ID: 921554656

View in Genome Browser
Species Human (GRCh38)
Location 1:216583539-216583561
Sequence AGCCATGAAGCCCCTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921554656_921554660 5 Left 921554656 1:216583539-216583561 CCCTCTACAGGGGCTTCATGGCT 0: 1
1: 0
2: 1
3: 10
4: 184
Right 921554660 1:216583567-216583589 CTTAGCATTCAGAGTCCCTCTGG 0: 1
1: 0
2: 3
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921554656 Original CRISPR AGCCATGAAGCCCCTGTAGA GGG (reversed) Intronic
901012448 1:6209413-6209435 GGCCGTGAAGGCCCTGCAGACGG + Exonic
902720675 1:18302120-18302142 GGCCAGGCAGCCCCTGAAGAAGG - Intronic
903737736 1:25541055-25541077 AGCCATGTGTCCCCTGCAGAGGG - Intergenic
904937381 1:34141190-34141212 AGACATGAAAACCCAGTAGATGG - Intronic
906062511 1:42958117-42958139 AGCCCGGACGCCCCTGTAGGTGG - Intronic
908788198 1:67755565-67755587 AGAAATTAAGCCCCTGAAGAAGG - Intronic
908912332 1:69086718-69086740 AGCCATGAATCCCCTGCCTACGG + Intergenic
909151184 1:72007483-72007505 AGCCAGGGTGCCCCTGAAGAAGG + Intronic
911147129 1:94563117-94563139 AGGCATGCAGCCACTGTTGATGG - Intergenic
912359551 1:109083567-109083589 AGCCATCAAAGCCCTGGAGAGGG - Intergenic
915250894 1:154587814-154587836 GGCCATGAAGACCCTATAGGGGG + Intronic
915251990 1:154597155-154597177 AGCCATGAAGGCCCTGCATGGGG - Exonic
916688159 1:167166497-167166519 TGCCATGGAGACCCTGGAGACGG - Intergenic
921183524 1:212650935-212650957 AGTCTAGAGGCCCCTGTAGAAGG + Intergenic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
922364650 1:224852276-224852298 AGCCCAGAAGCCCATGAAGAAGG + Intergenic
922876494 1:228943616-228943638 AACCCTGAAGCCCCAGTAGGGGG - Intergenic
924702599 1:246468972-246468994 AGTCATTAAGCCTCTGTACATGG + Intronic
1063652347 10:7950327-7950349 GGGCATGAAGACCCTGTGGAGGG + Intronic
1065264216 10:23958079-23958101 AGCCATTAATTCCCTGTAGTGGG + Intronic
1065988583 10:30982694-30982716 AGCCATGCAGGTCTTGTAGATGG - Intronic
1068371177 10:56117696-56117718 TTCCAAGAAGCCCCTGTACATGG - Intergenic
1069594533 10:69662213-69662235 AGCCATGAGGCCCCGGGAGAGGG + Intergenic
1070371373 10:75785463-75785485 AGCCATCATGCCCCTGCAGGAGG - Intronic
1071197266 10:83175800-83175822 AGCTATGAAGCCCCTGTTTCAGG - Intergenic
1071917376 10:90309782-90309804 AGACATGAAGTCCTTGTATATGG - Intergenic
1075782284 10:125025068-125025090 AGCCCTGAAGCAGCTGTAGGCGG - Intronic
1080096873 11:28418724-28418746 AACCATGTAGCCACTGCAGAAGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082007460 11:47427416-47427438 AGCCCTGGAGCCCCTTTAAAGGG + Intergenic
1082757431 11:57091982-57092004 AGCCTGGATGCTCCTGTAGAAGG + Intergenic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1083725050 11:64623505-64623527 AGCCATGGAGCCCCTGGAAGAGG + Intronic
1083911362 11:65712169-65712191 CCTCACGAAGCCCCTGTAGAGGG - Exonic
1087901132 11:103642578-103642600 GGTCATGAAGGCCCAGTAGATGG - Intergenic
