ID: 921556475

View in Genome Browser
Species Human (GRCh38)
Location 1:216604279-216604301
Sequence ATCTAGAAGCTCAGTGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921556471_921556475 22 Left 921556471 1:216604234-216604256 CCTCTGGAAATTGTGGGAATAAA 0: 1
1: 0
2: 1
3: 23
4: 269
Right 921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG 0: 1
1: 0
2: 2
3: 19
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921556475 Original CRISPR ATCTAGAAGCTCAGTGAAGA GGG Intronic
900741623 1:4333654-4333676 CTCTGGAAGCTGAGAGAAGAGGG + Intergenic
903241673 1:21986781-21986803 TCCTAGAAGCTCAGTGGGGAAGG + Intronic
903245180 1:22009955-22009977 TCCTAGAAGCTCAGTGGGGAAGG + Intronic
903355107 1:22741620-22741642 GTCTAAAAGCTCAGGGAAGGCGG + Intronic
904891065 1:33779987-33780009 AGCTAGAAGCTCAGTGTAGTGGG + Intronic
909512582 1:76471460-76471482 AGCGATAAGCTCAGTGAAGCCGG + Intronic
909714475 1:78691368-78691390 TTGTAGAAGCTGAGTGATGAAGG + Intergenic
910534611 1:88283008-88283030 ATCAAATAGCTCAGTGAAAATGG + Intergenic
911513307 1:98835222-98835244 ATGTTTAAGCTTAGTGAAGAAGG - Intergenic
914828121 1:151150391-151150413 CTCTAGAAGCTTAGTTATGAAGG - Intergenic
915007747 1:152655769-152655791 TTCTAGATGCTTAGAGAAGATGG + Intergenic
916422857 1:164652548-164652570 AACTAGAAGGTGAGAGAAGAGGG + Intronic
918207024 1:182318504-182318526 AGGGAGAATCTCAGTGAAGATGG + Intergenic
918617440 1:186562327-186562349 ATCTAGGAACTTAGTAAAGATGG + Intergenic
920601702 1:207331877-207331899 ATTTAGAAGATCAGTGAAGCTGG + Intronic
921110175 1:212028349-212028371 ATCTAAAATCTTACTGAAGAAGG + Intronic
921556475 1:216604279-216604301 ATCTAGAAGCTCAGTGAAGAGGG + Intronic
922224552 1:223634062-223634084 ATCCAGAAGCAGAGTAAAGATGG + Intronic
922873005 1:228918134-228918156 TTCTAGCAGCTCAGTGGGGAAGG + Intergenic
923936449 1:238765587-238765609 ATGATGAAGCTTAGTGAAGAAGG - Intergenic
1064074750 10:12259677-12259699 CTCTAGAAGCTCAAAGAAGGAGG - Intergenic
1065183283 10:23147871-23147893 ATCTAGGAGCAAAGTGAGGAAGG - Intergenic
1065383528 10:25112973-25112995 AACTGGAACCTCTGTGAAGATGG - Intergenic
1065627033 10:27640308-27640330 TCCTGGAAGCACAGTGAAGAAGG + Intergenic
1065686912 10:28294782-28294804 GTGTAGAAGCTCAGGGAACAGGG - Intronic
1065868345 10:29933815-29933837 ATCCAGAAGATCTGTGAGGAAGG + Intergenic
1066245329 10:33577670-33577692 ATCTGTGAGCTCATTGAAGATGG - Intergenic
1066291106 10:34015196-34015218 ATCTATAACATCAGTGAGGAAGG - Intergenic
1066362794 10:34747583-34747605 CCCTTGAAGCTAAGTGAAGAGGG - Intronic
1067913167 10:50367782-50367804 ATAGAGAAGCTCAGTGAAAGTGG - Intronic
