ID: 921554196

View in Genome Browser
Species Human (GRCh38)
Location 1:216577211-216577233
Sequence TCCCTATGTTCAGCAAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921554196_921554197 -3 Left 921554196 1:216577211-216577233 CCTGCATTTGCTGAACATAGGGA 0: 1
1: 0
2: 0
3: 14
4: 138
Right 921554197 1:216577231-216577253 GGATTGTCTTTAAAGAAAAAAGG 0: 1
1: 0
2: 3
3: 55
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921554196 Original CRISPR TCCCTATGTTCAGCAAATGC AGG (reversed) Intronic
901147616 1:7077179-7077201 TCCCTGTGTTTTCCAAATGCAGG + Intronic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
903363436 1:22791773-22791795 TCACTATCTTAAACAAATGCTGG + Intronic
904053728 1:27656651-27656673 TCCCTGTCTTCAGCAGATGCTGG + Intergenic
905480419 1:38258004-38258026 TCCCCATGTTCACCAACTGGTGG - Intergenic
909576969 1:77186198-77186220 TCCCTATGATCAGCTGATGGAGG + Intronic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
913584186 1:120257252-120257274 TCCCTTTGTCCAGCACATCCAGG - Intergenic
913623994 1:120641088-120641110 TCCCTTTGTCCAGCACATCCAGG + Intergenic
914566178 1:148869120-148869142 TCCCTTTGTCCAGCACATCCAGG - Intronic
914606643 1:149261120-149261142 TCCCTTTGTCCAGCACATCCAGG + Intergenic
914957939 1:152181553-152181575 TCCCTAGGTTCAGCCAGTTCTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
920585797 1:207159001-207159023 TTCTCATGTTCAGCAAATGCAGG - Intergenic
921554196 1:216577211-216577233 TCCCTATGTTCAGCAAATGCAGG - Intronic
1068474080 10:57503095-57503117 TGCCTAGGTTGAGCAAATCCTGG - Intergenic
1068766866 10:60773908-60773930 TCCCCAAGTTCAGCACCTGCTGG + Intergenic
1070479484 10:76868450-76868472 TTCCAGTGGTCAGCAAATGCAGG - Intergenic
1073961005 10:108928299-108928321 ACCCTATGTGGAGCAACTGCAGG - Intergenic
1074673889 10:115826571-115826593 TCCCACAGTTCAGCAAATTCCGG + Intronic
1075643009 10:124078634-124078656 TCCGTAAGTTCAACAAATACTGG - Intronic
1077998099 11:7471248-7471270 TGGCAATGTTCAGGAAATGCTGG + Intergenic
1078577948 11:12517369-12517391 AGCCTCTGTTCAGTAAATGCTGG + Intronic
1079701657 11:23556014-23556036 TCCCTTTCTTCACCAAAGGCAGG + Intergenic
1080340407 11:31256851-31256873 TCTTGATGTTCAGAAAATGCTGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082160867 11:48886303-48886325 TCCCTCTGTGCAGCCAAGGCAGG - Intergenic
1082161499 11:48894103-48894125 TCCCTCTGTGCAGCCAAGGCAGG + Intergenic
1082167089 11:48962536-48962558 TCCCTCTGTGCAGCCAAGGCAGG + Intergenic
1082236494 11:49824162-49824184 TCCCTCTGTGCAGCCAAGGCAGG - Intergenic
1082609984 11:55284039-55284061 TCCCTCTGTGCAGCCAAGGCAGG - Intergenic
1082656704 11:55866485-55866507 TCCCTCTGTGCAGCCAAGGCAGG + Intergenic
1084666454 11:70578987-70579009 TCCCTTTATTCAGCAACAGCTGG - Intronic
1085029593 11:73262822-73262844 TCCTTTTATTCAGCAAATGTTGG - Intergenic
1085108118 11:73863295-73863317 TCCTTATTTTGAGCATATGCAGG - Intronic
1086046553 11:82539482-82539504 TCCATATCTTCAGCAATTACTGG - Intergenic
1089213441 11:116821364-116821386 TCCCTATGCTCAGGACACGCAGG - Exonic
1089368179 11:117933902-117933924 TCCCTATTTCCAGCAGATACTGG + Intergenic
1089847539 11:121470277-121470299 TCCCTGTGTTCAGCAAACAAGGG - Intronic
1091323288 11:134666482-134666504 TACCCATCTCCAGCAAATGCAGG + Intergenic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1095865905 12:46971887-46971909 TGCCTAGGTTCAGCAAATTATGG - Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1102232037 12:111269431-111269453 TCCCAGTGTCCAGCAAGTGCCGG - Intronic
1103377354 12:120467921-120467943 TTTCTATGTTCAGCAGATACGGG - Intronic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1109156248 13:58913640-58913662 TCCCTTTGTTCAGAGAAAGCAGG - Intergenic
