ID: 921554083

View in Genome Browser
Species Human (GRCh38)
Location 1:216576041-216576063
Sequence GATATTAATTTCCCTGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921554077_921554083 14 Left 921554077 1:216576004-216576026 CCATTCCTCTTTTTTTCCACTGA 0: 1
1: 1
2: 6
3: 99
4: 861
Right 921554083 1:216576041-216576063 GATATTAATTTCCCTGCTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
921554079_921554083 9 Left 921554079 1:216576009-216576031 CCTCTTTTTTTCCACTGAGGCAG 0: 1
1: 0
2: 4
3: 33
4: 334
Right 921554083 1:216576041-216576063 GATATTAATTTCCCTGCTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165
921554082_921554083 -2 Left 921554082 1:216576020-216576042 CCACTGAGGCAGAGACTGAGGGA 0: 1
1: 0
2: 3
3: 44
4: 384
Right 921554083 1:216576041-216576063 GATATTAATTTCCCTGCTCCTGG 0: 1
1: 0
2: 0
3: 16
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921554083 Original CRISPR GATATTAATTTCCCTGCTCC TGG Intronic
901827657 1:11872945-11872967 TATATTCATTTCCCAGCTCCTGG - Intergenic
902617035 1:17629547-17629569 GAGTTTATTTTACCTGCTCCAGG + Intronic
903432988 1:23322957-23322979 CATATTAATTTCCTTTCTCTAGG - Intronic
903728607 1:25472055-25472077 GAGATTATCTTCCCTGTTCCTGG - Intronic
905486906 1:38305744-38305766 GATATTTATCTCTCTGCGCCTGG - Intergenic
907542676 1:55230254-55230276 CATTTTCATCTCCCTGCTCCTGG + Intergenic
908418377 1:63935174-63935196 AAAACTAATGTCCCTGCTCCTGG + Intronic
908684746 1:66703052-66703074 GTTACTCATTTTCCTGCTCCAGG - Intronic
909565544 1:77049396-77049418 GATATTAATTTCAATTCTTCGGG - Intronic
913485613 1:119330243-119330265 GATATTAAGTTCCTTGCACAGGG - Intergenic
916805899 1:168260989-168261011 GAAATTAATGCCCCTGCTCATGG + Intergenic
918049004 1:180958241-180958263 GATATTAATTTCTATGTGCCAGG - Intergenic
919202483 1:194373850-194373872 GATCTTAATGTTCCTGTTCCAGG - Intergenic
919832834 1:201554110-201554132 GATCTGAACTTCCCAGCTCCAGG - Intergenic
920040887 1:203096090-203096112 GATATTAATATAGGTGCTCCAGG - Intronic
920910319 1:210210355-210210377 TAGATTAATGTCCCTGTTCCTGG - Intergenic
921554083 1:216576041-216576063 GATATTAATTTCCCTGCTCCTGG + Intronic
923519831 1:234726756-234726778 GATATGAATTTGGTTGCTCCAGG + Intergenic
924543992 1:245008197-245008219 AATATTATTTTCCATGCTCAGGG - Intronic
924691779 1:246358686-246358708 GAAATTAAATAACCTGCTCCTGG + Intronic
924885161 1:248207575-248207597 GAAATTAAATAACCTGCTCCTGG - Intergenic
1063274831 10:4554263-4554285 GATGTTAATTCCTCTGCTCCAGG + Intergenic
1064454565 10:15474500-15474522 AATATTAATTCCCCCACTCCAGG - Intergenic
1064976239 10:21119803-21119825 GATAGCTATTTCCCTGATCCAGG + Intronic
1068132765 10:52915350-52915372 GGTTTTAATTTCTCTTCTCCTGG - Intergenic