1090557066 11:127887603-127887625 AGACATGAGGACACTGTAGAAGG - Intergenic
1090891044 11:130922684-130922706 AGGCATGTAGCCTCTGTAGTAGG - Intergenic
1092650777 12:10632428-10632450 AGCCAGGAAGCCAGTGTAGCTGG + Intronic
1093124072 12:15307278-15307300 AGTCATGAGGCCCCTGTACAAGG - Intronic
1094498830 12:31005869-31005891 AGTGCTGAAGCTCCTGTAGAAGG - Intergenic
1095954266 12:47797477-47797499 AACCCTGGAGCCCCTGGAGACGG - Exonic
1102798088 12:115706814-115706836 GGCCATGAAGCCACTGGGGAAGG + Intergenic
1103231969 12:119338975-119338997 AACCATGAAGAGCCTGTACAAGG - Intronic
1104151677 12:126090475-126090497 AGCCACCAAGCCCCTGCAGTGGG - Intergenic
1104744575 12:131202862-131202884 AGCAATGAAGCCCCTGGAGCAGG - Intergenic
1104789810 12:131474345-131474367 AGCAATGAAGCCCCTGGAGCAGG + Intergenic
1104801181 12:131556135-131556157 AGCCACGATGCCCATGGAGAGGG - Intergenic
1105010040 12:132749547-132749569 ATCCAGGAAGCACCTGTATAAGG + Intronic
1106655722 13:31744019-31744041 ATCCAGGAAGCCCCTGGGGAGGG - Intronic
1107971041 13:45642627-45642649 ACCTATGCAGTCCCTGTAGAGGG + Intergenic
1108592006 13:51920699-51920721 TGCCATGAAGACACTGTAGCAGG - Intergenic
1111222581 13:85223578-85223600 AGGCATGAAACCCCTGTATCAGG + Intergenic
1113804566 13:113105871-113105893 AGCCCTGAAGCCCAAGCAGAAGG - Exonic
1114043379 14:18700724-18700746 AGCCATGTAGCAACTGAAGATGG + Intergenic
1114047668 14:18891169-18891191 AGCCATGTAGCAACTGAAGATGG + Intergenic
1114114855 14:19510475-19510497 AGCCATGTAGCAACTGAAGATGG - Intergenic
1114116548 14:19628238-19628260 AGCCATGTAGCAACTGAAGATGG - Intergenic
1114671679 14:24415033-24415055 GTCCATGAAGCCCATGAAGAAGG - Exonic
1114678396 14:24461085-24461107 AGCCATGCTACCTCTGTAGATGG - Intergenic
1118696857 14:68394261-68394283 AGCCCAGCAGCCCCTGCAGATGG - Intronic
1119736169 14:76983995-76984017 CGCCATGAAGTCACTGAAGAGGG + Intergenic
1121021887 14:90585253-90585275 TGCCACGGAGCCCCTGGAGAAGG - Intronic
1122942800 14:104989956-104989978 TGTCCTCAAGCCCCTGTAGAGGG - Intronic
1202868633 14_GL000225v1_random:138781-138803 TGTCAAAAAGCCCCTGTAGACGG - Intergenic
1124989769 15:34660139-34660161 ACCCAGGAATCCCCTGAAGAGGG + Intergenic
1127461684 15:59204962-59204984 GGCCCTGAAGGACCTGTAGATGG + Intronic
1128501651 15:68230945-68230967 AGCCCTCAAGCCGCTGCAGAAGG + Intronic
1133267806 16:4595148-4595170 TGCCCTGAAGCCCTTGAAGAGGG + Intronic
1133421009 16:5646929-5646951 AGCCAGGAAGACCCTCTTGATGG + Intergenic
1133796464 16:9050463-9050485 TGTCATGAAGCCCCAGTGGAGGG + Intergenic
1135922956 16:26667640-26667662 AGCCAAGATGGCCCTGTAGGTGG - Intergenic
1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG + Intronic
1138547173 16:57726876-57726898 GGCCATGATGCACCTGAAGAGGG + Exonic
1138554270 16:57762835-57762857 AGCCAGGAGGCCCCTGTGGCCGG - Intronic
1139404427 16:66706808-66706830 AGCCGTGAAGCCCCAGGATATGG - Intergenic
1146470366 17:33119567-33119589 AGCAAGGAAGCTGCTGTAGATGG + Intronic
