ID: 921559144

View in Genome Browser
Species Human (GRCh38)
Location 1:216635809-216635831
Sequence GCTATGTTCACAGCAGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 177}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921559144_921559149 -4 Left 921559144 1:216635809-216635831 CCTAAGCCTGCTGTGAACATAGC 0: 1
1: 0
2: 1
3: 8
4: 177
Right 921559149 1:216635828-216635850 TAGCACTTGGTCATTTTGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 170
921559144_921559148 -5 Left 921559144 1:216635809-216635831 CCTAAGCCTGCTGTGAACATAGC 0: 1
1: 0
2: 1
3: 8
4: 177
Right 921559148 1:216635827-216635849 ATAGCACTTGGTCATTTTGGAGG 0: 1
1: 1
2: 0
3: 11
4: 178
921559144_921559147 -8 Left 921559144 1:216635809-216635831 CCTAAGCCTGCTGTGAACATAGC 0: 1
1: 0
2: 1
3: 8
4: 177
Right 921559147 1:216635824-216635846 AACATAGCACTTGGTCATTTTGG 0: 1
1: 0
2: 1
3: 6
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921559144 Original CRISPR GCTATGTTCACAGCAGGCTT AGG (reversed) Intronic
900438937 1:2643861-2643883 GCCAAGAGCACAGCAGGCTTTGG - Intronic
900680878 1:3915557-3915579 CCTGAGTTCACAGCAGGCTCTGG + Intergenic
900794227 1:4698413-4698435 GTGATGTTCACAGCAGGATATGG + Intronic
902175704 1:14648847-14648869 GCTATGGTCACTGGAGTCTTTGG + Intronic
905695833 1:39972913-39972935 GCTGTGACCAGAGCAGGCTTTGG + Intergenic
908033355 1:60025438-60025460 GCAATGTTTCCAGCAGGCTCAGG + Exonic
915746754 1:158166892-158166914 GTTTTGTTCACTGCAGTCTTCGG - Intergenic
916369371 1:164073391-164073413 GAAATGGTCACAGCAGGCCTTGG - Intergenic
919810868 1:201408165-201408187 CCTATGCTCTCACCAGGCTTTGG + Exonic
921296061 1:213705095-213705117 GCAATGTTTACAGCAGGCCTTGG - Intergenic
921559144 1:216635809-216635831 GCTATGTTCACAGCAGGCTTAGG - Intronic
923777321 1:236991297-236991319 GCTTTGTTCACATAGGGCTTAGG - Intergenic
924675916 1:246177902-246177924 GCCATCCTTACAGCAGGCTTAGG + Intronic
924813161 1:247420962-247420984 GCTGTGTGGTCAGCAGGCTTGGG + Intronic
1063076684 10:2723714-2723736 GCTTTGTTCACAGAAGGGTGTGG - Intergenic
1063081865 10:2775075-2775097 TCTATATTCACAGCAGTCTTTGG + Intergenic
1064828430 10:19432855-19432877 GAAATGTTCACAGTAGCCTTTGG - Intronic
1068751664 10:60600628-60600650 GCTATGTTCTCACCATGGTTTGG - Intronic
1069116509 10:64513514-64513536 GCTATGGTCAAAGCTGGCTAAGG - Intergenic
1069956222 10:72053652-72053674 GCATTGTTCCCAGCAGGCTTGGG - Intergenic
1070961830 10:80505032-80505054 GCTGTGCCCAGAGCAGGCTTGGG + Intronic
1071406656 10:85340931-85340953 ACTATTTTCACAGCAGTTTTAGG - Intergenic
1073420643 10:103421210-103421232 GCTGTGTTCAGAGAGGGCTTGGG + Intronic
1074704433 10:116118545-116118567 GCCATGTTCAGATCAGGCCTTGG - Intronic
1075979881 10:126728914-126728936 GCCATGTTATCAGCAGTCTTAGG + Intergenic
1076781883 10:132729003-132729025 GCTGTGGTCTCAGCAGGCGTGGG + Intronic
1076781901 10:132729063-132729085 GCTGTGGTCTCAGCAGGCGTGGG + Intronic
1077399470 11:2346820-2346842 GCTATGTCCCCAACAGGCCTCGG + Intergenic
1079145489 11:17847554-17847576 GCTATTTACAAAGCAGTCTTTGG + Intronic
