ID: 921550973

View in Genome Browser
Species Human (GRCh38)
Location 1:216535347-216535369
Sequence GATGTTCCTCAATATGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921550967_921550973 6 Left 921550967 1:216535318-216535340 CCAGACTAAACCTTCCACTGAAC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 921550973 1:216535347-216535369 GATGTTCCTCAATATGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133
921550968_921550973 -4 Left 921550968 1:216535328-216535350 CCTTCCACTGAACATCTTTGATG 0: 1
1: 0
2: 1
3: 14
4: 166
Right 921550973 1:216535347-216535369 GATGTTCCTCAATATGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133
921550969_921550973 -8 Left 921550969 1:216535332-216535354 CCACTGAACATCTTTGATGTTCC 0: 1
1: 0
2: 2
3: 16
4: 166
Right 921550973 1:216535347-216535369 GATGTTCCTCAATATGGGCAGGG 0: 1
1: 0
2: 0
3: 9
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921550973 Original CRISPR GATGTTCCTCAATATGGGCA GGG Intronic
904135000 1:28305373-28305395 GATGTTCTTCAATAGGTGGATGG - Intergenic
905203811 1:36331352-36331374 GATGTTTTTCAATTTGGGAAAGG - Intergenic
906044216 1:42815946-42815968 TATGTGGCTCAATATTGGCAGGG + Intronic
909006982 1:70288486-70288508 GATGTTCTTCAACATGTGAATGG + Intronic
911189160 1:94930575-94930597 AATGTTCATCAATAAGGGAATGG - Intergenic
911296443 1:96122913-96122935 GATTTGTCTCAAGATGGGCATGG - Intergenic
912556180 1:110517759-110517781 GATGATCCTCAGGATGGCCAGGG + Exonic
914847750 1:151292280-151292302 GAGGTTCCCCATCATGGGCAAGG - Exonic
915776218 1:158490347-158490369 GATGTTTCTCTAGATGGGGAAGG + Intergenic
916933133 1:169600474-169600496 GTTGTTCCTCAGTATCTGCAGGG - Intronic
917150238 1:171935673-171935695 GATGTCACTGAATATGGACATGG - Intronic
917466377 1:175280579-175280601 GATGTTCTTCAATAGGTGAATGG + Intergenic
917635482 1:176931535-176931557 GATGATCCTCAATGTTGGTATGG + Intronic
917853985 1:179087175-179087197 AATGTTCATCGAAATGGGCAGGG - Intronic
918799877 1:188958819-188958841 GATGTCCCTGAATGTGGGAAGGG + Intergenic
918985209 1:191616252-191616274 GATGTTCTTCTACATGGACATGG + Intergenic
921550973 1:216535347-216535369 GATGTTCCTCAATATGGGCAGGG + Intronic
922171208 1:223156796-223156818 GATATTCTTATATATGGGCATGG - Intergenic
1064148419 10:12843273-12843295 GATTTTCCTGAAGAAGGGCAGGG + Intergenic
1064330720 10:14391676-14391698 GTTGTTCCTGCATCTGGGCAGGG + Intronic
1066478283 10:35769751-35769773 GTTGTCCCTCAATATCTGCAAGG - Intergenic
1069466669 10:68645936-68645958 CATCTTCCTCAATTTGGGTATGG - Exonic
1070025976 10:72632467-72632489 AATGCTCCTCAATATGGGTTTGG - Intergenic
1072800693 10:98390548-98390570 GATGTTCTTCCACATGGGCCTGG - Intronic
1079607014 11:22382538-22382560 AATGATGCTGAATATGGGCAGGG - Intergenic