1109404146 13:61875595-61875617 TCGCTATGTTGAGGGAATGCTGG + Intergenic
1112342513 13:98564424-98564446 TCCCCATGCTCAGCCACTGCAGG - Intronic
1113113851 13:106853893-106853915 TCCCTCTTTTCACCAAAGGCAGG - Intergenic
1113275526 13:108725184-108725206 TCCCTATGTTCAGAAAGTGAGGG - Intronic
1117604395 14:57412131-57412153 TCCCAATGTACAGGAAATACAGG - Exonic
1119315921 14:73694562-73694584 CCCCAATGTTCAGCAATTGGGGG + Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1131612385 15:93978749-93978771 TCCCTATGTTACCCAGATGCTGG + Intergenic
1134589082 16:15437334-15437356 TCTCTATTTTCAGAAAATGAAGG - Intronic
1137379502 16:47984207-47984229 TCCCTATTCTCTGCCAATGCCGG - Intergenic
1137877965 16:52015332-52015354 TTCCTATGTTCAGTATCTGCAGG + Intronic
1141783486 16:86181606-86181628 TCCCTCAGTTCAGCAACAGCAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1149790293 17:59470812-59470834 TCCCTAGGTCCAGCATATCCAGG - Intergenic
1150927236 17:69545731-69545753 TCACCATGCTCAGCCAATGCTGG - Intergenic
1155732701 18:29180717-29180739 TCCGTATGTTGAGGGAATGCTGG + Intergenic
1155823518 18:30408708-30408730 TCCCTATGTTTAGGAAGTGCTGG - Intergenic
1155824836 18:30427914-30427936 TCTGTATGTTAAGGAAATGCAGG + Intergenic
1157169570 18:45390100-45390122 TCCCTATGTTCTGCAGTTCCAGG - Intronic
1162290745 19:9778466-9778488 TCCCAATTTACAGAAAATGCAGG + Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1164044060 19:21519279-21519301 TCCCTATGTTGAGGGAATGCTGG - Intronic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1168111688 19:54195666-54195688 TCACTATGTTCAGCCAAGGCTGG - Intergenic
927435662 2:23064089-23064111 TCCCTTTGTTCTACAAAGGCTGG + Intergenic
927966356 2:27272114-27272136 TTCCTGTGTTCAGTAAATGTTGG - Intronic
929073870 2:38061218-38061240 TCCCCATGTGAAGGAAATGCAGG + Intronic
933009068 2:77034627-77034649 TGCCTATTTTCAGGAAATACAGG - Intronic
933107253 2:78346328-78346350 GCCCAATGGTCAGCAAATGCTGG + Intergenic
933286371 2:80388664-80388686 TCCTTCTGTTCAGCAAAAACAGG + Intronic
935220725 2:101010138-101010160 TCCCAATGTTTAGGAAATGTAGG - Intronic
935306394 2:101741122-101741144 TCCCCATGTACAGCAAAAGAGGG - Intronic
936599227 2:113879487-113879509 TCCCTAGGTCTAGCAAATGAGGG - Intergenic
937045852 2:118851157-118851179 TGCCTATCCTCAGAAAATGCAGG - Intergenic
937121237 2:119441233-119441255 TTGATCTGTTCAGCAAATGCAGG - Intronic
939329105 2:140735495-140735517 TTCAAATGTTCAGCAAAGGCAGG + Intronic
947688884 2:232116313-232116335 TCCCTTTGGTCAGCATATGCTGG + Intronic
948162767 2:235838544-235838566 TACATATGGTCAGTAAATGCTGG - Intronic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1172828321 20:37809378-37809400 TCCCTATATTCAGCATCTGTAGG + Intronic
1181760546 22:25055524-25055546 TCACTATGTTCAGCCCAGGCTGG - Intronic
1182003905 22:26943379-26943401 TATCTATGCTCAGTAAATGCTGG - Intergenic
1182881230 22:33735236-33735258 TCCCTAGGTGCAGCAACTGTGGG - Intronic
1183254396 22:36753118-36753140 TCCCCAAGTTTTGCAAATGCTGG + Intergenic
952059829 3:29494474-29494496 TCGCTTTGTTCAGCAATTTCTGG - Intronic
953280126 3:41547200-41547222 GCACTATGGTCAGCAAATGTTGG - Intronic
962569844 3:136702196-136702218 TCACTATGTTCAGCCCAGGCTGG + Intronic
963599856 3:147369469-147369491 TCCCTACGTTCAGCGAATACAGG + Intergenic
970801107 4:19974751-19974773 TCTGTATGTTCACCAAATGATGG + Intergenic
975941839 4:79657278-79657300 TCCCTATGTTTAGAAATTCCAGG + Intergenic
979257021 4:118616831-118616853 TCCCTAAGTTCTGGAATTGCAGG + Intergenic
979331328 4:119423715-119423737 TCCCTAAGTTCTGGAATTGCAGG - Intergenic