1068375580 10:56175285-56175307 GATATTTAATTCCCTTCCCCAGG - Intergenic
1071148726 10:82607385-82607407 GAAATTAATATAGCTGCTCCAGG + Intronic
1075060033 10:119250244-119250266 GAAATTAAATCACCTGCTCCAGG + Intronic
1075947043 10:126442882-126442904 GAAATTAAATTACCTGCTCCTGG + Intronic
1083417079 11:62532846-62532868 GATATTAAGGTTTCTGCTCCTGG - Exonic
1084920148 11:72462645-72462667 GATATTGATCTGCCTTCTCCTGG - Intergenic
1086925039 11:92631059-92631081 GATATTTATTTCCCTCCTTCAGG + Intronic
1089381907 11:118039357-118039379 GATTTTTATTTCCCTGGCCCAGG + Intergenic
1089696347 11:120218515-120218537 AATATTTATTCCTCTGCTCCTGG - Intronic
1099889142 12:88568542-88568564 GATATTTATTTCCTTCCTCTAGG - Intronic
1109351360 13:61186579-61186601 GATATTAATATCCAATCTCCTGG - Intergenic
1110593857 13:77296095-77296117 GATATTAACTTCCAGGCTACTGG + Intronic
1111155221 13:84312564-84312586 GATAAAAATTTTACTGCTCCTGG - Intergenic
1115237878 14:31225908-31225930 GATGTAAATTTCCATGCTCTTGG - Intergenic
1116117373 14:40672301-40672323 TATATTAAATTCCCTTCACCTGG - Intergenic
1120256386 14:82124680-82124702 GATTGTAATTTGCCTCCTCCTGG - Intergenic
1120421030 14:84286320-84286342 CATATTATTTTCCCTGCTTAAGG + Intergenic
1122976381 14:105172533-105172555 GAAAGTATGTTCCCTGCTCCTGG - Intergenic
1126348812 15:47723416-47723438 GACATTCATTTCCCTGATCTTGG + Intronic
1128976997 15:72161389-72161411 GAGATGAATTTCCATGCTCTGGG - Exonic
1137313758 16:47294464-47294486 GACATTGATTCTCCTGCTCCAGG + Intronic
1137827831 16:51514966-51514988 GAGAATAATTTGCCTGCTCCTGG - Intergenic
1139372369 16:66477110-66477132 GCTATTCAGTTCCCTCCTCCCGG + Intronic
1140805179 16:78526505-78526527 GAGATTAAGTTCCCTGCCCCTGG - Intronic
1141229427 16:82150918-82150940 CATTTGAATTTTCCTGCTCCAGG - Intronic
1141329506 16:83096378-83096400 TATCTTAATTCCCCTGTTCCTGG + Intronic
1143988382 17:10935270-10935292 CATATTATTTTACCTACTCCAGG + Intergenic
1146017729 17:29247244-29247266 GATATTCATGGCCCTCCTCCTGG - Intronic
1147188211 17:38724369-38724391 GATATTAAATACCCTGCTGTTGG + Intronic
1147306782 17:39569649-39569671 GATCCTAATTTCCCAGATCCTGG + Intergenic
1148704888 17:49621150-49621172 GATCATATTTTCCCTGCTCCAGG + Intronic
1153069250 18:1086815-1086837 GAAATTAAGTAACCTGCTCCTGG - Intergenic
1153712879 18:7818043-7818065 GTTATTCACTTCCCTCCTCCAGG + Intronic
1156482390 18:37444481-37444503 AATATTAAATTCTTTGCTCCAGG + Intronic
1156884750 18:42122189-42122211 GTTATTAATTTGCCTTCTCTAGG - Intergenic
1156942051 18:42779860-42779882 GATATTAAGTAACCTGCTCAAGG - Intronic
1158997041 18:62932152-62932174 GATGTGAATTCACCTGCTCCGGG - Intronic
1159181318 18:64909351-64909373 GATATTTATTTCCTTCCTCCTGG - Intergenic
1160022914 18:75194377-75194399 CATTTTAATTTTCCTGCTGCTGG + Intergenic