1070749662 10:78956439-78956461 ATCTGGAAGCTGAGGGAAGAGGG - Intergenic
1071079078 10:81788585-81788607 AGATAGAAGCTAAATGAAGAGGG - Intergenic
1071226119 10:83530174-83530196 AGCTAGAAGCTAACAGAAGATGG - Intergenic
1071801403 10:89066125-89066147 CTGCAGAGGCTCAGTGAAGAGGG - Intergenic
1075291202 10:121232670-121232692 CTCAAGCAGCTCTGTGAAGAGGG - Intergenic
1076063611 10:127431287-127431309 TTCTAGAGGCTCAATCAAGAAGG + Intronic
1076172130 10:128328129-128328151 ATAGAGAAGCTCAGAGAAAAGGG + Intergenic
1077953907 11:6992121-6992143 ATGTAGAAACTATGTGAAGAGGG + Intergenic
1081233346 11:40614643-40614665 ATGATTAAGCTCAGTGAAGAAGG - Intronic
1081772122 11:45656575-45656597 ATCAAAAAGCTCAGTGTAAACGG - Intronic
1082069115 11:47924380-47924402 ATCTAGAAGCTTAGGGAAGCAGG + Intergenic
1084744308 11:71158619-71158641 ATCTTAAAGCTCAAAGAAGATGG + Intronic
1084980989 11:72828656-72828678 CTCTGGAAGCTCACTGCAGAGGG + Intronic
1085965662 11:81520917-81520939 ATCTAGAATCTCAGCCAAGTAGG - Intergenic
1086914587 11:92514558-92514580 TGCTAGAAGCTCATTGTAGATGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088047029 11:105465955-105465977 ATATAGAAGATCAGTGCAGGAGG - Intergenic
1090000796 11:122955803-122955825 ATCCAGAAGAGAAGTGAAGAAGG - Intronic
1090200962 11:124855849-124855871 TCCTGGAAACTCAGTGAAGAAGG - Intergenic
1091096749 11:132830267-132830289 ATCAAAAAGCTCAGAGAAGTTGG - Intronic
1091787199 12:3250350-3250372 ATCATGAAGGACAGTGAAGAGGG - Intronic
1092256717 12:6929954-6929976 TTCTACAAGGTCAGGGAAGAAGG - Intronic
1092968430 12:13668548-13668570 CTCTTGGAGCTCAGTGAACAAGG + Intronic
1093854828 12:24088870-24088892 ATTCAGAAGGCCAGTGAAGAAGG - Intergenic
1094091674 12:26656898-26656920 AGCTAGAAGCTGAGTGAGGCTGG - Intronic
1095304475 12:40623526-40623548 ATATAGAAACTCAAAGAAGAGGG - Intergenic
1095352918 12:41236057-41236079 ATCTAGGTGCTCAGTAAACATGG - Intronic
1096052599 12:48624256-48624278 ATACTCAAGCTCAGTGAAGATGG - Intergenic
1097358029 12:58623983-58624005 ATGTAAAAGCTAAGTGAACAAGG - Intronic
1098194241 12:67983112-67983134 ATCTAAATGCTTAGTGTAGAAGG + Intergenic
1098213733 12:68193883-68193905 CTCTAGAAGCTCAATGAAGCTGG + Intergenic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1100392733 12:94158227-94158249 ATCTTGAAGCTGAGTGGAGAAGG + Intronic
1101318188 12:103649142-103649164 ATCTAGAAGGTCAAGGACGAGGG - Intronic
1101695267 12:107119621-107119643 ACCTAGAATCTCAGAGAAGAGGG - Intergenic
1103328037 12:120134565-120134587 ATTGAGCAGCTCTGTGAAGAGGG + Exonic
1103557823 12:121776501-121776523 ATCCAGAAGCTCTGGGAAGGAGG - Exonic