1148600753 17:48892665-48892687 TGCCACGAAGCTCCTGTGGAGGG + Intergenic
1151424427 17:74021527-74021549 AGCCAGGCAGCCCCAGAAGAAGG + Intergenic
1152029809 17:77834967-77834989 GGGCATGCAGCCCCTGTAGGAGG - Intergenic
1152587732 17:81196522-81196544 AGCCATGCATGCCCTGGAGAGGG - Intronic
1153250591 18:3117812-3117834 AGCCATGAAGCCAAGGTAAAGGG - Intronic
1157165919 18:45358349-45358371 AGAAATGAAGCCCCAGTAGCGGG - Intronic
1158823491 18:61188086-61188108 AGCTGTGAAGCCCATGGAGAAGG - Intergenic
1159082444 18:63751028-63751050 AGGCAAAAAGCCCCTGAAGAGGG - Intergenic
1159560911 18:69993021-69993043 AGCCATGAAGCCACAGGAGGAGG - Intergenic
1167256186 19:48430657-48430679 AGCCATGAAGCAACTGAAAAAGG - Intronic
1167566479 19:50260669-50260691 ATCCATGAAGCCCTTGGGGATGG - Exonic
1168527465 19:57100270-57100292 GGCCAGGGAGCCCCTTTAGATGG - Intergenic
925807974 2:7671470-7671492 AGCCATGTGGCCTCTGTAGCTGG - Intergenic
926198202 2:10776119-10776141 AGCCACGGAGCCCCCGTAGTGGG + Intronic
926473651 2:13293873-13293895 AGCCATGAGGCCACTGCAGAGGG + Intergenic
929442323 2:41973825-41973847 GGCCATGAGTCCCCTGTGGATGG - Intergenic
930748003 2:54904462-54904484 ATCCATGGAGCCTCTGTAGAAGG + Intronic
933574992 2:84057191-84057213 GGCCAAGAAACCCCTGCAGAAGG - Intergenic
935356637 2:102207543-102207565 AGTCATGAAGCCCCTGTTCCAGG - Intronic
938425042 2:131179688-131179710 AGCCATGTAGCAACTGAAGATGG + Intronic
939994955 2:148911471-148911493 GGCCATGAAGCCCTTTAAGAAGG + Intronic
941073283 2:160978870-160978892 AGCTTTGCAGCCCCTGGAGATGG - Intergenic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
1173980171 20:47217890-47217912 AGGCAAGAAGCCCCAGTAAATGG - Intronic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1176411190 21:6450409-6450431 AGCCATGCAGACCCTGCAGCTGG - Intergenic
1178777531 21:35566321-35566343 AGCAAAGAAGCCCCAGTACAAGG - Intronic
1179686683 21:43058731-43058753 AGCCATGCAGACCCTGCAGCTGG - Intronic
1180466201 22:15613841-15613863 AGCCATGTAGCAACTGAAGATGG + Intergenic
1181076150 22:20378312-20378334 AGTCAAGAATCCCCTGAAGAAGG + Intronic
1181828530 22:25539722-25539744 TGCCTTGTACCCCCTGTAGAGGG + Intergenic
1183402748 22:37614194-37614216 AGCCACGAACCCCCTGAACAAGG + Exonic
1183695652 22:39420486-39420508 GGCCATGAGGCCTCTGTTGATGG - Intronic
950585610 3:13890300-13890322 ACCCAGGAAGCCCCTGGAGCAGG + Intergenic
951609499 3:24476292-24476314 AGCTATGAACACCCTGTAGAGGG - Intronic
952512516 3:34071453-34071475 TTCCATGAAGCCACTGCAGAAGG + Intergenic
952707969 3:36399274-36399296 AGACAGGAACCCACTGTAGAGGG - Intronic
955473930 3:59315744-59315766 AACCATGAAGCACATGTATAAGG - Intergenic
957020181 3:75118065-75118087 AGCCATGGGGCTCCTGGAGAAGG + Intergenic
959684288 3:109128068-109128090 AGGCAGGAAGCCACTGTGGAAGG - Intergenic
960615978 3:119596403-119596425 AGCCAGGAAGCGCCTTTAGATGG - Intergenic