1080187272 11:29504872-29504894 GCTATGTTAACAGCTTCCTTAGG - Intergenic
1081082360 11:38757894-38757916 GCTATGTTCTAAGCAGGGTTTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1088129771 11:106473327-106473349 GCTGTGTTCACTGCAGCCTCAGG + Intergenic
1089015637 11:115163008-115163030 GCTCTGTTATCAGCAGGCTGGGG - Intergenic
1089617459 11:119702973-119702995 TCTATGTTCCCACCAGGCTCAGG + Intronic
1090497021 11:127223055-127223077 TCTATGTTCACAGCAGCCAGTGG - Intergenic
1091236706 11:134026923-134026945 GCCATGGCAACAGCAGGCTTCGG + Intergenic
1092995151 12:13942808-13942830 GCTGTGTACCCAGCAGGCTCTGG - Intronic
1095085111 12:38051776-38051798 GGCAAGTTCTCAGCAGGCTTCGG + Intergenic
1095578026 12:43761609-43761631 GCTCTGGTCACAGTTGGCTTTGG + Intronic
1096385512 12:51192419-51192441 GCAATGACCACAGCAGGCTGGGG + Exonic
1098027987 12:66225570-66225592 ACTATGTTCTGGGCAGGCTTGGG - Intronic
1098142816 12:67468701-67468723 GGTGTGGTCACAGCAGGCCTTGG - Intergenic
1099985264 12:89655092-89655114 CCTGTGTTCACAGAAGCCTTTGG - Intronic
1101509636 12:105381064-105381086 GCTGTGTTCAGAACAGGCTGAGG - Intronic
1101986818 12:109453600-109453622 GCTGTGGTCTCAGCAGGATTGGG + Intronic
1106603359 13:31206144-31206166 GCTATTTTCACAACGGGCTGAGG - Intronic
1107083869 13:36405122-36405144 CCTATGTTCACTGGAGGCTCTGG + Intergenic
1107381438 13:39860806-39860828 GCTTTGTTCCCATGAGGCTTAGG - Intergenic
1108933215 13:55857838-55857860 GCTATCTTCAAAGAAGGATTTGG + Intergenic
1109602790 13:64654971-64654993 GCTATGTTAAGCGCAGTCTTGGG - Intergenic
1110646655 13:77893418-77893440 GCTGTTTTCAAAGCAGTCTTAGG + Intergenic
1112439072 13:99412458-99412480 GCTCTGTGCACAGCAGGTTGGGG + Intergenic
1115306222 14:31936651-31936673 GCTCTGTTCTCTGCAGGCTGAGG - Intergenic
1117245768 14:53885322-53885344 GCTATGTTCACAGCTGGTAAAGG - Intergenic
1119200283 14:72746933-72746955 GCTGAGTTCACAGCCTGCTTTGG - Intronic
1122180616 14:99951556-99951578 GCTAAGGTCACAGCAACCTTGGG - Intergenic
1122768388 14:104086199-104086221 GCTCTGGACACAGAAGGCTTAGG + Intronic
1126345770 15:47692485-47692507 TCTATGTTTGCAGCATGCTTAGG - Intronic
1128316167 15:66660837-66660859 GCTACATTTACAGCGGGCTTCGG - Intronic
1128580337 15:68805529-68805551 GCTCTGCTCACACCAGCCTTGGG - Intronic
1130149481 15:81300149-81300171 CCTGTGTTGACAGCAGCCTTAGG - Exonic
1131560494 15:93435507-93435529 GCCATGTCAACAGCAGGGTTGGG - Intergenic
1131575399 15:93585063-93585085 TAAATGTTCAAAGCAGGCTTTGG + Intergenic
1132847791 16:2008678-2008700 GGTTTGTTCATAGAAGGCTTCGG - Intronic
1133425627 16:5686452-5686474 GCTACCTTCACTGCAGGCTTTGG - Intergenic
1133522502 16:6572927-6572949 GCTAAGTTCCCAGCACTCTTGGG - Intronic
1133827182 16:9288498-9288520 GCTATTTTCAAATCTGGCTTTGG + Intergenic
1134539777 16:15055497-15055519 GCAACGTTCACCGCAGGCTGCGG + Intronic
1134629273 16:15745276-15745298 GCTCTGTTGACAGCAGGGTGTGG - Intronic
1135822441 16:25695926-25695948 GCTCTCTGCACAGCTGGCTTGGG + Intronic
1139080404 16:63511683-63511705 GAAATGTTCATAGCAGGCTTTGG - Intergenic