1106655907 13:31745799-31745821 ATCCAGAAGTTCAGCAAAGAAGG + Intronic
1107840967 13:44457859-44457881 ATACAGAAGCTAACTGAAGAAGG + Intronic
1108302849 13:49097182-49097204 ACCTGGAAGCTCAGTGTGGAGGG + Intronic
1108712478 13:53047278-53047300 GGTGAGAAGCTCAGTGAAGATGG + Intronic
1109374610 13:61474871-61474893 ATCTAGAAACTCAAGGAAAACGG + Intergenic
1109446862 13:62450908-62450930 ATCAAGAAGCGTAGAGAAGAAGG - Intergenic
1110767461 13:79297237-79297259 TTCTCAAAGCTCAGTGAAAAAGG + Intergenic
1111708866 13:91785771-91785793 ATTTAGAAGATCTGTGCAGATGG - Intronic
1112558462 13:100490925-100490947 ATTTTGAAGCTCACTGAAGTTGG - Intronic
1114795671 14:25712407-25712429 CTCTAAAAGGTCAGTGCAGAGGG - Intergenic
1115740623 14:36383970-36383992 AAGTAGAACCTCAGTGATGATGG - Intergenic
1115914391 14:38295047-38295069 ATGTTGAAGCTTTGTGAAGACGG - Intergenic
1117322532 14:54637472-54637494 CTCTAGAAGCCAGGTGAAGAAGG + Intronic
1117552123 14:56847073-56847095 CTTTAGAAGTTCAGTGTAGAAGG + Intergenic
1118249212 14:64142655-64142677 CTCGAGAAGCTCAGTCAAGGTGG - Intronic
1118878731 14:69808362-69808384 AGCTACTAACTCAGTGAAGATGG + Intergenic
1119897837 14:78235308-78235330 ATCAAGAGCCCCAGTGAAGATGG - Intergenic
1120592546 14:86392731-86392753 ATCATTAAGCTTAGTGAAGAAGG - Intergenic
1120943048 14:89967716-89967738 ATCTAGAAGGTATGTGGAGATGG - Intronic
1121589489 14:95091871-95091893 ATCTAGTGGCTTAATGAAGAGGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1124984309 15:34591384-34591406 ATTTAGAAGATCTGTGCAGATGG - Intergenic
1125324448 15:38522726-38522748 ATTGAGAAGTTCAGTGAGGAAGG + Intronic
1128016331 15:64350926-64350948 ATATAGAAGCTCTGAGAAGCTGG - Intronic
1131915672 15:97263210-97263232 ATCCAGGAGGTCAGTAAAGATGG + Intergenic
1133397742 16:5461863-5461885 CTCTATGAGCTCAGTGAAGCTGG - Intergenic
1133853863 16:9531197-9531219 TTTTAGAAGCTCAGTGAAGATGG + Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1134821267 16:17249255-17249277 ATCTAGAATCTCTGTGGAGGTGG - Intronic
1134894797 16:17875546-17875568 TTCCAGAAGCTCAGAGAAAATGG + Intergenic
1135752740 16:25069878-25069900 ATCTGGAACCCCAGGGAAGACGG - Intergenic
1137819414 16:51429443-51429465 ATTTAGAAGATGAGAGAAGATGG + Intergenic
1140225182 16:73071225-73071247 ATCTCGAAGCTCAGTGGAGCAGG - Intergenic
1142067412 16:88070696-88070718 CTGTAGATGCTCACTGAAGATGG + Intronic
1143083234 17:4396875-4396897 ATCTAGAAGCTCCTGGAAGTTGG - Intergenic
1143241901 17:5450721-5450743 ATCTAGAAGCACTGGGTAGATGG + Intronic
1144013304 17:11170668-11170690 GACAAGAAGCTCAGGGAAGAAGG + Intergenic
1144404333 17:14938262-14938284 ATCCAGAAGTTCAGTGAAAGGGG + Intergenic