1079890252 11:26042902-26042924 GAAGCTCCTCAATATGGGAAAGG - Intergenic
1080650321 11:34217357-34217379 GATGTCCTTCAATATGTGAATGG - Intronic
1081047942 11:38298896-38298918 GATATTCCTCAATGTGTGAATGG - Intergenic
1085489911 11:76905675-76905697 AATGTTCATTAATATGGGAATGG + Intronic
1090455127 11:126842487-126842509 GATGAACCCCAATATGGTCATGG - Intronic
1091327293 11:134700841-134700863 GATGCTGCACAACATGGGCAGGG + Intergenic
1099884917 12:88516901-88516923 GATGATACTAAATATTGGCAAGG + Intronic
1102218115 12:111176336-111176358 GATATTCCTCACACTGGGCATGG - Intronic
1104027882 12:125042105-125042127 AATGTCCCTCAATAAGGGAATGG - Intergenic
1107594204 13:41944994-41945016 GATTTTCCTGAATATATGCATGG - Intronic
1110972080 13:81776401-81776423 GATGTTCCTCAATAGGTGAAAGG - Intergenic
1111039350 13:82724861-82724883 GGTGTTCCTCAATAGGTGAATGG - Intergenic
1111123161 13:83880080-83880102 GAGGATCCTCAGTTTGGGCATGG + Exonic
1111510733 13:89258797-89258819 AATGTTTATCAATATGGGAATGG + Intergenic
1112110483 13:96291444-96291466 CATGTTCTTGAATATGGGCTAGG + Intronic
1115201647 14:30860326-30860348 GATGTTACACAATATGACCATGG - Intergenic
1116528874 14:45941741-45941763 ATTGTTCCTCAATAAGGGAATGG + Intergenic
1119495990 14:75079745-75079767 GATGCTCCTCCAGATGGGAATGG + Exonic
1120651875 14:87144039-87144061 AATGTTCATCAATATGAGAATGG - Intergenic
1120952529 14:90055197-90055219 GATGTTCTTCAATAGGTGAATGG + Intergenic
1121664187 14:95659313-95659335 GATGTGCCTCAGTTTGTGCAGGG + Intergenic
1121885343 14:97537820-97537842 GATGTCCCTCAATAGGGGAATGG + Intergenic
1123162711 14:106294802-106294824 AATGTTACTCAGTGTGGGCAGGG - Intergenic
1124457049 15:29853002-29853024 GATGTTCTTCAATAAGTGAATGG + Intronic
1125056921 15:35370936-35370958 GATGTTCTTCAATAGGTGCATGG + Exonic
1139185612 16:64802982-64803004 AATTTTCCACAATATGGACATGG + Intergenic
1139460221 16:67116132-67116154 GATGTTCCTCCATTTAGGAATGG + Intronic
1152517207 17:80832513-80832535 GCTGTTCCTTAACAAGGGCAGGG + Intronic
1154232829 18:12573549-12573571 GATGTCCCTCAATAGGTGAATGG + Intronic
1155126039 18:22876619-22876641 AATGTTCATCAATATGGGACTGG - Intronic
1158004855 18:52660916-52660938 GATGTTCCCCAGTATGGCCAGGG + Intronic
1160405486 18:78643751-78643773 ATTGTTCCTCAAAATGGGCCAGG + Intergenic
1160618033 18:80148608-80148630 AATGTTCTTCAATCTGGGAAGGG + Intronic
1161900162 19:7112559-7112581 GCTGTTCCTGAATATGTGCATGG + Intronic
1162979013 19:14226496-14226518 GAGGTTCCCCAGTCTGGGCATGG - Intergenic
1165163179 19:33830637-33830659 AATGTCCCTCAATTTGGGCTGGG + Intergenic
1165174744 19:33920110-33920132 GATGTTCTTCAATAAGCGAAAGG + Intergenic
1165369349 19:35394396-35394418 GTTTTTCCTCATTATGGGTAAGG - Intergenic
1166179535 19:41097752-41097774 GATGTTCTTCAATAAGTGAATGG + Intergenic
1167240935 19:48342610-48342632 GATCTTCGTCAACGTGGGCATGG - Exonic
1168329387 19:55558037-55558059 GATGTCCTTCAATATGTGAATGG - Intergenic
926949051 2:18221431-18221453 GATGTTTTTCAGTATGGGAATGG - Intronic
931228425 2:60353366-60353388 GATCTTTCTAAATGTGGGCAGGG - Intergenic
931788710 2:65644381-65644403 TATGTTGCTCACTCTGGGCATGG + Intergenic
933531095 2:83513297-83513319 GATGTTCTTCAATAGGTGAAAGG + Intergenic
933742732 2:85547507-85547529 TATTTTTCTAAATATGGGCAAGG - Exonic
937326424 2:120992125-120992147 GAAGTTCCTCATTAAGGCCAAGG - Exonic
938269117 2:129953599-129953621 GAGGTTCCACAATATTGGCCAGG + Intergenic
939546208 2:143557241-143557263 GATGTCCTTCAATAGGTGCAAGG + Intronic
941998240 2:171621917-171621939 GATGTTCCTCATTTTTGCCAAGG - Intergenic
946487612 2:220115803-220115825 GCTGTTTATCAATATGGGGATGG + Intergenic
947080616 2:226391924-226391946 CATGTTCCCCTATATGGGCTGGG - Intergenic
1172965702 20:38833054-38833076 GATGTTCCTCAATAGGTAAATGG + Intronic
1183664745 22:39240805-39240827 GAGGCTCCTCAATGTGGGGAGGG + Intronic
1183696431 22:39426204-39426226 GATGTTCCTCAATTTAGGATGGG - Intronic
949902870 3:8833978-8834000 GATGTTCTTCAATATGTGAATGG + Intronic
952191879 3:31031537-31031559 GATGTCCCTCAATAGGTGAATGG - Intergenic
952536180 3:34311516-34311538 GATGCTTATCAATGTGGGCATGG - Intergenic
953065809 3:39469640-39469662 AATGTCCCTCAATATGGGTTTGG + Intronic
953065860 3:39470257-39470279 GTTGTCCCTCAATATGGGTGTGG - Intronic
953525347 3:43685678-43685700 GATGCTGCTAAATATTGGCAAGG - Intronic
956275724 3:67499057-67499079 GTTGTCCCTCAATATATGCAGGG - Intronic
956623327 3:71242977-71242999 GATGAACCTCATTATGTGCAGGG + Intronic
956921828 3:73937991-73938013 GATCTCCCTGAATATGGGAAAGG - Intergenic
960119101 3:113928091-113928113 AAAGCTCCTCAATATGGGAAAGG - Intronic
965047174 3:163593994-163594016 AATGTTCCTCAATGGGGGTATGG - Intergenic
967513371 3:190338405-190338427 GCTGTTACTTAATAGGGGCATGG + Intronic
971565528 4:28134774-28134796 GATGTTCTTCAATAGGTGAATGG - Intergenic
972827811 4:42781382-42781404 TATGTTCCTCAATAGGGAAATGG + Intergenic
973990996 4:56407261-56407283 GATGATCATTAATATGGGGAGGG - Intronic
976607007 4:86993384-86993406 GATATTCCTCAATCTCTGCAGGG - Intronic
977061977 4:92271100-92271122 GCTGTTCCTGAATCAGGGCATGG + Intergenic
977421037 4:96799873-96799895 GATGTTTCTCAATAGGTGAATGG + Intergenic
977439266 4:97041621-97041643 GATGTTCTTCAATAAGTGAATGG + Intergenic
978348084 4:107792851-107792873 GAGGTTCCTCAAACTGTGCAGGG - Intergenic
984408201 4:179361754-179361776 GATGTCCCCAAATATGTGCATGG + Intergenic
986659066 5:10042772-10042794 GTTGTTCCTCAGTATCTGCAGGG + Intergenic
987286308 5:16461257-16461279 GATGCTCCACACTATGTGCAGGG + Intronic
988756427 5:34257178-34257200 GATGTTCCTCAGTAGGTGAATGG + Intergenic