1163141825 19:15354894-15354916 GATGCTCATTTCCCTGTTCCAGG - Exonic
1165637303 19:37352198-37352220 GATATTAATATAGCTACTCCAGG + Intronic
1166242805 19:41505483-41505505 GATATTACTTTCCCTGTCGCGGG - Intergenic
927311263 2:21634266-21634288 GATAGTCATTTCCCTTTTCCGGG - Intergenic
931847665 2:66221493-66221515 CAGAGTACTTTCCCTGCTCCTGG - Intergenic
931982827 2:67712543-67712565 GATATTTCTTTCCCAGCTCGGGG + Intergenic
933326331 2:80842806-80842828 GAAATTTACTTCCCTTCTCCAGG - Intergenic
933393871 2:81707135-81707157 CATCTCACTTTCCCTGCTCCTGG + Intergenic
934473422 2:94576617-94576639 GATATGCATTTCCCTGGCCCAGG - Intergenic
935049678 2:99514165-99514187 AATATTTATTTCCCTTCTCATGG - Intergenic
937654858 2:124363124-124363146 CATATTAATTGCCCTGTTGCTGG + Intronic
940157037 2:150668201-150668223 GAAATTAAATAACCTGCTCCTGG + Intergenic
940254008 2:151710019-151710041 TCTCTTAAGTTCCCTGCTCCTGG - Intronic
941027010 2:160467968-160467990 GATATTAAATTACCTGCTTGAGG - Intronic
942703679 2:178743330-178743352 AATATTAATTTCTCTGATTCTGG - Intronic
943683081 2:190788388-190788410 GATTTGAATTTCCCTGCTGGTGG + Intergenic
944841604 2:203629158-203629180 GACATAAATATCCATGCTCCAGG + Intergenic
945199547 2:207267455-207267477 GTTATTAATTTCCCTCCACTTGG + Intergenic
1168806861 20:676671-676693 GTAATTAATTTTCCTGCTGCCGG + Intergenic
1169510920 20:6262709-6262731 GAAGTTTATTTCCCTGCTCCAGG - Intergenic
1169578367 20:6991361-6991383 GATGTTCATTTACCTGCACCTGG - Intergenic
1169812214 20:9619737-9619759 GTTATTAATTCCCCTGCTGTGGG + Intronic
1171382624 20:24745032-24745054 GATTCTAATTCCCCTGCACCTGG - Intergenic
1171750432 20:29043831-29043853 TCTATTAATTTGCCTGTTCCAGG + Intergenic
1172599985 20:36176956-36176978 GATTTCACCTTCCCTGCTCCTGG + Intronic
1173107361 20:40150610-40150632 CTTATTTATTTCTCTGCTCCAGG - Intergenic
1174160020 20:48543892-48543914 AATATTCAATTGCCTGCTCCTGG + Intergenic
1174783599 20:53412592-53412614 CTTATGAAGTTCCCTGCTCCGGG + Intronic
1177110052 21:17015917-17015939 TATATTCATTTGCTTGCTCCTGG - Intergenic
1179245253 21:39627597-39627619 GCTATTCATTTTTCTGCTCCTGG + Intronic
1179415219 21:41192994-41193016 CATATTTATTTCCCATCTCCTGG + Intronic
1179523580 21:41961121-41961143 GGGAATAATTTTCCTGCTCCAGG + Intergenic
1180392577 22:12298042-12298064 TCTATTAATTTGCCTGTTCCAGG - Intergenic
1180407171 22:12566726-12566748 TCTATTAATTTTCCTGTTCCAGG + Intergenic
1183752334 22:39728650-39728672 GAAATCAATTGCCCTGCTCCAGG - Intergenic
1184840427 22:47049258-47049280 GATATTAACCTCCCAGCTCCTGG + Intronic
950993146 3:17463317-17463339 GATATTTATTTGCCTACTTCTGG + Intronic
951112251 3:18818294-18818316 GTTATTGACTTTCCTGCTCCAGG + Intergenic
951341696 3:21496079-21496101 GCTGTGAATTTCCCTGGTCCTGG - Intronic