1145916295 17:28576004-28576026 CTCTAGAAGCTGAGAGAAGAGGG - Intronic
1149043269 17:52215821-52215843 CTCTGGATGCTCAGTGAGGAAGG - Intergenic
1149121307 17:53169237-53169259 CTCTACAAACTCAGTGAAGACGG - Intergenic
1149247211 17:54723837-54723859 ATCACAAAGCACAGTGAAGAAGG + Intergenic
1152295503 17:79464879-79464901 CTGCAGAAGCTCAGTGAAGTCGG + Intronic
1153492785 18:5666851-5666873 ATCCAGAAGATCACTGATGAAGG - Intergenic
1154059073 18:11041966-11041988 AACCAGGAGCTCAGAGAAGATGG - Intronic
1155044828 18:22094598-22094620 AGCTCGCAGCTCAGTGAAGGAGG + Intronic
1155825319 18:30435190-30435212 GACTGTAAGCTCAGTGAAGAAGG - Intergenic
1156903526 18:42328351-42328373 ATATAGAAATTCAGAGAAGAAGG + Intergenic
1157570852 18:48711166-48711188 CTCTAGCAGCCCAGAGAAGAAGG + Intronic
1157590798 18:48835588-48835610 ATCTATAAGCACAGTGCAGAAGG + Intronic
1158308593 18:56134075-56134097 ATTTGGAAGGGCAGTGAAGATGG + Intergenic
1158322787 18:56281724-56281746 ATGTGGATGCTCAGTGAATATGG - Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1159514495 18:69440108-69440130 ATCTGGAAGGTCTGAGAAGAGGG + Intronic
1159908212 18:74117873-74117895 GTCTAGAACTTCAGAGAAGAGGG - Intronic
1162440685 19:10690319-10690341 ATCTGGAGGCTCAGTGGAGTGGG + Exonic
1166557696 19:43712246-43712268 ATGATTAAGCTCAGTGAAGAAGG - Intergenic
1166810292 19:45510057-45510079 GTCTAGAATCTCAGGGCAGAAGG + Intronic
1167455377 19:49594933-49594955 CGCTCGAAGCCCAGTGAAGAGGG - Exonic
1168422712 19:56215564-56215586 AACCAGGAGCTCAGTGAGGATGG - Intergenic
925071297 2:969581-969603 ATCTAGAAGCACAGCTAAGCAGG - Intronic
926570859 2:14528487-14528509 GTCTACCAGCTCAGAGAAGAGGG - Intergenic
927287910 2:21376193-21376215 CTCTAGAAGTTCAGAGAAGGAGG + Intergenic
927437772 2:23084890-23084912 AACTGGAAGTTGAGTGAAGAGGG + Intergenic
928776122 2:34765789-34765811 TTCTAGAACCACAGTGAAAATGG + Intergenic
930552914 2:52858355-52858377 ACCTAGATGCCCAGTGATGATGG + Intergenic
930681373 2:54260081-54260103 ATCTAGTACCTAAGTGGAGAAGG + Intronic
933985342 2:87586416-87586438 ATCTAGCACCTCAGTGGAGTAGG + Intergenic
935387211 2:102512835-102512857 AGCTGGAAGCTCACTGAGGATGG + Intronic
936308500 2:111364393-111364415 ATCTAGCACCTCAGTGGAGTAGG - Intergenic
939865191 2:147464745-147464767 ATCAAGAAGGTCAAAGAAGAGGG + Intergenic
940755110 2:157673259-157673281 ACCTAGAAGCTGAGTGCAGTGGG + Intergenic
941247422 2:163116732-163116754 ATATTGAAGCTTAGTGAATATGG - Intergenic
943028282 2:182655242-182655264 AGTTAGAAGCTCAGGGAAGTGGG - Intergenic
943902450 2:193457491-193457513 ATCTAGAACCTCAAGGAAGACGG + Intergenic
