ID: 921553500

View in Genome Browser
Species Human (GRCh38)
Location 1:216568504-216568526
Sequence CTGGCAGACTGGAGGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 421}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921553500_921553506 -9 Left 921553500 1:216568504-216568526 CCAACTTCCCTCCAGTCTGCCAG 0: 1
1: 0
2: 1
3: 31
4: 421
Right 921553506 1:216568518-216568540 GTCTGCCAGAGGCCTCAGGATGG 0: 1
1: 0
2: 3
3: 26
4: 288
921553500_921553508 -1 Left 921553500 1:216568504-216568526 CCAACTTCCCTCCAGTCTGCCAG 0: 1
1: 0
2: 1
3: 31
4: 421
Right 921553508 1:216568526-216568548 GAGGCCTCAGGATGGACCTGTGG 0: 1
1: 0
2: 2
3: 32
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921553500 Original CRISPR CTGGCAGACTGGAGGGAAGT TGG (reversed) Intronic
900160855 1:1222790-1222812 GTGGCTGTCAGGAGGGAAGTGGG - Intronic
900229882 1:1551316-1551338 CTGGCAGGCTGGAGAGCTGTGGG - Intronic
900547401 1:3236487-3236509 CTTGCAGGCTGGAAGGGAGTGGG + Intronic
900715799 1:4142688-4142710 CTGGCAGCCAGGATGGAAATGGG - Intergenic
901380828 1:8872810-8872832 CTGGCAAACAGGATGGATGTGGG + Intronic
902388755 1:16090774-16090796 CTGGCAATGTGGAGGGAAATGGG + Intergenic
902428343 1:16342539-16342561 CTCCCAGACTGGAGTGCAGTGGG - Intronic
902926876 1:19701710-19701732 TGTGCAGACTGGTGGGAAGTGGG + Intronic
904491049 1:30859257-30859279 GTGGCAGTCTGCAGGGAGGTAGG - Intergenic
904611493 1:31728365-31728387 CTGGCAGCAGGGAGGGATGTGGG - Intronic
905878004 1:41445680-41445702 CTGGCAGACAGGTGGGCAGATGG + Intergenic
906089383 1:43165555-43165577 GTGACAGACTTGAGGGAAGCTGG - Intronic
906146452 1:43563547-43563569 CTGAGAGACTGGAGGGAAACTGG + Intronic
906234923 1:44200501-44200523 CTGGAAGGCTTGAGGGAAGCGGG - Intergenic
907471017 1:54673507-54673529 CTGACAGACTATAGGGAAGAAGG - Intronic
907925155 1:58949061-58949083 CTGGCACACAGTAGGGAAGTAGG + Intergenic
909574858 1:77162445-77162467 TTGGGAGAATGGAGGGAAATTGG + Intronic
910618704 1:89229362-89229384 CGGGCAGAATGGAACGAAGTTGG - Intergenic
912380937 1:109247972-109247994 CTGGCAGGATGGATAGAAGTAGG - Intergenic
912629342 1:111233547-111233569 CTGGCATCCAGGAGGGAGGTGGG + Intronic
912705467 1:111908639-111908661 CTGGAACACGGGAGAGAAGTTGG - Intronic
912897026 1:113602885-113602907 TTCGCAGACTGGAGTGCAGTGGG - Intronic
913548042 1:119889085-119889107 CTTGCAGACTAGAAGGAATTGGG + Intergenic
914973034 1:152328829-152328851 CAGCCAGACTGGCAGGAAGTGGG - Intergenic
915166693 1:153951960-153951982 CTGCCTGACTGGAGGGATGAAGG - Intronic
916446926 1:164881150-164881172 CCGGGAGTCTGGAGAGAAGTGGG + Intronic
917491043 1:175498725-175498747 CTGGCAGAGTGCAAGGAGGTGGG + Intronic
917568983 1:176244257-176244279 CTAGCAGGATGGAGGGAAGAGGG - Intergenic
919920021 1:202162008-202162030 AGGACAGACTGGAGGGAAGCAGG + Intergenic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
920852030 1:209634525-209634547 CTGGCGGACCCGAGGGAAGGTGG + Exonic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
923339953 1:232998560-232998582 CTGGCATGCTGGTGGGAAGAGGG + Intronic
923403925 1:233642285-233642307 GTGGAAACCTGGAGGGAAGTTGG - Intronic
1062955604 10:1538459-1538481 CTGGTAGACGAGAGAGAAGTGGG + Intronic
1063881679 10:10538254-10538276 CTGGCAGACCAGAGGGAGGCAGG - Intergenic
1064352891 10:14592919-14592941 CTGGAAGCCTGGGGGAAAGTAGG - Intronic
1065047906 10:21760522-21760544 CTGGCAAAATGCAGGGAAATAGG + Intronic
1065115238 10:22477532-22477554 CCTGCAGACTGGAGAGACGTGGG - Intergenic
1066303504 10:34117421-34117443 CACACAGACTGGAGGGCAGTGGG + Intronic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067357654 10:45545799-45545821 CTGGCTGAGTGAAGGGAAGAAGG - Intronic
1067415314 10:46097877-46097899 CTGGGAAACTGGAGGGAGGTAGG - Intergenic
1067541896 10:47160826-47160848 TTGTCTGACTGGAGGGAGGTAGG - Intergenic
1069383384 10:67862680-67862702 CTGGCAGAGTGTAGGGCACTTGG - Intergenic
1069833890 10:71296734-71296756 CTGGCAGAGGTGAGGGAAGTCGG + Exonic
