATACTGTTATGTGG + Intronic
1042944689 8:74143453-74143475 AATTACAGAACGATGTCATGGGG + Intergenic
1043514286 8:80981771-80981793 AACAACAGCATGTTTGCATGTGG - Intronic
1045448649 8:102295536-102295558 CAAAACAGAATGTTGTCGTGAGG + Intronic
1045575832 8:103418727-103418749 AACAGCAGGATGAAGTCATGGGG + Intronic
1047992875 8:130305007-130305029 AACAACAAAAGGAGGTCATGTGG - Intronic
1048453854 8:134559405-134559427 AACAACAGAATGATGCTTTGTGG - Intronic
1049656069 8:143798342-143798364 AACCACAGAATGATCTCAAGTGG + Intronic
1050415026 9:5407613-5407635 AACATTAGAATGCTGTCTAGAGG - Intronic
1050757289 9:9021562-9021584 AACTACAGAATGGTCTCAGGTGG + Intronic
1051340585 9:16106280-16106302 AACAAAAGGCAGCTGTCATGGGG + Intergenic
1051759921 9:20451079-20451101 AACACCTGAATGGTGTTATGTGG - Intronic
1055095047 9:72404080-72404102 AACTTCAGAATACTGTCATGTGG + Intergenic
1055919111 9:81438731-81438753 AACAACAACCAGCTGTCATGGGG - Intergenic
1057500468 9:95593734-95593756 GACAACAGAGTCCGGTCATGGGG - Intergenic
1058245744 9:102623585-102623607 AACAACTGAATGCTGTCTACAGG - Intergenic
1059619286 9:115985673-115985695 CACATCAGAAGGTTGTCATGAGG - Intergenic
1185631004 X:1515781-1515803 AACCTCAGTATGCTGTCAGGAGG + Intronic
1189013825 X:37075249-37075271 AAGAACAAAATTCTGTCATTTGG + Intergenic
1189642507 X:43088061-43088083 AACAATGGAAAGCTGTGATGGGG + Intergenic
1189844092 X:45115799-45115821 AACCACAGCATGCTGCAATGAGG + Intergenic
1190464516 X:50712764-50712786 CAAAACAGAATCCTGTCATTTGG + Intronic
1193521093 X:82529414-82529436 AACAACAGAATTTTGTCAAAGGG + Intergenic
1195071460 X:101284944-101284966 AAGAACAAAATTCTGTCATTTGG - Intronic
1197949666 X:131880901-131880923 ACCCACACCATGCTGTCATGAGG + Intergenic
1198475611 X:136994660-136994682 AATAACAAAAAGCAGTCATGTGG - Intergenic
1199504250 X:148543583-148543605 TACTACAGCATGCTGTCATGCGG - Intronic
1200404227 Y:2792877-2792899 TACAACAGAATGCTTCCATGAGG - Intergenic
1201342412 Y:12948702-12948724 AACAACAGAATGCTATTACTGGG + Intergenic
1201367887 Y:13228397-13228419 ATCAGCTGAATGCTGTCATTGGG + Intergenic