1140098588 16:71895563-71895585 GCTGCGTTCACGGCAGGATTCGG + Intronic
1140198876 16:72878584-72878606 GCTTTGCTCACCGCAGTCTTAGG + Intronic
1140695702 16:77531209-77531231 GCTATGTTTCCAACAGACTTTGG + Intergenic
1140894299 16:79311533-79311555 GCTGCTTTCACTGCAGGCTTTGG + Intergenic
1141159661 16:81620772-81620794 GCTGTCTACAGAGCAGGCTTGGG + Intronic
1143119816 17:4599685-4599707 GCTGTGTTCCCTGCAGGCTGGGG - Intronic
1145817556 17:27806282-27806304 GCTCTGCCCACAGCAGGCCTTGG - Intronic
1151209689 17:72535323-72535345 ACTATGTTCACCTAAGGCTTAGG + Intergenic
1152167337 17:78718387-78718409 GCTATTTACAAACCAGGCTTTGG + Intronic
1152747315 17:82047271-82047293 GCTTTGTCCACTGCAGGCTCTGG - Intergenic
1152827238 17:82474830-82474852 GCTGAGATCACAGCAGGCTGTGG - Intronic
1153192400 18:2556325-2556347 GTTATGATCAGAGCAGACTTTGG - Intronic
1153288520 18:3478400-3478422 GCTGAGATCACAGCAGGCCTTGG - Intergenic
1153660260 18:7319753-7319775 ATTATCTTCACAGAAGGCTTGGG - Intergenic
1154154906 18:11936518-11936540 GCCATGGGCAGAGCAGGCTTGGG + Intergenic
1159486991 18:69074780-69074802 CCTAGCTTCACAGGAGGCTTGGG - Intergenic
1160858182 19:1226714-1226736 GCTATGCTCACGGCTGGCTGTGG - Intronic
1165682795 19:37791730-37791752 GCTGTGTTCATGGCAGGATTCGG + Intronic
925547046 2:5028022-5028044 CCTATGTTCATGGCAGGTTTAGG + Intergenic
931097106 2:58953583-58953605 TCTATGTTAACAGCACTCTTAGG - Intergenic
932409348 2:71536031-71536053 GCTTTGGAAACAGCAGGCTTGGG - Intronic
934568024 2:95351304-95351326 GCTGTGTTGAGAGCAGACTTGGG + Intronic
937833288 2:126446202-126446224 TGTGTGGTCACAGCAGGCTTGGG + Intergenic
940286477 2:152037917-152037939 TCTGTGTTCACTGCAGGCTGGGG - Intronic
943063317 2:183061223-183061245 CCTTTTTTCAGAGCAGGCTTTGG - Intergenic
946537680 2:220648865-220648887 GAGATGCTCACAGCAGGATTGGG - Intergenic
948724100 2:239921210-239921232 GCTCTGGACACAGCAGGGTTGGG - Intronic
1170414860 20:16128812-16128834 GCTATGTGAACAGCATGCCTGGG - Intergenic
1170709164 20:18774848-18774870 GCAGTGGTCACAGCAGGCCTTGG - Intergenic
1175298171 20:57923590-57923612 GATATGTTCCCAGCTGGCCTGGG - Intergenic
1176056024 20:63149696-63149718 GCTGTGTGCACTGCAGGCCTGGG - Intergenic
1176553012 21:8238228-8238250 GGAAAGTTCTCAGCAGGCTTAGG - Intergenic
1176571934 21:8421252-8421274 GGAAAGTTCTCAGCAGGCTTAGG - Intergenic
1176579843 21:8465835-8465857 GGAAAGTTCTCAGCAGGCTTAGG - Intergenic
1176932405 21:14829252-14829274 GCTGTGTTCACAGGAAGCTGTGG + Intergenic
1177947304 21:27487343-27487365 GCTATGTACACTGCAGTCTCTGG + Intergenic
1178125216 21:29508537-29508559 GCAATGTTCACATCAGACTGAGG + Intronic
1178158854 21:29887775-29887797 TCTATGTTCACAGCAGGAGAAGG + Intronic
1179126417 21:38595151-38595173 GCTATTTTCACAACAAGGTTCGG - Intronic
1184550560 22:45202290-45202312 GCTTTGTTCCCAGAAGCCTTTGG - Intronic
1203258010 22_KI270733v1_random:155270-155292 GGAAAGTTCTCAGCAGGCTTAGG - Intergenic
951414178 3:22402886-22402908 CCTATGCTCACAGCGGGCTATGG - Intergenic
952317320 3:32242444-32242466 CCTGTGGTCACAGCTGGCTTGGG - Intronic