979949200 4:126871321-126871343 TCTCTACGTTCAGTAAAAGCAGG + Intergenic
980221751 4:129926809-129926831 TCCCTATGTACTGTACATGCAGG + Intergenic
980972950 4:139584026-139584048 TCTCCATGCTCAGCAAATGATGG + Intronic
981271638 4:142852395-142852417 TGATTATGTTTAGCAAATGCCGG + Intergenic
991596292 5:68310104-68310126 TCTCTATCATCAGCAAATGATGG - Intergenic
992366032 5:76090644-76090666 TCCATTTGTTCAGCAATTACAGG - Intronic
995672385 5:114621254-114621276 TCCCTATGTACAGGAAATATAGG - Intergenic
996218368 5:120896017-120896039 TCCCTATGCTCAGCACAAACAGG - Intergenic
996317904 5:122181821-122181843 TCCCTATGCTCTGCCAATGAAGG + Intergenic
996620247 5:125492475-125492497 CCCATATGTGCAGAAAATGCAGG - Intergenic
997946341 5:138205172-138205194 TCCCAAACTTCAGCAAATGCTGG + Intronic
999896816 5:156043149-156043171 GCTCTATGTTCAGCAAAAACTGG - Intronic
1001147740 5:169199636-169199658 TCCCTATATTTAGGAAATACTGG + Intronic
1002941759 6:1723173-1723195 GCCCTTTGCTCAGCAAAGGCAGG - Intronic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004824253 6:19402922-19402944 TCCCTATGATCAGCTGATGGAGG - Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1009685210 6:66948668-66948690 TCCCTATGCACAGCCATTGCGGG - Intergenic
1009699111 6:67153262-67153284 TCCCTCTGTCCAGCAAATTAAGG - Intergenic
1011044020 6:83062126-83062148 ACCCTATGCTCAACAAAGGCAGG + Intronic
1012398445 6:98825290-98825312 TTCCTAGGGACAGCAAATGCGGG - Intergenic
1015794362 6:136996367-136996389 TCCTTTTGTTAATCAAATGCTGG + Intergenic
1016427477 6:143949712-143949734 TGGCAAAGTTCAGCAAATGCTGG - Intronic
1017584499 6:155905544-155905566 TCTCTATGTTTAGCATATGGGGG - Intergenic
1017939701 6:159040961-159040983 TCCCTGGATTCATCAAATGCAGG - Intronic
1022674064 7:32481929-32481951 TCCGTATGTTGAGGGAATGCTGG - Intergenic
1022857212 7:34326868-34326890 TCCCTTTGTCCAGCATATCCAGG - Intergenic
1026323707 7:69289778-69289800 TACCAATTTTCAGCAAATACAGG + Intergenic
1030364660 7:108631525-108631547 TCCATTTGTCCAGGAAATGCTGG - Intergenic
1032519036 7:132528736-132528758 TCTCTCTGTTCAGCCATTGCAGG - Intronic
1037099013 8:15019615-15019637 TCCCTTTGTCCAGCAAACACAGG - Intronic
1038041126 8:23725290-23725312 TCCCTATTCTCAGCAAAACCAGG + Intergenic
1039500578 8:38013574-38013596 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040063497 8:43125013-43125035 TCCCTATGTTGAGGAAGTGCTGG + Intergenic
1040859967 8:51989010-51989032 TCATTATCTTCAGCAAATGTAGG + Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1044021830 8:87114240-87114262 CACTTATGTTCAGCAAATGCTGG - Intronic
1044941113 8:97344897-97344919 TTCCTACGTTGAACAAATGCAGG + Intergenic
1052402245 9:28015251-28015273 TCCCAAGGTTTAGCAAAAGCAGG + Intronic
1052862042 9:33443260-33443282 TCCCTCTGTTCAGGACCTGCTGG - Intronic
1056263989 9:84877722-84877744 TTCCTATGTTCAGAAACTCCAGG + Intronic
1057431928 9:95002987-95003009 TTCCTTTGTTCAGCTCATGCCGG + Intronic
1058148622 9:101439703-101439725 TCCCTACTTTCAGTAAATTCTGG + Intergenic
1058932845 9:109738868-109738890 TCCCTGTGTACTGCAAATGGTGG + Intronic
1060413684 9:123416063-123416085 TCCCTACATTCAGCTAGTGCTGG - Intronic
1062170038 9:135129611-135129633 ACCCCATGCTCAGCAAATGGGGG - Intergenic
1185705717 X:2264885-2264907 CACCAATGTGCAGCAAATGCGGG + Intronic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186316594 X:8377469-8377491 TACCTCTTTTCAGCAAGTGCAGG + Intergenic
1187288450 X:17929024-17929046 TCCTTATGTTTAGCAAAACCAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1197073115 X:122323975-122323997 TTCTCATGTTCAGCAAATGCTGG + Intergenic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic