ID: 921552261

View in Genome Browser
Species Human (GRCh38)
Location 1:216552264-216552286
Sequence ATCTAATACTATGCATAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921552261 Original CRISPR ATCTAATACTATGCATAAGC AGG Intronic
900883049 1:5395703-5395725 TTCAAATACTATGCATACCCAGG + Intergenic
905936365 1:41827423-41827445 ATCTAGAACTAGGCATAAGAGGG - Intronic
919203953 1:194396095-194396117 ATCTAAGAATATGTATAATCTGG - Intergenic
920818604 1:209359014-209359036 ATGTACAAATATGCATAAGCAGG - Intergenic
921552261 1:216552264-216552286 ATCTAATACTATGCATAAGCAGG + Intronic
1066590731 10:36991286-36991308 ATTTTATAATATGCATAAGCAGG + Intergenic
1066610287 10:37238625-37238647 ATCTAAAAATATTCATAAACAGG + Intronic
1067245993 10:44544815-44544837 ATCTAATACTAAGCACAAGTTGG - Intergenic
1068574957 10:58674882-58674904 ATTTAAGACTATCCATAACCAGG - Intronic
1070957863 10:80476069-80476091 ATCTAATACAATGTAAAGGCTGG + Intronic
1071331942 10:84569490-84569512 ATCTAATACAGTACATAAGATGG + Intergenic
1071799623 10:89044018-89044040 ATATAATACTATGCAACCGCAGG - Intergenic
1073821281 10:107267240-107267262 ATCTAATCCAATTTATAAGCTGG + Intergenic
1075328646 10:121555653-121555675 ATCAAATACTAAGAATGAGCTGG + Intronic
1076226947 10:128785053-128785075 ATATGATACTATACATAAGAAGG - Intergenic
1078037901 11:7826781-7826803 ACCCAAGACTCTGCATAAGCTGG + Intergenic
1080581021 11:33643704-33643726 ATCTAAAGTTATGCAGAAGCAGG - Intronic
1087464411 11:98486910-98486932 ATTAAATTCTATGCATAAGATGG + Intergenic
1087652626 11:100885654-100885676 ATCAAATACTATACATATGTTGG + Intronic
1087658490 11:100956288-100956310 ATCTATTACTAAGCATAACCTGG - Intronic
1088732775 11:112697943-112697965 ATTTAATACTCTGCATTAACAGG - Intergenic
1090383940 11:126345712-126345734 ATTCAATACTAGGAATAAGCCGG - Exonic
1092345805 12:7713645-7713667 ATCTAATACCATGAAGGAGCTGG + Intronic
1099690164 12:85941945-85941967 TTTTAATATTATGCATAGGCCGG + Intergenic
1110010762 13:70330995-70331017 ATCTAATAATTTCTATAAGCTGG - Intergenic
1115896131 14:38089628-38089650 GGTTAATACTATGCATAATCAGG + Intergenic
1127861163 15:62995295-62995317 ATCTAATACTCTGCATTCACAGG - Intergenic
1131093815 15:89643306-89643328 ACCTAATACAATGTAAAAGCTGG - Intronic
1135878931 16:26233485-26233507 TTTTAATACTATGCAGAGGCAGG - Intergenic
1138006322 16:53341256-53341278 ATCTACCACTAAGCATAAGAGGG + Intergenic
1138555374 16:57768016-57768038 ATCTAATACAATGAAAATGCTGG + Intronic
1139689015 16:68627523-68627545 ATCTAATAGTTTGCCTATGCTGG - Intergenic
1141533561 16:84663248-84663270 ATCTAATCCTGTGGCTAAGCGGG - Intronic
1147520310 17:41165586-41165608 ATATAATTCTTTGTATAAGCTGG - Intergenic
1158810697 18:61030557-61030579 ATCTAATAGGATGCAGAACCAGG + Intergenic
1159240486 18:65737064-65737086 ATCTAATTCTATGCTTAAATTGG + Intergenic
1163093378 19:15036793-15036815 AACCGATACTATCCATAAGCTGG - Intergenic
1164397701 19:27880290-27880312 ATGTAATACTATGCAGAAAAAGG - Intergenic
931955152 2:67415571-67415593 ATCTTATACTATGCATAAAGTGG + Intergenic
932857216 2:75248258-75248280 ATGTAATACTTTACATATGCTGG - Intergenic
936790571 2:116146141-116146163 ATGTAATATTGTGCACAAGCAGG + Intergenic
940546726 2:155098944-155098966 AACTAATACAATCAATAAGCGGG - Intergenic
943608876 2:190008611-190008633 ATAAAAAACTGTGCATAAGCTGG - Intronic
943678333 2:190740254-190740276 ATTTAAAACTATACATAATCAGG + Intergenic