944821766 2:203439835-203439857 GTCTAAAATGTCAGTGAAGAAGG - Exonic
945718102 2:213383344-213383366 AGCTAGAAGATAAGTCAAGAGGG - Intronic
945995650 2:216433737-216433759 ATGAACAAACTCAGTGAAGAAGG + Intronic
946625586 2:221609355-221609377 ATCTAGAAGCTCAGCTATGCTGG + Intergenic
946876219 2:224132350-224132372 AAATAGAAGTTAAGTGAAGAGGG - Intergenic
947900875 2:233720435-233720457 ATCTATAAGCCCAGTGAAGCTGG + Intronic
947902234 2:233730761-233730783 ATCTATAAGCCCAGTGAAGCTGG + Intronic
948542204 2:238699043-238699065 TTCTGGAAGCACAGTGCAGATGG + Intergenic
1172056405 20:32157591-32157613 ATCTGGACTCCCAGTGAAGAAGG - Intronic
1172382689 20:34509560-34509582 ATCAAGCAGCTCAGTGTAAATGG + Exonic
1173356530 20:42297564-42297586 AGCTAGAAACTCACTGAAAAAGG + Intronic
1173549843 20:43925079-43925101 ATCTTGAATCTCTTTGAAGATGG + Intronic
1173965086 20:47106626-47106648 ATCTGGAATCTCAGTGAGGCTGG + Intronic
1177109803 21:17011736-17011758 ATCTAAGAGCTCAGAGGAGAAGG - Intergenic
1178082989 21:29084737-29084759 ATCAGGAATCTCAATGAAGAAGG + Intronic
1178384144 21:32135633-32135655 ATCTGGAAGCTCCCTGCAGAGGG + Intergenic
1179949160 21:44699934-44699956 ATCTGGCAGCTCAGTGAAGATGG - Intronic
1181174611 22:21028545-21028567 ATCCAGGTGCCCAGTGAAGAGGG - Exonic
1183826805 22:40394747-40394769 ATCTAGAAGAGTAGTGATGAGGG - Intronic
1184678595 22:46056839-46056861 CTCTAGAAGCTCAATCTAGAAGG - Intronic
949934177 3:9103850-9103872 ATCCAGAAGCTGAGTGTGGAAGG - Intronic
950460551 3:13119791-13119813 ATCTGGAAGCCCAGATAAGATGG + Intergenic
952679592 3:36075074-36075096 AACTAGAAGAGGAGTGAAGATGG - Intergenic
953939702 3:47082378-47082400 GTAAAGAAGCTCAGTTAAGAAGG - Intronic
953987599 3:47457342-47457364 TTAGAGAAGCTCAGAGAAGAGGG - Intronic
959486495 3:106933096-106933118 ACCTAGAAGATAGGTGAAGAAGG - Intergenic
960090290 3:113631673-113631695 TTCTAGAAACTCAGTGGTGAAGG - Intergenic
961089801 3:124101128-124101150 ATCTAGAAAGTCATTGAAAATGG - Intronic
961193211 3:124979817-124979839 CTCTAGAAGCTTGGTGAGGAGGG - Intronic
961774086 3:129271730-129271752 ATCGAGAAGCTGAGTGAATGTGG + Intronic
962426369 3:135272175-135272197 ACGTAGGAGCTCAGAGAAGAGGG + Intergenic
964342975 3:155728090-155728112 TGCCAAAAGCTCAGTGAAGAGGG - Intronic
965026571 3:163309716-163309738 ATCTAGAAGTTCAATCAAAATGG + Intergenic
969682627 4:8651844-8651866 GTCAAGAAGCTCAGAGAAGCAGG - Intergenic
969839344 4:9869250-9869272 TTCTAGAAGCTGGGTGGAGACGG - Intronic
971025111 4:22582076-22582098 AACTAGCAGATCAGTGATGATGG + Intergenic
972243047 4:37214729-37214751 TTCTAGAAGCTGGGGGAAGAAGG - Intergenic
972867869 4:43256724-43256746 ATCTCCAAGCACAATGAAGATGG + Intergenic