1069951966 10:72025223-72025245 CTCCCAGACTGGAGGGCAGAAGG + Intergenic
1070456984 10:76626972-76626994 CTGGCTGCCTGGAAGGAGGTGGG + Intergenic
1072553780 10:96498832-96498854 GTGGCAGACTGGAAGGAGCTTGG + Intronic
1072737911 10:97891583-97891605 CTGCCAGCCTGGAGGGCAGGGGG + Intronic
1073327457 10:102650948-102650970 CTGGGAAACTGGAAGGAAGATGG - Intronic
1073446846 10:103586026-103586048 CAGGCAGCCTTGGGGGAAGTGGG + Intronic
1074094532 10:110298651-110298673 ATGGCAGTCTGGAGTGAAGATGG - Exonic
1074117951 10:110471777-110471799 CAGGCAGACTGGAGGCAGGTTGG + Intergenic
1074247683 10:111711574-111711596 GGGGCAGAATGCAGGGAAGTGGG - Intergenic
1074809747 10:117091825-117091847 CTGGCAGAGTGGGAGGAAGAGGG - Intronic
1075118764 10:119649158-119649180 CTCCCAGACTGGAGTGCAGTGGG - Intergenic
1075528442 10:123205294-123205316 CAAGTAGACTGAAGGGAAGTGGG + Intergenic
1075764114 10:124879291-124879313 CTGCCAGACTCGGGGGTAGTGGG + Intergenic
1075844985 10:125538164-125538186 CTGCCAGACTGCAGGCATGTGGG - Intergenic
1076712404 10:132345629-132345651 CTGGCAGTGTGGAGGGCACTGGG + Intronic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1078091642 11:8268044-8268066 CTGGGAGACTGGCTGGCAGTGGG + Intronic
1078158318 11:8817646-8817668 CTGGCAGACTGAAGGAGAGGGGG - Intronic
1079022807 11:16923512-16923534 CTGGAAGGCTGGAGTGAGGTAGG + Intronic
1079039054 11:17045185-17045207 TGGTGAGACTGGAGGGAAGTAGG + Intergenic
1080277846 11:30523294-30523316 CAGGCAGGCTGGGGGGAGGTGGG + Intronic
1080912598 11:36618616-36618638 CTGGCAGACAGGAGGGCCTTAGG + Intronic
1081685494 11:45040068-45040090 CTGGCAGAGAGGAGGAAAATTGG - Intergenic
1081797142 11:45828442-45828464 CTGGAAAACTGGAGGCCAGTGGG - Intergenic
1081989768 11:47331670-47331692 CCAGGAGCCTGGAGGGAAGTTGG - Exonic
1082028489 11:47588995-47589017 TTGGAAGAGTGGAGGGAAGCAGG + Exonic
1082811431 11:57481452-57481474 CTAGCAGAGGGGAGGGAAGTGGG + Intergenic
1083343079 11:61971484-61971506 CGGACCCACTGGAGGGAAGTCGG + Intergenic
1083999207 11:66287161-66287183 CTGGCACACAGGAAGGACGTAGG - Intronic
1084196383 11:67525255-67525277 CTGGCAGAACGCAGGGAGGTGGG - Intergenic
1084699752 11:70778802-70778824 CTGCCAGTGTGGAGGGCAGTAGG - Intronic
1085047430 11:73361943-73361965 CCGGCAGAATGGAGGGAGGCAGG - Intronic
1085315021 11:75539592-75539614 CTGGGAGATTGGAGGGCAGGGGG + Intergenic
1085342607 11:75743233-75743255 CTCACAGCCTGGAGGGAGGTTGG - Intergenic
1085573824 11:77584658-77584680 CATGCAGACTGGAGTGCAGTGGG + Intronic
1086167976 11:83801531-83801553 CTGTAAGACTGGAGGAAACTTGG - Intronic
1087231595 11:95672192-95672214 GAGCCAGACTGTAGGGAAGTAGG + Intergenic
1089661887 11:119991285-119991307 CAGGCAGAGGGAAGGGAAGTTGG + Intergenic
1090561273 11:127935451-127935473 CTGGCAGGCAGGAGGGAGGCTGG - Intergenic
1090587351 11:128228302-128228324 ATTGCAGACTGGAGAGATGTTGG + Intergenic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092830933 12:12443760-12443782 CAGGCAAACTGGGGGGAAATGGG - Intronic
1093441155 12:19197928-19197950 ATGACAGACTGGAGGGGAGGTGG - Intronic
1093724266 12:22485315-22485337 GTGGCAGGCTGGAGGGAAGGTGG + Intronic
1093752356 12:22814843-22814865 CTGGCAAACTGTCAGGAAGTGGG + Intergenic
1095044736 12:37489506-37489528 GTGGCAGAAGAGAGGGAAGTAGG - Intergenic
1096403107 12:51323824-51323846 CTGGCAGATTGGAGAGAGGTCGG - Intronic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1098032130 12:66265720-66265742 CTGCCATCCTGGAGGGAAGATGG - Intergenic
1099424483 12:82505353-82505375 CTGGCAGACAGGAGGCAGGAAGG + Intergenic
1100268139 12:92998233-92998255 CTGGCAGGCTGGAGTGCAGTGGG + Intergenic
1100516155 12:95329813-95329835 CACCCAGACTGGAGGGCAGTGGG - Intergenic
1102291978 12:111708327-111708349 CTAGGAGAGTGGAGGGAATTGGG - Intronic
1102574861 12:113849926-113849948 CTGGGAGACTGGAGGAAAGAGGG + Intronic
1104847301 12:131852929-131852951 CCGACAGACAGGAGGGAGGTCGG - Intergenic
1106021404 13:25919400-25919422 CTGAGAGACTGGAGGGATTTGGG + Intronic