952487492 3:33829368-33829390 TAAATTAATTGCCATGCTCCAGG + Intronic
953073954 3:39550890-39550912 AATATTCATTTGCCTGCCCCGGG + Intergenic
959039767 3:101407659-101407681 GAAATTAAATAACCTGCTCCTGG + Intronic
960839257 3:121939781-121939803 GATAGTAATTTACTTGCTCAAGG - Intronic
961999802 3:131284200-131284222 TGTATTTGTTTCCCTGCTCCAGG + Intronic
963822253 3:149910185-149910207 GCAATTAATATCCCTGTTCCCGG - Intronic
964654016 3:159046090-159046112 AATATGAATTTCCCTCGTCCAGG - Intronic
964738954 3:159945375-159945397 GATTTTAATTTCTATGCTGCAGG + Intergenic
964889559 3:161519252-161519274 GATATTATTCTCCTTGCCCCTGG + Intergenic
965184799 3:165449004-165449026 GAAATTAAATAACCTGCTCCTGG + Intergenic
965400463 3:168206981-168207003 GAAAGTACTTTCCCTGCTGCTGG + Intergenic
967857340 3:194128294-194128316 GATCTTAATTTCTCAGCTCCAGG - Intergenic
968125404 3:196155670-196155692 GAAATTAAATAACCTGCTCCTGG - Intergenic
969069983 4:4528580-4528602 GTTATAAATTACCCAGCTCCAGG + Intronic
971395129 4:26220236-26220258 AATATAAATTTCTATGCTCCAGG - Intronic
971654305 4:29322310-29322332 AATCTTAATTTCCCTTTTCCAGG - Intergenic
975553961 4:75641082-75641104 AATATTATTTTAACTGCTCCTGG - Intergenic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
977142058 4:93386256-93386278 GGGATTAATTTACCTGTTCCAGG - Intronic
977267407 4:94872097-94872119 GATGTCAATTTTCCAGCTCCTGG - Intronic
978316706 4:107445911-107445933 GAAATTAAATAACCTGCTCCTGG - Intergenic
979887463 4:126046926-126046948 GATATTAATTAAGCTTCTCCGGG - Intergenic
980525385 4:133984918-133984940 CCTATTAAATTCCCTGTTCCTGG - Intergenic
983524978 4:168751526-168751548 GACATTAAGTTTCTTGCTCCAGG - Intronic
984839504 4:184055044-184055066 AATATTAATTACCTTGCTCCTGG - Intergenic
986294128 5:6423350-6423372 CCTATTAAATTCCCAGCTCCTGG - Intergenic
986924126 5:12725289-12725311 AATATTATTTTCCCTGAGCCTGG + Intergenic
987250918 5:16100448-16100470 TGTATTAATTTTCCTCCTCCTGG - Intronic
988830224 5:34979761-34979783 CATATTAATTTCCTTTCTTCTGG - Intergenic
990891517 5:60655884-60655906 GAAATTAAATAACCTGCTCCTGG - Intronic
992102767 5:73423167-73423189 AATGTTAATTTCCATGCCCCTGG + Intergenic
992389460 5:76316842-76316864 GATATCACTTTCTATGCTCCTGG + Intronic
993666919 5:90710310-90710332 AATATTACTAACCCTGCTCCTGG - Intronic
997640230 5:135444146-135444168 GATAATAACTTCCCTTCTCACGG + Intergenic
1005412664 6:25566712-25566734 AAAATTCATTTCCCTCCTCCTGG + Intronic
1006231373 6:32589843-32589865 GTTACTGATTTCCTTGCTCCTGG + Exonic
1007901304 6:45415646-45415668 CATATAGATTTCCCAGCTCCTGG - Intronic
1008049220 6:46882917-46882939 GATAATGACTTCCCTTCTCCTGG - Intronic
1008561160 6:52726147-52726169 GATATTAATTTCTCTGCACTGGG - Intergenic
1009229248 6:61043094-61043116 AATATCATTTTCTCTGCTCCGGG + Intergenic
1010704456 6:79090616-79090638 GATATTACTTTCTTTGCTCTTGG - Intergenic
1013319585 6:108974254-108974276 GAAATTAAGTTACTTGCTCCAGG - Intronic
1015571006 6:134621505-134621527 TTTATTAATTTTCCTGCACCTGG - Intergenic
1019566568 7:1683846-1683868 GACATTAATTTACCTACTCCAGG + Intergenic
1020023967 7:4885474-4885496 GATATTCCTCACCCTGCTCCTGG + Intergenic
1022385709 7:29897036-29897058 TCTATTAATTTCACTGCTCTAGG + Intronic
1022761367 7:33356490-33356512 GATGTTAAATTCACTTCTCCTGG - Intronic
1024445773 7:49476728-49476750 GCTATGAATTTCTCTGGTCCTGG + Intergenic
1029208489 7:98884829-98884851 CATGTAAATTTCCCTTCTCCTGG + Intronic
1029310763 7:99661612-99661634 CATATTTATTTCTGTGCTCCAGG - Intronic
1033009277 7:137602729-137602751 GAAATGAATTACCCTTCTCCTGG - Intronic
1033623130 7:143080447-143080469 GAAATTAAATAACCTGCTCCTGG + Intergenic
1035603030 8:909330-909352 GAAATTAATTTTCCTGATTCAGG + Intergenic
1040748400 8:50674285-50674307 GCTGTGAATTTCCCTGGTCCTGG + Intronic
1041854269 8:62432603-62432625 GATAGTGATTTCCCTGATACAGG - Intronic
1043260606 8:78190460-78190482 GATTTTAATTTCTATGCTGCTGG - Intergenic
1044002159 8:86896404-86896426 AATATTAATTTTTCTGATCCAGG + Intronic
1044612195 8:94103507-94103529 GATATTAATATATCTGCTTCAGG + Intergenic
1048874899 8:138828971-138828993 GATATTGACTTCCCTGCTGGAGG + Intronic
1051577013 9:18627567-18627589 AATTTTGATTTTCCTGCTCCTGG + Intronic
1051779056 9:20669054-20669076 AATATTTATTTCCCTGCTCTTGG + Intronic
1053721513 9:40951520-40951542 TCTATTAATTTGCCTGTTCCAGG + Intergenic
1054344482 9:63900649-63900671 TCTATTAATTTGCCTGTTCCAGG - Intergenic
1055054013 9:72007233-72007255 AATAATCATTACCCTGCTCCCGG + Intergenic
1055315628 9:75030917-75030939 GAAATTAATTTTCCTGCCCAGGG + Intergenic
1055652154 9:78416929-78416951 AAGATTAATTTATCTGCTCCTGG - Intergenic
1055915576 9:81396891-81396913 GATTTTAATTCCCATCCTCCAGG - Intergenic
1058113122 9:101053560-101053582 GGTATTCATGTCCCTGCTCTGGG + Intronic
1062236309 9:135510165-135510187 GATATTAATATAACTCCTCCTGG - Intergenic
1203453674 Un_GL000219v1:144626-144648 TCTATTAATTTGCCTGTTCCAGG - Intergenic
1186138872 X:6549598-6549620 GATATTTATTCTCCTGCTTCTGG - Intergenic
1187507899 X:19891441-19891463 GATATTAACTTCCCTTGTGCTGG - Intergenic
1187779055 X:22796655-22796677 GAAGTTGATTTCCCTACTCCTGG + Intergenic
1188072827 X:25737858-25737880 TAATTTAATTTCCCTGATCCTGG - Intergenic
1193311710 X:80017528-80017550 TTTATTATTTTCACTGCTCCAGG + Intronic
1194483560 X:94457477-94457499 GATATTAATCTTCCTTTTCCCGG - Intergenic
1194780826 X:98023486-98023508 GCCATTCATCTCCCTGCTCCTGG - Intergenic
1199966796 X:152826846-152826868 GACATTAAAGTCTCTGCTCCAGG - Intergenic
1200406517 Y:2817552-2817574 GCTGTAAATTTCCCTGGTCCAGG + Intergenic