ID: 921555591

View in Genome Browser
Species Human (GRCh38)
Location 1:216594898-216594920
Sequence GACTCAGTAGTACCTTGGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921555591 Original CRISPR GACTCAGTAGTACCTTGGTA GGG Intronic
908629348 1:66085155-66085177 GACTCAGGAGGTCCTGGGTAGGG - Intronic
911856801 1:102888007-102888029 GACTCTGTGGTACTTTGCTATGG + Intronic
916531562 1:165661193-165661215 GGCTCATAAGTCCCTTGGTACGG - Intronic
918958727 1:191242644-191242666 GACTCAGTAGGCACTTGGTATGG + Intergenic
919374473 1:196776723-196776745 AAATCAGTAGTACTTTGTTATGG + Intronic
921555591 1:216594898-216594920 GACTCAGTAGTACCTTGGTAGGG + Intronic
921782998 1:219190865-219190887 CACTCAGTAGTTGCTTGGGAAGG + Intronic
923861211 1:237893869-237893891 GACTCCCAAGTACTTTGGTAAGG - Intergenic
1065786054 10:29216253-29216275 GACTCAGTATTACCTATGTGTGG + Intergenic
1071380392 10:85053411-85053433 CACTCAGCAGTGCCCTGGTAGGG + Intergenic
1072501287 10:96020482-96020504 TACTCAGTATTACTTTGGGAAGG + Intronic
1076284845 10:129284637-129284659 GGCTGAGTAATACCATGGTATGG - Intergenic
1077560691 11:3258407-3258429 GACCCAGTGGTACCTGGGCAGGG - Intergenic
1077566587 11:3304235-3304257 GACCCAGTGGTACCTGGGCAGGG - Intergenic
1090342160 11:126033623-126033645 TACACTGTAGTACCTTGGAAAGG - Intronic
1092362807 12:7851698-7851720 GACTTAGTTGTATCTGGGTATGG + Intronic
1098354337 12:69596784-69596806 GACTCAGTTTAACCTTGGGAAGG + Intronic
1098453398 12:70645509-70645531 CTCTCAGAAGTACCTTGGTTTGG + Intronic
1103059585 12:117847796-117847818 CACTCAGAAGTGCCTTGGGACGG - Intronic
1103822091 12:123707057-123707079 GACTCAGTATTATCAAGGTAGGG + Exonic
1111302677 13:86365909-86365931 CACTAAGAAGTACCCTGGTAGGG - Intergenic
1113359096 13:109611945-109611967 GAGTCAGTGGTATTTTGGTATGG - Intergenic
1114730972 14:24992226-24992248 GACTAAGTAGTACCTTTAAAAGG - Intronic
1114756998 14:25270420-25270442 GACTCAGTAGGATCTTGAGATGG - Intergenic
1124688165 15:31799715-31799737 CACTCTGTAGTACTTTGTTATGG + Intronic
1130437675 15:83918316-83918338 GACTCAGTAGTTCCTAGCTTTGG + Intronic
1135496608 16:22956939-22956961 GAGTCAGCAATACCTGGGTAAGG + Intergenic
1137611117 16:49818290-49818312 GACTCAGCAGAACCTGGATAGGG + Intronic
1141803030 16:86323858-86323880 TTCTCAGTAGCACCTTGGCAAGG - Intergenic
1146829472 17:36055925-36055947 GCCTCAGTAGTACCTGGATAGGG + Intergenic
1149200430 17:54179359-54179381 AACTCTGTATTTCCTTGGTATGG - Intergenic
1149401248 17:56298085-56298107 GACTTAGTAGTTCCAAGGTAGGG - Intronic
1151705238 17:75763891-75763913 GATTCAGTACTACCCAGGTATGG - Exonic
1158274690 18:55754642-55754664 CATTCTGTAGTACCTTGTTATGG + Intergenic
1162956428 19:14101140-14101162 AACTCTGTAGTACCTTGCTCTGG + Intronic
1164850897 19:31483323-31483345 CACTCAGCAGTGCCCTGGTAAGG + Intergenic