1106644353 13:31616599-31616621 CAGGCAGGCTGGAGTAAAGTGGG - Intergenic
1108774907 13:53753900-53753922 CTGTCATGCTGGAGGGAAGAGGG + Intergenic
1109231252 13:59759905-59759927 CTCCCAGACTGGAGTGCAGTGGG - Intronic
1111541522 13:89673473-89673495 CTGGCAGACAAAAGGTAAGTTGG + Intergenic
1111796504 13:92927333-92927355 CACCCAGACTGGAGTGAAGTGGG - Intergenic
1112442924 13:99437793-99437815 TTGGCAGAGTGGAGGGAGGAAGG - Intergenic
1113249248 13:108433082-108433104 CTGGCAATTTGGAGGGAAATTGG - Intergenic
1113800811 13:113085478-113085500 CTGGCACACAGCAGGGACGTGGG + Intronic
1114220175 14:20689337-20689359 CTGGCAGGTTGAAGGGAAGAAGG + Intronic
1114225068 14:20730632-20730654 CTGATAGACTGGATGGAAGGAGG - Intergenic
1115688490 14:35821199-35821221 CTGGCAGATTTTAGGGAAGAGGG + Intergenic
1116922184 14:50590442-50590464 CAGGCAGAAAGGAAGGAAGTAGG - Intronic
1117435972 14:55715582-55715604 TTGGACGTCTGGAGGGAAGTGGG - Intergenic
1117460249 14:55938281-55938303 CTGCCAGACAGAAGGGAAGAGGG - Intergenic
1118053022 14:62050070-62050092 CGGGCAGAATGGAGGCAAGTTGG - Intronic
1119371210 14:74145412-74145434 CTGGCATACTGTAAGGAAGAAGG - Intronic
1119666558 14:76489199-76489221 CAGACAGACTGGAGGGGAGATGG - Intronic
1119702152 14:76762471-76762493 CTGGCAGAGCGGAGAAAAGTCGG - Exonic
1120152172 14:81048546-81048568 CTGGCAGCTTGGAGCAAAGTAGG - Intronic
1120759159 14:88270639-88270661 AAGGCAGACTGGGGGGAAGAGGG + Intronic
1121415506 14:93776507-93776529 CTGGCAGACTGGAGTCAGGTGGG - Intronic
1123129121 14:105971821-105971843 CTAGCAGTCTGGAGGGATGTAGG + Intergenic
1124382247 15:29176735-29176757 CTGGCGACCTGGAGGGAAGGAGG - Intronic
1124621772 15:31278104-31278126 CTGGCTGCCTGGAGGGATGGTGG + Intergenic
1125807483 15:42506278-42506300 CAGGCAGGCTGGAGTGTAGTGGG + Intronic
1125933346 15:43615603-43615625 CTGGGAGACTGGAGAGCAGTAGG + Exonic
1125946444 15:43715065-43715087 CTGGGAGACTGGAGAGCAGTAGG + Intergenic
1126781163 15:52140109-52140131 ATTGCTGACTGGAGGGATGTTGG - Intronic
1127583790 15:60362514-60362536 CTGGCAGAGTGGAGAGGAGCTGG - Intronic
1128750538 15:70145689-70145711 CTGCCAGTCTTGAGGGATGTGGG + Intergenic
1128990773 15:72258210-72258232 CTGGGAGGATGGAGGGTAGTTGG - Intronic
1129463910 15:75713152-75713174 AAGGCAGAAAGGAGGGAAGTAGG - Intergenic
1129986329 15:79922984-79923006 CTGGCAGAGGGGAGGTCAGTTGG - Intronic
1131507147 15:93029109-93029131 CTGGCAAACTGCAGGGACTTGGG - Intergenic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133220520 16:4317391-4317413 CTGGCATCCTGGAGGGAAGGTGG + Intronic
1133332312 16:4982234-4982256 CTGGGAGCCAGGAGGGAAGGGGG + Intronic
1134803735 16:17107867-17107889 GTGGCAGCCTTGAGGGAAGGAGG + Exonic
1135009378 16:18861119-18861141 CTGGCAGCTTGGAGAGAACTGGG - Intronic
1135098937 16:19589282-19589304 CTTCCAGACTGGAGTGCAGTGGG + Intronic
1135316418 16:21450044-21450066 CTGGCAGCTTGGAGAGAACTGGG - Intergenic
1135369340 16:21882295-21882317 CTGGCAGCTTGGAGAGAACTGGG - Intergenic
1135442473 16:22488838-22488860 CTGGCAGCTTGGAGAGAACTGGG + Intronic
1135740320 16:24969713-24969735 CTTCCAGGCTGGAGGGAAGGAGG + Intronic
1136143546 16:28302186-28302208 CTGGAAAACTGGAGAGAAGGAGG + Intronic
1136313088 16:29428756-29428778 CTGGCAGCTTGGAGAGAACTGGG - Intergenic
1136326532 16:29530526-29530548 CTGGCAGCTTGGAGAGAACTGGG - Intergenic
1136441222 16:30270511-30270533 CTGGCAGCTTGGAGAGAACTGGG - Intergenic
1136871161 16:33809046-33809068 GTAGCAGTCTGGAGGGATGTAGG - Intergenic
1138243946 16:55452317-55452339 ATGGGAGACTGGAGCGAGGTGGG + Intronic
1138700142 16:58854057-58854079 CGGGGAGATTGGAAGGAAGTTGG + Intergenic
1139422782 16:66859263-66859285 CAGCCACACTGGAGTGAAGTGGG - Intronic
1139667965 16:68471556-68471578 CTGAGAGACTGAAGGGAACTAGG - Intergenic
1139684365 16:68591147-68591169 CGGCCAGTCTGGAGTGAAGTGGG - Intergenic
1139887721 16:70222827-70222849 CTGGCAGCTTGGAGAGAACTGGG - Intergenic
1140949082 16:79798470-79798492 CAGCCAGACTGAAGGGAAGAGGG - Intergenic
1141088457 16:81113445-81113467 CTGCAAGACTGGAGGGAGGCAGG + Intergenic