963414707 3:144980110-144980132 TGACATTAAGTCCCTGTAGATGG - Intergenic
963631806 3:147742210-147742232 AGTTTTGAAGCCCCTTTAGAAGG + Intergenic
965104573 3:164340717-164340739 AGCCATGGAACCCCAGTTGAGGG + Intergenic
967708924 3:192683384-192683406 AGCCAAGGAGCACTTGTAGAAGG - Intronic
969437022 4:7194126-7194148 AGCCATGAATCCCCAGAGGAGGG + Intronic
972184163 4:36508015-36508037 TGCCATGAAGCCGAAGTAGATGG + Intergenic
973646190 4:52953514-52953536 AGTCATGCAGCCCCTGAAGGTGG + Intronic
975619328 4:76280367-76280389 AGCCATGAAGCCCCTCAGCAGGG - Intronic
976031317 4:80758026-80758048 ACCCCTGAAGCCCCAGAAGAAGG + Intronic
979600176 4:122578942-122578964 TGCCATAAAGCCCCTAGAGAGGG + Intergenic
982598244 4:157413199-157413221 CTCCATGAAGCACCTGTATAAGG + Intergenic
984821596 4:183887294-183887316 AGCTATGACGTCCCTGTACAGGG - Intronic
985681972 5:1260546-1260568 AGCCTTGAAGCCGCGGTTGAAGG + Exonic
985836931 5:2278376-2278398 AGCCCTGTAGCCCCTGCACAAGG + Intergenic
985947188 5:3194970-3194992 TCCCATGCAGCCCCTGCAGAAGG + Intergenic
990182344 5:53174826-53174848 GGCCATGAGTCTCCTGTAGATGG - Intergenic
992549518 5:77847514-77847536 AGCCTTGAAGCCCCTGAAAAGGG - Intronic
998976048 5:147649085-147649107 AGCCATGAATGCCCTGTGTAAGG - Intronic
999264208 5:150255953-150255975 ATCCATGAAGTCCCTGCTGAAGG + Intronic
1002018713 5:176347692-176347714 AGCCTTGAAGCCCCCCAAGATGG - Exonic
1003090402 6:3097281-3097303 AGCCAGGATGCCCTTGAAGAAGG + Intronic
1006432108 6:34003390-34003412 CTCCATGAAGCCTCTGTGGATGG + Intergenic
1007238504 6:40408361-40408383 AACCAAGAAGCCCCTGCCGAGGG - Intronic
1007928278 6:45667830-45667852 AGCCATGGAGGCACTGAAGATGG + Intergenic
1013854822 6:114559843-114559865 AGCCAAGAGGTCACTGTAGAAGG - Intergenic
1015154427 6:130075716-130075738 AGGCAGGAAGCCACTGTGGAGGG + Intronic
1018173809 6:161162360-161162382 AGCCATGAAGCTTCTGTAACCGG - Intronic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1019991509 7:4695073-4695095 AGCCATGAGGCTCCAGAAGAAGG + Intronic
1020153647 7:5703454-5703476 AGCCATGCAGCTACTGTAGGAGG + Intronic
1021858433 7:24881012-24881034 AGTCATGAATGCCCTGTAGTTGG - Intronic
1022015404 7:26344972-26344994 AGCCATGGAGCCCCTGGGGCTGG - Intronic
1025158868 7:56635733-56635755 AGCCCCAAAGCACCTGTAGAAGG - Intergenic
1032705867 7:134420911-134420933 AGCTATGAATCCTCTCTAGAGGG + Intergenic
1033470819 7:141647414-141647436 AGCAAGGAAGCCCGTGTAGCTGG - Intronic
1033489909 7:141833277-141833299 AGCCTTGAAGCCCATGTTGTTGG + Intergenic
1034094031 7:148389847-148389869 AACCATGAAGACCCTTCAGATGG - Intronic
1034404981 7:150897109-150897131 AGCCATGCAGCCCCAGGAAATGG + Intergenic
1042837747 8:73093049-73093071 GGCCATGAGGACCCTGTGGATGG - Exonic
1043340303 8:79229804-79229826 AGTCATGAGGCCCCTGTTGCAGG - Intergenic
1045680873 8:104658442-104658464 AGACATGAATCCCTTGGAGAAGG + Intronic
1047485746 8:125329323-125329345 AGCCAAAAAGCTCCTGTAGTGGG - Intronic