976033809 4:80791776-80791798 ATGTAGAATCTCATTGAAAAGGG + Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
979746720 4:124223832-124223854 ATAAATAAGCTCAGGGAAGAAGG + Intergenic
981797528 4:148613945-148613967 ATCTAGAAGCTGGATGAATATGG + Intergenic
982658287 4:158175978-158176000 ATTTAGAATCTCTGGGAAGATGG - Intergenic
983436950 4:167728251-167728273 ATCCAGAAGTACAGTGGAGAAGG + Intergenic
984479138 4:180276529-180276551 ATGACGAAGCTCAGTGAGGAAGG + Intergenic
984535741 4:180973157-180973179 AAGCAGAAGCTAAGTGAAGAGGG + Intergenic
987088905 5:14493707-14493729 AGCCAGAAGCTTAGTGAGGAAGG + Intronic
987731969 5:21785403-21785425 ATGATTAAGCTCAGTGAAGAAGG + Intronic
987755224 5:22092547-22092569 ATCGAAAACCACAGTGAAGATGG + Intronic
989089791 5:37718279-37718301 ATTTACACCCTCAGTGAAGAGGG + Intronic
991479601 5:67063010-67063032 ATCTTGGGGCTCAGTGAAAAAGG - Intronic
992532756 5:77668374-77668396 ATATAGAAGATCAGTCCAGAAGG + Intergenic
992990660 5:82279624-82279646 AACTGAAAGATCAGTGAAGAAGG + Exonic
993729097 5:91401339-91401361 CACTAGAAGCCAAGTGAAGAGGG - Intergenic
994042608 5:95275324-95275346 ATCTAGAAGCTCTGGCAACACGG + Intronic
994775068 5:104029875-104029897 ATCTCCAAGCACAATGAAGATGG - Intergenic
995102836 5:108335483-108335505 ATATAGAAGCTCAGAGATGGAGG + Intronic
995469491 5:112485506-112485528 ATATAGAACATTAGTGAAGATGG - Intergenic
998094827 5:139391232-139391254 ATCAGGAAGCTCTGAGAAGAGGG - Exonic
998998443 5:147893218-147893240 ATCCAGAAACTCAGTGAAACTGG - Intronic
1001022084 5:168191545-168191567 ATCTAGAAGTTTTGTGAAAAAGG - Intronic
1007941489 6:45785662-45785684 ACCTAGAACCTCAGTAATGAAGG + Intergenic
1008692474 6:53995408-53995430 AACTAGTAGCACAGCGAAGACGG + Intronic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009900104 6:69799723-69799745 TTCTAGAAGCTCATTTAAGTTGG + Intergenic
1010608455 6:77921610-77921632 ATCATTAAGCTTAGTGAAGAAGG - Intronic
1011621853 6:89250671-89250693 TTCCAGGAGCCCAGTGAAGAAGG - Intergenic
1012106620 6:95168986-95169008 ATCCAGAAGCACATTGAATATGG + Intergenic
1012640913 6:101612202-101612224 TTCAATAAGCTCAGTGAAGCAGG + Intronic
1013821287 6:114156174-114156196 ATGTGGAAGCTTAGTGTAGAGGG - Intronic
1014991300 6:128080406-128080428 ATATAGAAATGCAGTGAAGATGG + Intronic
1016478022 6:144449775-144449797 ATCGAGAAGCTCTGTGGGGAGGG + Intronic
1016503544 6:144750178-144750200 ATATAGAAGCACAGGGAAGGAGG - Intronic
1016630553 6:146225015-146225037 ATCCAGATGCTCAGGGATGATGG - Intronic
1016755146 6:147676850-147676872 AGCTAGAAGATCAGGGTAGAGGG + Intronic
1018337327 6:162807373-162807395 ATAATTAAGCTCAGTGAAGAAGG - Intronic