1167859528 19:52271475-52271497 TACTCAGTAGTAACTGGGAATGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
927495924 2:23551808-23551830 GACTCAGTAGTCCCAGGGCAAGG + Intronic
927882498 2:26698584-26698606 GACAGAGCAGTTCCTTGGTAAGG - Intronic
928613299 2:33011656-33011678 GACTCTGTGGTACTTTGTTATGG + Intronic
930998535 2:57752548-57752570 TACTCAGTTCTGCCTTGGTAGGG + Intergenic
932502467 2:72195405-72195427 GACTCAGTTGTCCCTTGTTGGGG + Intronic
934892561 2:98083473-98083495 GACTCAGTCTTGCCTTGGTGTGG - Intergenic
1169520919 20:6372191-6372213 CACTCAGTAGTACTTTGTTATGG + Intergenic
1174934174 20:54849551-54849573 GACTCACTATTACCATGGAAGGG - Intergenic
1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG + Intergenic
959397461 3:105858822-105858844 AACTCAGTTGTATATTGGTATGG - Intronic
962199599 3:133390479-133390501 GGCTCAGTAGGACCAGGGTAGGG - Intronic
968291722 3:197544293-197544315 GACTGAGAAGTAACTTGGTTAGG - Intronic
976820681 4:89203221-89203243 CACTCAGTGGTACCTTCTTATGG + Intergenic
978346888 4:107779940-107779962 GACTGTGTAGACCCTTGGTAAGG - Intergenic
980958442 4:139451664-139451686 CACACAGTAGTACCTGGGTGTGG - Intergenic
981488568 4:145314897-145314919 GACTCAGTAGGTCTTGGGTAGGG + Intergenic
981759234 4:148175004-148175026 AAGTCAGTAGTCCCTTTGTAAGG + Intronic
983958989 4:173729534-173729556 GATTATGTTGTACCTTGGTATGG - Intergenic
984346135 4:178529146-178529168 GATTTAGTGGTACATTGGTACGG - Intergenic
994597306 5:101855969-101855991 CACTAAGTAGTACCTGGATATGG + Intergenic
1005017032 6:21384246-21384268 GACTCAGCAGTAACTTTTTAAGG + Intergenic
1005647775 6:27857561-27857583 CACTCTGTGGTACCTTGTTATGG + Intronic
1010662160 6:78583821-78583843 GTAACAGTAGTCCCTTGGTAGGG + Intergenic
1015044547 6:128761944-128761966 GCCTCAGGAGCACCTTGGTTGGG - Intergenic
1015742158 6:136468172-136468194 AAGTCAGTAGTACCAAGGTAAGG - Intronic
1020711523 7:11612119-11612141 GATTCAGTAGAACCTTTGGAGGG - Intronic
1031116949 7:117679303-117679325 GACTCAGCAGTTCCGAGGTAGGG - Intronic
1032150478 7:129425168-129425190 GACTCTGAACTACTTTGGTAAGG - Intronic
1036148058 8:6273364-6273386 TACCCAATAGTACCTTTGTAGGG + Intergenic
1041600704 8:59714239-59714261 GACTCGGGAGTACCTGGGAATGG - Intergenic
1044261276 8:90125840-90125862 CACTCAGGGGTCCCTTGGTATGG - Intergenic
1048896133 8:138993963-138993985 CATTAAGTAGTACCTTGGTTTGG + Intergenic
1052792539 9:32889384-32889406 GTCTCAGGAGTACACTGGTAGGG + Intergenic
1055593422 9:77841850-77841872 GGCTCAGTGGTTTCTTGGTAAGG + Intronic
1187269415 X:17766182-17766204 GACACAGTAGTGCCTGGGTATGG - Intergenic
1187284737 X:17894133-17894155 GACTCAGGAGTGACTTGGTTGGG + Intergenic
1197947981 X:131861449-131861471 GACTCCTTATTACCTTGATAGGG + Intergenic