1141152207 16:81572096-81572118 CCGGGAGACAGGAGGGAAATGGG - Intronic
1141946011 16:87310713-87310735 CTGGCTGCATGGAGGGAGGTGGG - Intronic
1203101011 16_KI270728v1_random:1307012-1307034 GTAGCAGTCTGGAGGGATGTAGG + Intergenic
1142809495 17:2388648-2388670 CAGGGAGTCTGGAGGGGAGTGGG - Intronic
1143086141 17:4417508-4417530 CTGGCAAACTGAGGGGAAGCTGG - Intergenic
1143485760 17:7252643-7252665 CTGGCTGAGGGGACGGAAGTGGG + Intronic
1143763541 17:9121908-9121930 CTGGCAGATTGGAGGGTATTGGG - Intronic
1144456659 17:15424262-15424284 CTGGTAGCCTGGAGGGAGGCAGG - Intergenic
1144790262 17:17854293-17854315 CAGGCTGATGGGAGGGAAGTGGG + Intronic
1145178329 17:20721507-20721529 CTGGCTGGCTGGAGGGAGGGCGG + Intergenic
1146565649 17:33910735-33910757 CTGCCTCTCTGGAGGGAAGTAGG + Intronic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1148339900 17:46867167-46867189 CTCACAGTCTGGAAGGAAGTTGG - Intronic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151833272 17:76568304-76568326 CTGGCAGGAGGGAGGGAAGGGGG + Intronic
1151872799 17:76848025-76848047 CTCCCAGGCTGGAGTGAAGTAGG + Intergenic
1152512971 17:80802941-80802963 ATGGCAGACTGGACGGAGGGAGG - Intronic
1153010010 18:529896-529918 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1153504182 18:5779159-5779181 GTGGCAGAGTGAAAGGAAGTGGG + Intergenic
1154158834 18:11965060-11965082 CACACAGACTGGAGGGCAGTGGG - Intergenic
1155046858 18:22110358-22110380 CTGCCAGGCTGGAGTGCAGTGGG - Intergenic
1156665327 18:39398609-39398631 CACGCAGGCTGGAGGGCAGTGGG + Intergenic
1157177502 18:45464975-45464997 CAGGCAGGCAGGAGAGAAGTAGG + Intronic
1157378932 18:47193235-47193257 CTGGCAGGTGGGTGGGAAGTGGG - Intergenic
1157515310 18:48306995-48307017 GTGGGAGAGTGGAGGGAAGGTGG - Intronic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1158507293 18:58057965-58057987 ATGGCTGAGTGAAGGGAAGTGGG - Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1160088960 18:75808114-75808136 CTGGGAGACTGGTGGCAAGGTGG - Intergenic
1161246267 19:3254045-3254067 TTGGCAGCCAGGAGGGAAGATGG + Intronic
1161914355 19:7217597-7217619 CTGCCAGGCTGGAGTGCAGTGGG + Intronic
1162374261 19:10295708-10295730 CCGGTAGACTAGACGGAAGTGGG + Intronic
1162525993 19:11206882-11206904 CTGTCAGGCTGGAGTGCAGTGGG + Intronic
1163847850 19:19647318-19647340 GTGGCAGACTGCAGGGTGGTGGG + Exonic
1164357967 19:27464373-27464395 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
1166009146 19:39928178-39928200 CTGACAGACTGGAGATAAGGAGG + Exonic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166802223 19:45465356-45465378 GTGGAAGACTAGAGGGACGTGGG - Intronic
925611052 2:5703455-5703477 CTGGCAGACTGGGAGGTATTTGG + Intergenic
927023650 2:19043297-19043319 CTGGCAGCCAGCAGGGAAATGGG - Intergenic
927747264 2:25634052-25634074 CCGGCAGCCAGGAGGGAGGTGGG + Intronic
928029689 2:27767917-27767939 CAGGCAGAGTGGAAGGAACTGGG - Intergenic
930219525 2:48732243-48732265 CTGGCAGAGAGGAAGGGAGTGGG + Intronic
930309131 2:49715758-49715780 CTGGCAGTGTGGAGGAAGGTAGG + Intergenic
931766912 2:65465017-65465039 TTGAAAGACTGGAGGCAAGTAGG - Intergenic
932396155 2:71449932-71449954 CTAACAGAATGGAGGGAGGTTGG + Intergenic
932453970 2:71834468-71834490 CTGGGAGACTGGAGGAGGGTGGG + Intergenic
932485306 2:72080981-72081003 CTGGCAGACTGGCCTGAAGGTGG - Intergenic
932512714 2:72311346-72311368 CTGGCAGCCTGCAAGGAAATGGG - Intronic
932715243 2:74096196-74096218 CTGACAGACTGGTAGGAAGCAGG + Intronic
933314676 2:80701896-80701918 ATGGTAGATTAGAGGGAAGTAGG + Intergenic
933426410 2:82118332-82118354 ATGGCAAACTGGAAGGAAGATGG + Intergenic
934518568 2:95005050-95005072 CTGGCAGGCTGTAGGAAGGTGGG - Intergenic
934632478 2:95943441-95943463 CTCCCAGGCTGGAGGGCAGTGGG - Intronic
934753802 2:96811186-96811208 CTGGAAGCCTGGAGAGAAGGTGG + Exonic
935200191 2:100849749-100849771 CTGGAAAACTGGAGAGAGGTTGG + Intronic
935947814 2:108301902-108301924 CTAGGGGACTGGAGTGAAGTTGG + Intronic