1018498224 6:164372168-164372190 ATTTATAACCTCAGTGAAGAAGG - Intergenic
1020627183 7:10596164-10596186 ATCTATAAGCTCAGAGATGGAGG - Intergenic
1020955103 7:14730674-14730696 ATCCAGAGTCACAGTGAAGAAGG - Intronic
1021903451 7:25310495-25310517 AGCTAGAGGCTGAGTGGAGAAGG - Intergenic
1026791359 7:73334362-73334384 AGCCAGAAGCTCAGTGCAGGAGG - Intronic
1027481985 7:78709394-78709416 ATGTAGAAGCTTAGAAAAGAAGG - Intronic
1030237120 7:107276145-107276167 ATCTAGAATCTTAGTGTAAATGG - Intronic
1030992982 7:116323691-116323713 ATGATGAAGCTTAGTGAAGAAGG + Intronic
1031611014 7:123827288-123827310 TTCTGGAAGCTAAGTGAAGAAGG + Intergenic
1033475692 7:141690115-141690137 ATCTGTAAGGTCAGTGCAGAAGG + Intronic
1034028181 7:147730730-147730752 ATCATTAAGCTTAGTGAAGAAGG + Intronic
1035144418 7:156799696-156799718 AGCTAGAAGCTTAGTGAGGAAGG + Intronic
1035768973 8:2131419-2131441 AGCTCCAAGCCCAGTGAAGAGGG + Intronic
1036180882 8:6584218-6584240 ATTTAGCAGCTCAGGGAGGAAGG + Intronic
1038896583 8:31790190-31790212 ATCAATATGCTTAGTGAAGAAGG + Intronic
1041940492 8:63382015-63382037 ATCAGGAAGCTGTGTGAAGAGGG + Intergenic
1043862736 8:85339607-85339629 ATGATTAAGCTCAGTGAAGAAGG + Intronic
1045937211 8:107694594-107694616 ATCTAGAAGCCCCTTGAAAATGG - Intergenic
1046789880 8:118309764-118309786 ACCCAGGAGCTAAGTGAAGATGG - Intronic
1051385064 9:16498893-16498915 ATCCAGTAGCCCAGAGAAGATGG - Intronic
1054697490 9:68375096-68375118 CTCAAGAAGCCCTGTGAAGAGGG - Intronic
1055437876 9:76310635-76310657 ACCTAGAAATTCAGGGAAGAGGG - Exonic
1055776173 9:79769240-79769262 ATCTTGAAGCTCAATTAAGTGGG + Intergenic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058462578 9:105196812-105196834 TTATAGAAGCTGAGAGAAGATGG + Intergenic
1059223233 9:112645853-112645875 ATTTGGAAGCTCAGTGAAGTTGG - Intronic
1061750548 9:132774020-132774042 ATCCAGAAGCCAAGGGAAGAGGG - Intronic
1186463495 X:9766181-9766203 CTCTAGAAGACCAGTAAAGATGG - Intronic
1187359011 X:18607035-18607057 ATGTCGAAGCTCAGAGAAGTTGG + Intronic
1189130878 X:38496825-38496847 AACAAGAACCTCATTGAAGAGGG - Intronic
1190438531 X:50452422-50452444 AGGTAGAAGCCTAGTGAAGAAGG - Intronic
1190528857 X:51354828-51354850 AGCTGGAAGCTCAGAGAATAGGG + Intergenic
1193023114 X:76814039-76814061 ATTTAGAAGTTGAGTGGAGAAGG - Intergenic
1193494203 X:82190184-82190206 ATATAGATGCTCAGTGTAGATGG + Intergenic
1194000412 X:88421632-88421654 ATATAGAAGCTAATTGAAGTTGG - Intergenic
1195260188 X:103124276-103124298 ATCTAGAAGATCAAAGAAGGGGG + Intergenic
1197627581 X:128819917-128819939 TTCTAGAAGTTCAGGGAAGGTGG + Intergenic