1047502757 8:125454650-125454672 AACCAAGAAGCCTGTGTAGAAGG + Intergenic
1048348739 8:133598595-133598617 AGACATGAAGACTCTTTAGATGG + Intergenic
1049737969 8:144220113-144220135 AGAAATGAAGGCCCTGTTGATGG + Intronic
1052828213 9:33192952-33192974 AACTATGAAGCTCCTCTAGAGGG + Intergenic
1052917331 9:33933423-33933445 AGTCCTGGAGCTCCTGTAGAAGG - Intronic
1054905849 9:70413331-70413353 AGCCACGAAGTCCATGTAGGCGG + Exonic
1055360659 9:75486863-75486885 AGCCAAGAAGGCCCGTTAGATGG - Intergenic
1059621505 9:116010978-116011000 ATCTGTGAAGCCCCTGAAGAAGG + Intergenic
1060328183 9:122638693-122638715 AGCCATGAAGTTCCCCTAGATGG + Intergenic
1061572778 9:131487949-131487971 AGGCATGCAGCCCTTGGAGATGG + Exonic
1186250721 X:7662934-7662956 AACCATGAAGTCCCTTTAGGAGG + Intergenic
1187794291 X:22985290-22985312 AGTTCTGAAGCCCCTGTGGAAGG + Intergenic
1188459433 X:30406659-30406681 AGCCATGAAACTACTCTAGAAGG - Intergenic
1191758645 X:64623391-64623413 GGCCATGAAAACCCAGTAGAAGG + Intergenic
1193076615 X:77362562-77362584 AGCCAGGTAGCCCCAGTGGATGG - Intergenic
1194472918 X:94319645-94319667 GGCCATGCAGCCCCTGAAAATGG - Intergenic
1196442085 X:115727458-115727480 AGCCAGAAAGCCCCGGGAGATGG + Intergenic
1196442746 X:115730412-115730434 AGCCAGAAAGCCCCGGGAGATGG + Intergenic
1196443477 X:115733456-115733478 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196445801 X:115845376-115845398 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196446472 X:115848357-115848379 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196447141 X:115851338-115851360 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196447812 X:115854321-115854343 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196448480 X:115857300-115857322 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196449151 X:115860291-115860313 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196449822 X:115863282-115863304 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196450491 X:115866265-115866287 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196451161 X:115869250-115869272 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196451832 X:115872229-115872251 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196452503 X:115875216-115875238 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196453173 X:115878185-115878207 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196453843 X:115881178-115881200 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196454510 X:115884187-115884209 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196454923 X:115886289-115886311 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196455587 X:115889249-115889271 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1199709412 X:150458270-150458292 AGACAGGATGCCCCTCTAGAAGG + Intronic
1200226205 X:154419299-154419321 TGCCATGCAGGCCCTGGAGACGG + Intronic