936118511 2:109721851-109721873 CGGGCAGGCTGGTGGGAATTGGG - Intergenic
936417124 2:112326343-112326365 CTGGCAGATAGGGAGGAAGTGGG - Intronic
937919957 2:127121997-127122019 TTGGCAGCCTGGAGGGAGCTGGG + Intergenic
938201982 2:129379689-129379711 CTGGCCCACTAAAGGGAAGTGGG + Intergenic
941441158 2:165538493-165538515 GTGAGAGACTGGATGGAAGTGGG - Intronic
941493156 2:166167401-166167423 TGGGGAGACAGGAGGGAAGTGGG + Intergenic
942181402 2:173384355-173384377 CTGGAAGACTGGAAGGATGAAGG - Intergenic
944580259 2:201125966-201125988 CTGGCAGTCAGGAGGGAAAAAGG + Intronic
945019483 2:205556881-205556903 CTGGCAGGCTGGAGTGAAAAAGG - Intronic
946074484 2:217062665-217062687 CTGGCAGGATTGAGGGAAGGTGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946322399 2:218961493-218961515 AAGGCAGACAGGAGGGAAGATGG - Exonic
946679275 2:222196102-222196124 CTTGCAGAGTTGAGGGAAATGGG - Intergenic
948134108 2:235622943-235622965 CCTGCACACTGGAGGGAAGCAGG + Intronic
948636368 2:239340408-239340430 GTGGCAGACTGGAGCTCAGTGGG - Intronic
948760333 2:240186252-240186274 GCTGCAGACTGGAAGGAAGTGGG + Intergenic
1169000544 20:2164783-2164805 CTGGCTGACTTCAGGCAAGTGGG - Intronic
1169314664 20:4580219-4580241 CAGGCAGACAGGAAGGAAGGAGG - Intergenic
1170709654 20:18778872-18778894 CTGTCACAGTGGAGGGAAGTAGG + Intergenic
1170783831 20:19450433-19450455 GTGGCAGAGGGGAGGGAGGTTGG + Intronic
1170858901 20:20084519-20084541 CTCTCAGACTCGAGGGAAGCAGG + Intronic
1170901134 20:20464532-20464554 CTTGCAGACAAGAAGGAAGTGGG - Intronic
1171024537 20:21616950-21616972 CATGCTGCCTGGAGGGAAGTCGG - Intergenic
1171390825 20:24800591-24800613 CTGGCAGGATGGAGGGGAGCTGG - Intergenic
1171801760 20:29627130-29627152 GTGGCAGAAGAGAGGGAAGTAGG + Intergenic
1172323480 20:34016274-34016296 CTAGCAGACTGTTAGGAAGTTGG + Intronic
1172889977 20:38257219-38257241 CTGGCACACAGTAGGGAACTGGG + Intronic
1173013463 20:39203620-39203642 GTAGCAGAGAGGAGGGAAGTTGG + Intergenic
1174180666 20:48672419-48672441 CTGGCAGCAGGGAGGGCAGTAGG - Intronic
1174203239 20:48821526-48821548 CTAGAATACTGGAGGGAGGTGGG - Intronic
1174599174 20:51710477-51710499 CTGGGAGATTGCAGGGAAGAGGG - Intronic
1175133330 20:56805881-56805903 CTTGGAGATTGGAGGGATGTGGG - Intergenic
1175532492 20:59683753-59683775 TTGGAAGATTGGAGGGAAATTGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1176522599 21:7835915-7835937 CTGGAAGTCTGGATGGATGTGGG + Intergenic
1176996182 21:15558056-15558078 CTGGCAAAGTGAAGGGAAGATGG - Intergenic
1177989745 21:28022769-28022791 CTGGAAGACTGTATGGAAGGAGG + Intergenic
1178656619 21:34465927-34465949 CTGGAAGTCTGGATGGATGTGGG + Intergenic
1180675069 22:17581214-17581236 CCTGGAGACTGGAGGGAAGGGGG - Intronic
1181000809 22:19987057-19987079 CAGACAGGTTGGAGGGAAGTTGG - Intronic
1181570798 22:23767055-23767077 CTAGCAGAGGGGAGGGATGTTGG - Intronic
1181920253 22:26315021-26315043 GTGGCAGACGGGAGGGTGGTTGG + Intronic
1182815604 22:33160836-33160858 CAGGCTGAGTGAAGGGAAGTTGG + Intergenic
1183099947 22:35577910-35577932 TTGGCAGACCAGTGGGAAGTGGG + Intergenic
1183211206 22:36452497-36452519 CTGGCAGAGGGAGGGGAAGTTGG + Intergenic
1183270709 22:36861001-36861023 CTGCCAGACTGGAGAGAAGCAGG + Exonic
1183438223 22:37807724-37807746 ATGGCAGAGGGGAGGGAAGGGGG - Intergenic
1184224642 22:43122346-43122368 CTGGCACGCTGGGAGGAAGTTGG - Intronic
1184418422 22:44365148-44365170 CTGCCAGACAGGAGTGAAGGGGG + Intergenic
1184471020 22:44696428-44696450 CTGGCTGACAGGTGGGAAGGTGG + Intronic
1184542043 22:45132571-45132593 GTGGCAGACTCGGGGGAAGCAGG + Intergenic
1184796282 22:46735245-46735267 CCGCCAGCCTGGTGGGAAGTAGG - Intronic
950432177 3:12957163-12957185 GTGGCAGAGTGGAAGGAAGGAGG - Intronic
950556883 3:13701357-13701379 AGGGCAGAGTGGAGGGAAGGAGG - Intergenic
950728948 3:14939414-14939436 CAGGCAGGATGGAGGGAGGTAGG + Intergenic
951537903 3:23756336-23756358 CAGGGAGACTGGAGGCAGGTGGG - Intergenic
951670059 3:25171182-25171204 GTGGAAGACAGGAAGGAAGTAGG - Intergenic
952175609 3:30859224-30859246 CTGGGAGGCTGGGGGGAAGCAGG + Intronic
952375605 3:32764708-32764730 CTGGCAGAGTTGACGGAACTGGG - Exonic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953927041 3:46987888-46987910 CCGGCAGACCGCAGGGATGTGGG - Intronic
954071239 3:48144272-48144294 TAGGCTGACTGGTGGGAAGTTGG - Intergenic
954248780 3:49352545-49352567 CAGGCATCCTGGAGAGAAGTTGG + Intergenic
956121660 3:65972071-65972093 CTGCCAGGCTGGAGGAAGGTGGG - Intronic
956580598 3:70807995-70808017 CAGGCAGAGTGAAGGGAAATGGG - Intergenic
956746200 3:72312687-72312709 CTGGAGGATGGGAGGGAAGTAGG + Intergenic
956979010 3:74614725-74614747 CGGGCGGACTGGAGGGAGGGAGG + Intergenic
957155761 3:76542005-76542027 GTGGCAGAGAGGAGGGAAGAAGG - Intronic
959855688 3:111154975-111154997 TTGCCAGACTGGAGTGCAGTGGG + Intronic
960043114 3:113170310-113170332 AGGGCAGACAGGAGGGAAGCTGG - Intergenic
960366836 3:116783105-116783127 TTGGCTGACTGAAGGGAAGAAGG - Intronic
960775338 3:121244750-121244772 ATGGCAGACTAGAAGGGAGTGGG + Intronic
960961340 3:123072571-123072593 CTGGCAGAGAGGAGGCAAGGAGG - Intronic
961459704 3:127042646-127042668 CTGGCTGCCTGGAGTGAGGTTGG + Intergenic
962263686 3:133930781-133930803 CTGGCCCATGGGAGGGAAGTGGG - Intergenic
962884231 3:139608881-139608903 TTGGGAGACAGGAGAGAAGTGGG - Intronic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
967758142 3:193193520-193193542 TTGGTAGGCTGAAGGGAAGTGGG - Intergenic
968122619 3:196136328-196136350 CTGGGAGACTGGAAGGGAGCCGG - Intergenic
968618745 4:1594085-1594107 CTGGCAGCCTGGGGGGACCTGGG - Intergenic
968976659 4:3825637-3825659 CTGGCAGACTGGACGCATCTGGG - Intergenic
969462886 4:7338081-7338103 CTGGCTGGCTGGATGGATGTTGG + Intronic
969509293 4:7608536-7608558 CTGACAAACATGAGGGAAGTGGG + Intronic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
972336422 4:38110811-38110833 CTGCCAAACTCGAGGGAAGCTGG - Intronic
978361516 4:107935313-107935335 CTGGGAGCCTGGAGGCAATTTGG + Intronic
979179628 4:117708529-117708551 ATGGCTGAATTGAGGGAAGTAGG + Intergenic
982099911 4:151957759-151957781 CTTGCAGAATGGAGGGAAAAGGG - Intergenic
982108088 4:152028768-152028790 CTGGAAGGCTGGTGGGAAGAAGG + Intergenic
983183684 4:164677428-164677450 CTGGGAGAATGGAGCCAAGTTGG + Intergenic
983466878 4:168105269-168105291 GGGGCATACTGGAGGGAGGTGGG - Intronic
984419029 4:179496281-179496303 CAGGCATAGTGGAGAGAAGTGGG - Intergenic
984615918 4:181897112-181897134 CTGGCAGGCTGAAGGGAAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985249115 4:188005452-188005474 CAGGCAGAGTGAAGGGATGTGGG - Intergenic
985706005 5:1401774-1401796 CTGGGAGGCTGGATGGACGTGGG - Intronic
985948332 5:3203758-3203780 CTAGCATGCTGGAGGGATGTAGG - Intergenic
986458330 5:7942726-7942748 CTGGGAGAGTGGCAGGAAGTGGG - Intergenic
986988251 5:13523281-13523303 CTGACAAACAGAAGGGAAGTTGG - Intergenic
988075780 5:26352471-26352493 CTCGCAGGCTGGAGTGCAGTGGG - Intergenic
988784131 5:34550190-34550212 CTCCCAGGCTGGAGCGAAGTAGG - Intergenic
989168590 5:38453796-38453818 CTGGCAGTTTAGGGGGAAGTTGG - Intronic
989171838 5:38479077-38479099 CGGGAAGAGGGGAGGGAAGTTGG - Exonic
990851780 5:60213233-60213255 CTGGCAGACAGAAGCGAAGCAGG + Intronic
992638406 5:78747490-78747512 CTGGCAGACTTGTGGGGAGGGGG - Intronic
992815101 5:80428999-80429021 CTGGCAGAATGGAACCAAGTTGG + Intronic
994177325 5:96725090-96725112 CTGTGAAACTGGAGGAAAGTAGG + Intronic
994699083 5:103110953-103110975 GTGGCAGATTGGAGGGCAGTAGG - Intronic
994879969 5:105478137-105478159 CACGCAGACTGGAGTGCAGTAGG + Intergenic
997014187 5:129912012-129912034 CTCCCAGACTGGAGTGCAGTGGG - Intronic
998752534 5:145339122-145339144 CTAGCAGACTGGAGGCAAGATGG + Intergenic
999984540 5:156990730-156990752 CTGTCAGAGTGTTGGGAAGTAGG + Intergenic
1000157476 5:158565881-158565903 ATGGCAGACTGGAGTGAATCTGG - Intergenic
1001397578 5:171428206-171428228 CTGGCATGCTGGAGGAATGTTGG + Intronic
1001447724 5:171798808-171798830 CAGGCAGGCTGGGAGGAAGTGGG - Intergenic
1001818912 5:174694387-174694409 CTGTCAGAACGCAGGGAAGTCGG - Intergenic
1002048550 5:176555858-176555880 CTCCCAGGCTGGAGGGCAGTGGG - Intronic
1003005430 6:2376697-2376719 CAGGTAGCCTGGAGGGACGTGGG + Intergenic
1003601102 6:7518195-7518217 CTGAAAGACTGGAAGGAATTGGG - Intergenic
1004051259 6:12081872-12081894 GGGGAAGCCTGGAGGGAAGTGGG - Intronic
1004284646 6:14309897-14309919 CTGGTACTCTGGAGGGAGGTTGG + Intergenic
1006513250 6:34532873-34532895 CCGGCAGCCTGGAGTGGAGTGGG - Exonic
1006595939 6:35192531-35192553 CTGGGAGCCTGGAGGGGTGTAGG - Intergenic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1007105858 6:39282447-39282469 CTAGCAGGCTGGAGGGCAGTGGG - Intergenic
1007178798 6:39913724-39913746 AGGGCAGTGTGGAGGGAAGTCGG + Intronic
1007540642 6:42640548-42640570 CTGGCAGACTGGAGAGACCCAGG + Intronic
1007655275 6:43447785-43447807 CGTGCAGCCTGGAGAGAAGTTGG + Exonic
1007809859 6:44478064-44478086 GTGCCAGGCTGGAGGGAAGAGGG + Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1009727707 6:67556953-67556975 CTGGGAGAATGGAAGCAAGTTGG - Intergenic
1009796994 6:68481774-68481796 GTAGGAGAGTGGAGGGAAGTGGG + Intergenic
1010615502 6:78007080-78007102 CGGGGAGAATGGAAGGAAGTTGG + Intergenic
1012768543 6:103399563-103399585 CTGGCACAGTGAAGGGAACTGGG - Intergenic
1013231733 6:108166656-108166678 CTTGCAGGCTGGAGGGCAGCTGG + Intronic
1014089241 6:117384812-117384834 CTGGCAGATTAGAGGGCAGGAGG + Intronic
1014126686 6:117784026-117784048 CTGGAAGACTTGGGGGAAGGTGG - Intergenic
1014250705 6:119113013-119113035 CTGGCAGAGGGGAGTGTAGTTGG + Intronic
1014831261 6:126105423-126105445 CTGGCAGTCAGAAGGGACGTGGG + Intergenic
1015911308 6:138169981-138170003 CTGCAAGACTGGAGACAAGTTGG + Intronic
1016311531 6:142738589-142738611 ATGGGAGAGTGAAGGGAAGTAGG + Intergenic
1016395302 6:143617631-143617653 CTGCTAGACTGGAGGGAGGAAGG - Intronic
1016692812 6:146958189-146958211 GTGGCAGTCTAGAGGGAAGGTGG + Intergenic
1017219714 6:151951845-151951867 CTGGCAGAAGGGAGAGGAGTAGG - Intronic
1017627084 6:156359629-156359651 CTGGCAAAGAGGAGGGAAGATGG - Intergenic
1018252846 6:161889534-161889556 CAGACAGACTGGAGGGATGGAGG + Intronic
1018565659 6:165148987-165149009 CTGGAAGGCTGGAGGTAAGTTGG - Intergenic
1018825239 6:167403942-167403964 CAGGCAGAGTGGAGGGAGGGAGG + Intergenic
1018869618 6:167770869-167770891 CTGTCTGGATGGAGGGAAGTGGG - Intergenic
1019225498 6:170504306-170504328 TTGGAAGACTGGAGGGGAGCTGG - Intergenic
1019809911 7:3157782-3157804 ATGAAAGACAGGAGGGAAGTCGG + Intronic
1019935984 7:4258309-4258331 CTGCCAGGCTGTAGGGAAGCAGG - Intronic
1019981893 7:4627856-4627878 CTTGCAGACTGGAAGGATCTTGG - Intergenic
1021164120 7:17313147-17313169 CTGGTAGTCTGGAGGAAATTTGG - Intronic
1021165819 7:17339182-17339204 ATGGCAGCCAGGAGGGAACTAGG - Exonic
1021963645 7:25896044-25896066 TTGGCAGGCTGGAGGGTAGAGGG - Intergenic
1023422376 7:39995533-39995555 CTGGAAGACAGGTAGGAAGTAGG - Intronic
1023647301 7:42331093-42331115 TTGCCAGGCTGGAGGGCAGTGGG - Intergenic
1025290665 7:57719053-57719075 GTGGCAGAAGAGAGGGAAGTAGG - Intergenic
1025790599 7:64683969-64683991 CTGTCAGATTGGATGGAAGTAGG - Intronic
1025876015 7:65480274-65480296 CTGGCAGAGTGGAGCCAAGATGG + Intergenic
1026184529 7:68072122-68072144 CAGCCAGACTGGAGTGGAGTGGG + Intergenic
1026618914 7:71933167-71933189 CTGGCAAAGAGGAGGGAAGATGG - Intronic
1027870649 7:83702583-83702605 CTGGTAGACTGGAGGGAAATGGG - Intergenic
1028004207 7:85541741-85541763 CTGGCAGAATGGAACCAAGTTGG - Intergenic
1028689471 7:93635411-93635433 CTGGCAGACAGCAAGGAAATGGG + Intronic
1029255547 7:99267074-99267096 CTGGCAGACTTGCCCGAAGTAGG - Intergenic
1029702402 7:102256057-102256079 CTGGGAGACTGGAGGGAGTCGGG - Exonic
1029790886 7:102841943-102841965 CTGGTAGAATGAAGGGTAGTGGG - Intronic
1030017825 7:105242469-105242491 TTGCCAGACTGGAGTGCAGTGGG - Intronic
1032086433 7:128886379-128886401 CTGGCTGAGGGGAGGGAGGTGGG + Intronic