945536804 2:211027285-211027307 ATATAATAAAATGCAAAAGCAGG - Intergenic
945801588 2:214438540-214438562 TTCTAATTCTATGAATATGCTGG - Intronic
946009183 2:216551305-216551327 ATCTAATCCTATGTATGGGCAGG - Intronic
946664271 2:222032789-222032811 ATCTAACACTGAGCACAAGCAGG + Intergenic
1170861681 20:20110295-20110317 ATATAATACTATGTATAAACTGG + Intronic
1174232141 20:49054317-49054339 ATCTAATGCTGTGCTTATGCAGG - Intronic
1177034488 21:16025291-16025313 TTCTAATACTATGCCTTAGGAGG + Intergenic
1177535379 21:22420848-22420870 ATATAATAGTATGCGTAGGCTGG + Intergenic
1181303375 22:21898885-21898907 ATTTAATAATAAGTATAAGCTGG + Intergenic
951297173 3:20951908-20951930 ATTTTATACTATACATATGCTGG - Intergenic
951782815 3:26383975-26383997 ATATAATACTATACATCAGCAGG - Intergenic
954805027 3:53213592-53213614 ATCTTATACTATGCATGATGTGG + Intergenic
957118395 3:76057178-76057200 ATCTGATACTAGGCGTATGCGGG + Intronic
957661827 3:83166318-83166340 ATATAATAATATGCAAAATCTGG + Intergenic
959829099 3:110838964-110838986 ATATAAAAATATGCATAAGTGGG - Intergenic
961813654 3:129536378-129536400 ATGGAATACTAGGCATACGCAGG + Intergenic
963807331 3:149736901-149736923 ATATAATGCCATGCATAAGTGGG + Intergenic
965950070 3:174298229-174298251 ATATAATACTATGTGTATGCAGG - Intergenic
975342077 4:73253963-73253985 TTCTAGTACTGTGCTTAAGCAGG + Intronic
977311642 4:95395153-95395175 AACTAATACTATCCATAATATGG - Intronic
979699853 4:123655505-123655527 ATCTAATACTCTTCATAACATGG - Intergenic
980515369 4:133851010-133851032 ATCTTATAATATGCATGTGCAGG + Intergenic
980935816 4:139224716-139224738 ATCTAAACCTATGCAATAGCTGG - Intergenic
980951872 4:139387735-139387757 TTCTAATAGAATGCATATGCAGG + Intronic
981616248 4:146647802-146647824 ACCTAATGCTTTGCACAAGCTGG + Intergenic
982967654 4:161934140-161934162 ATCACTTACTATGCTTAAGCTGG - Intronic
986594312 5:9404892-9404914 ATCTAATACTTTTCAAAAGGAGG - Intronic
989405825 5:41059564-41059586 ATTAAATACTATGTATTAGCTGG + Intronic
993936318 5:94007924-94007946 ATGTAATACTCTGCATGTGCAGG - Intronic
994578921 5:101614093-101614115 ATCTAATACTTTGCATGGGTGGG + Intergenic
1001114209 5:168925300-168925322 AGCTGCTACTATGCACAAGCTGG + Intronic
1001722482 5:173868010-173868032 ATCCAATACATTGAATAAGCAGG + Intergenic
1010965461 6:82201359-82201381 ATCTAATATACTGCTTAAGCTGG + Intronic
1012041797 6:94215489-94215511 ATAGAATAGTATGCATAAACTGG - Intergenic
1014347238 6:120287875-120287897 AACTAATATTATGAAAAAGCAGG + Intergenic
1016101351 6:140105180-140105202 AGCTAATATTATGCATAATTGGG - Intergenic
1020747544 7:12096431-12096453 GTCTAATAATATGAGTAAGCAGG + Intergenic
1023299006 7:38748532-38748554 ATCTAATAGTATTCACAAGGTGG - Intronic
1026133880 7:67642587-67642609 ATCTCATACTGTGCACAAGTGGG + Intergenic
1032859872 7:135866872-135866894 ATGTAATATTTTGCAAAAGCTGG - Intergenic
1033410663 7:141114764-141114786 ATCTCAGACTCTGCTTAAGCGGG + Intronic
1036111878 8:5912055-5912077 ATATAATACTATGTATAAATAGG + Intergenic
1039155925 8:34556795-34556817 ACCTAATATTTTGCATAAGAAGG - Intergenic
1044115003 8:88325345-88325367 ATCTAATACTTTCCTAAAGCAGG + Intronic
1050398626 9:5227516-5227538 ATGGAATACTATGCATAAAAGGG + Intergenic
1051303928 9:15687249-15687271 AGCTAACACTATGCTTAAGAGGG + Intronic
1052066193 9:24023302-24023324 ATCTAATACTATGCAAACATTGG - Intergenic
1189651502 X:43194855-43194877 ATATAATAAGATGCATCAGCTGG + Intergenic