992139496 5:73781435-73781457 GATGTTCCTGCATATGAGCTAGG - Intronic
997996802 5:138593088-138593110 GGTATTCCTGAAGATGGGCAGGG + Intergenic
998209588 5:140184331-140184353 AATGTTCATCAATATGAGAATGG - Intronic
1006967034 6:37998070-37998092 GATGTTCTTCAATAGGTGAATGG + Intronic
1007019936 6:38509168-38509190 GAGGTTACTCAATAGGGGGAAGG + Intronic
1008013796 6:46495192-46495214 AATGTTCCACCATATTGGCAAGG + Intergenic
1008876705 6:56337561-56337583 GATGGGCCTCAATATGGCCAGGG - Intronic
1014269242 6:119317642-119317664 GATGTTCCTCAATAGGTAAATGG - Intronic
1014779624 6:125549136-125549158 CACGTTCCCCAAAATGGGCAGGG + Intergenic
1015025090 6:128522365-128522387 GCTGTCCCCCAAAATGGGCAAGG - Intergenic
1016230794 6:141801549-141801571 GATGTTCCTCAGTAGTGGAATGG + Intergenic
1016284102 6:142453166-142453188 GATTTTTCTGAATATGGGGATGG - Intergenic
1017297148 6:152811349-152811371 GATGTTCCTCAGTAGGTGAATGG - Intergenic
1017595414 6:156023290-156023312 AATGTTCTTCAATATGTGAATGG + Intergenic
1023493002 7:40764174-40764196 GAAGTTCCCAAATATGAGCATGG + Intronic
1024726482 7:52202483-52202505 GATGTTCCTCAACAGGTGAATGG + Intergenic
1026092060 7:67308492-67308514 GATATACCTGAATATGAGCAAGG - Intergenic
1028326823 7:89538231-89538253 CATGTTCCTCATTAAGTGCATGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1030522176 7:110611480-110611502 GATGTTCCTCAGTAAGGAAATGG + Intergenic
1032641336 7:133772259-133772281 GATGTTCCTAAATATTACCAGGG - Intronic
1032865256 7:135918264-135918286 GATGTCTCTCAATGTGTGCAGGG + Intergenic
1034325380 7:150226086-150226108 GATGTTCTACAATATGTGAATGG - Intergenic
1034767824 7:153743166-153743188 GATGTTCTACAATATGTGAATGG + Intergenic
1036795419 8:11752930-11752952 ATTGTTCTTCAATATGGGAATGG + Intronic
1038508201 8:28104758-28104780 GATGTTCCTCATTTTGATCAAGG + Intronic
1038562312 8:28591060-28591082 GATGCTCCTCAATGAGGACAGGG - Intergenic
1039932128 8:42002753-42002775 AATGTTCATCAATATGGGATTGG - Intronic
1041475030 8:58255092-58255114 AATGTTCCTCATTTTGGGCATGG - Intergenic
1042843557 8:73148363-73148385 GAGGTTTCTCAGGATGGGCAGGG + Intergenic
1044437408 8:92180346-92180368 GATGTTCTTCAATAGGTGAATGG - Intergenic
1045279211 8:100735161-100735183 GAGCTTCCTGCATATGGGCAGGG - Intergenic
1047395672 8:124496705-124496727 GATGTTCCTCAGTAGGTGAATGG - Intronic
1048220515 8:132536953-132536975 GGTCTTCCTCAATATGAACATGG - Intergenic
1051189266 9:14493830-14493852 GTTGTTTCACAATATGGGGAAGG + Intergenic
1051996223 9:23220719-23220741 GGTATTCCTCAAGCTGGGCATGG - Intergenic
1058399584 9:104599092-104599114 GATGTTCCTCAGCTTGGCCATGG - Exonic
1188061924 X:25611479-25611501 GATATTCCTGAATATGAGGAAGG + Intergenic
1188897271 X:35685131-35685153 GATGTCCCTCAATAAGTGAATGG + Intergenic