1032088444 7:128896214-128896236 CTGGCGGACTGTGGGTAAGTGGG + Intronic
1033175158 7:139116862-139116884 CTCCCAGGCTGGAGGGCAGTGGG - Intergenic
1033231801 7:139604072-139604094 CTGGCGGACTGGAGGTAAGCAGG - Exonic
1035094263 7:156340751-156340773 TTGCCAGACTGGAGTGCAGTGGG - Intergenic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037599790 8:20384373-20384395 CTGGCAGCCTGGGGGCAAGATGG + Intergenic
1037775771 8:21834733-21834755 CCAGCAGACTGGAAGCAAGTCGG + Intergenic
1038303287 8:26375974-26375996 CACCCAGACTGGAGGGCAGTAGG + Intergenic
1039421165 8:37442392-37442414 ATGGAAGACAGGAGGGAAGAAGG - Intergenic
1039698057 8:39932898-39932920 TTGCCAGACTGGAGTGCAGTAGG - Intergenic
1040364105 8:46696672-46696694 CTCCCAGACTGGAGTGCAGTGGG + Intergenic
1041146516 8:54881706-54881728 CTGGCAGACGGGTGGAAAGGTGG + Intergenic
1041234792 8:55789230-55789252 TTGTCAGACTGGAAGAAAGTGGG - Intronic
1042194747 8:66222508-66222530 CTGGGAGACTGGAGACAAGGAGG - Intergenic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1042835196 8:73073211-73073233 ACGGAAGACTGCAGGGAAGTAGG - Intronic
1042868982 8:73380455-73380477 CTGGCTTGCTGGAGGGAAGAAGG - Intergenic
1043001923 8:74770024-74770046 CTGGTAGATGGGAGGGAAGGAGG + Intronic
1043130088 8:76448825-76448847 TTGGCAGACTGGAGGTATATAGG - Intergenic
1044208725 8:89523501-89523523 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1047264186 8:123290439-123290461 CTGGCAGACTGAAGGCCAGAGGG + Intergenic
1047330212 8:123880173-123880195 TGGGAAGAGTGGAGGGAAGTTGG - Intronic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1051480372 9:17553827-17553849 CATGCAGACTGGAGTGTAGTGGG + Intergenic
1053010671 9:34631042-34631064 CTGGAAGACTGGAGAGCAGAGGG + Intergenic
1053375736 9:37604798-37604820 CAGGGAGAATGAAGGGAAGTGGG + Intronic
1054165777 9:61726321-61726343 GTGGCAGAAGAGAGGGAAGTAGG + Intergenic
1054865868 9:70000290-70000312 GTGGGAGGCTGGAGGGAGGTGGG + Intergenic
1055627377 9:78188000-78188022 AAGGCAGAAGGGAGGGAAGTTGG - Intergenic
1055791783 9:79930053-79930075 ATGGCAGACTGGGGAGAAGGAGG - Intergenic
1057888329 9:98848381-98848403 CTGGCAGAAAGGAGAGAAGCAGG + Intronic
1058866713 9:109167409-109167431 CTGCCTGCGTGGAGGGAAGTCGG - Intergenic
1059764375 9:117370041-117370063 GTGGCAGTGTGGAGGGAGGTGGG - Intronic
1060292634 9:122318493-122318515 CTGGCAGACTGGTGGAAGGCAGG + Intronic
1060396939 9:123322876-123322898 CTGGCAGACAGAGAGGAAGTGGG + Intergenic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060840810 9:126791929-126791951 AGGGGAGACTGGAGGGAAGGAGG - Intergenic
1061673159 9:132200718-132200740 CTGGCAGATGGGAGTGAAGCAGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1061989807 9:134152728-134152750 ATGACAGACTAGAGGGAAGAAGG - Intronic
1062183635 9:135204687-135204709 CTGGCAGCCAGCAGAGAAGTAGG - Intergenic
1062243346 9:135551293-135551315 CTGGCAGAATGCAGGGAGGGAGG - Intergenic
1062366466 9:136211776-136211798 CTGGAAGACTGGTGGGAGGTGGG - Intronic
1062421275 9:136483774-136483796 CTGGGAGGCTGGAGGGCAGGCGG + Exonic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1187068482 X:15864528-15864550 CTGGCAGCCAGGAGAGAAATTGG + Intergenic
1188331826 X:28882254-28882276 CTTGCAGACCGGAAGGGAGTGGG + Intronic
1188575998 X:31650924-31650946 CTGGCAGAATAGAGAAAAGTTGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1189261295 X:39680615-39680637 CTGGCAGATTATAGGAAAGTTGG - Intergenic
1190255849 X:48761799-48761821 CTGGCAGCCTGGAGGGCAGATGG - Exonic
1191607663 X:63079836-63079858 ATGGCAGACTGGAGTGAATAGGG - Intergenic
1194573731 X:95585464-95585486 CTGACAGACAGCAAGGAAGTGGG - Intergenic
1195658791 X:107358685-107358707 CTGGAAGACTGGAGGGACAGAGG + Intergenic
1196483200 X:116175191-116175213 CTTGCAGACTCGAAGAAAGTTGG - Intergenic
1196933865 X:120709600-120709622 CTGGAAGAATGGGGAGAAGTTGG - Intergenic
1197467341 X:126820981-126821003 CTGGCAGGCTGGAGGCAGGAGGG + Exonic
1198772451 X:140145295-140145317 CGGACAGACAGGAGGGAACTAGG + Intergenic