952780155 3:37088686-37088708 CCTATAGTCCCAGCAGGCTTAGG + Intronic
954745920 3:52787502-52787524 GCTCTGTCCACAACAGGCCTGGG - Intronic
959411850 3:106033951-106033973 GCTATCTTCAGAGCTGGTTTTGG - Intergenic
962199355 3:133388877-133388899 GCTCTGTTCGCAGCAGCCTGAGG - Intronic
962965240 3:140347439-140347461 AATATGTTCACACCAGGTTTAGG - Intronic
966097142 3:176217636-176217658 GATATCTTGACAGCTGGCTTCGG + Intergenic
966157311 3:176930775-176930797 CCTGTGTTTACAGCAGGATTGGG - Intergenic
967407849 3:189137515-189137537 GCTCTGTTCACAGCAGGGCCTGG - Intronic
967866218 3:194192231-194192253 TCTATGTTATCAGCAGCCTTGGG - Intergenic
968259070 3:197304510-197304532 TGTCTGTTCACAGAAGGCTTTGG + Intergenic
968430113 4:552241-552263 CCTATATTCACAGCAGGCTGTGG + Intergenic
970131073 4:12871884-12871906 TCTCTGTTGACATCAGGCTTTGG + Intergenic
973867411 4:55127299-55127321 GCTTTGTTCGCAGCCAGCTTAGG - Intergenic
974780097 4:66543554-66543576 GCTATGTGCTCTGCAGCCTTGGG - Intergenic
975261305 4:72302901-72302923 TCTTTCTTCACAGCAGGCTGAGG + Intronic
976305965 4:83559823-83559845 GCTTTGTACACAGTAGGCTGGGG + Intronic
976600497 4:86934283-86934305 GGTATGTTTACAGCAGGAATCGG + Intronic
978031013 4:103939732-103939754 GTGTTGTTAACAGCAGGCTTTGG + Intergenic
978067242 4:104420792-104420814 GCTCTCTTTACATCAGGCTTGGG + Intergenic
980096187 4:128493309-128493331 CCTATGCTCACTCCAGGCTTTGG + Intergenic
981692891 4:147528982-147529004 GCTATGTTCAGACGAGGCTGTGG + Intronic
981823873 4:148916845-148916867 GCTGTGTTCTAAGCAGACTTGGG - Intergenic
984150140 4:176119695-176119717 CCTATGTTCCCTGCAGTCTTTGG + Intronic
987443869 5:17992002-17992024 AATATGTTCACAGCATGCTGAGG + Intergenic
991603010 5:68372384-68372406 CCTATTTTCAGATCAGGCTTTGG + Intergenic
992273275 5:75088070-75088092 GCTAGGTTCATAGGAGGTTTAGG + Intronic
994080030 5:95698324-95698346 GCTAAGTTCACAGCAAGCTGTGG + Intronic
995744647 5:115391107-115391129 GCCATGTTCACAGAAAACTTTGG + Intergenic
998146936 5:139734358-139734380 GCTCTGTTCTGAGCAGGCTAGGG - Intergenic
1000155026 5:158541703-158541725 GCTGGAATCACAGCAGGCTTTGG + Intergenic
1002047302 5:176549311-176549333 GCTATGTGGCCAGCAGACTTTGG - Intronic
1003393596 6:5734081-5734103 GCATTGTCCACAGCAGGTTTCGG - Intronic
1004122098 6:12833810-12833832 GCACTGTCCACAGCAGGCTAGGG - Intronic
1005199371 6:23325805-23325827 GCTGTGTTCTCACCAGGCTCAGG - Intergenic
1007518595 6:42433376-42433398 GCTCTGTGCACAGAAGACTTAGG - Intronic
1008227194 6:48935830-48935852 GCTATGTTCACTGAAGGCCCTGG + Intergenic
1009873492 6:69476202-69476224 GATATATTCACAGAAGACTTGGG - Intergenic
1010679192 6:78780483-78780505 GCTCTGTTCAGAGCAGCCTGTGG + Intergenic
1012800430 6:103820332-103820354 GCAATACTCACCGCAGGCTTTGG + Intergenic
1015411377 6:132897616-132897638 GCTAAGTTTTCAGCCGGCTTTGG - Intergenic
1016370570 6:143369793-143369815 CCTATCTACACAGGAGGCTTAGG + Intergenic
1016692073 6:146949597-146949619 GCATTGTTCATAGCAGGCTGTGG + Intergenic
1018708734 6:166482608-166482630 GCTGCGATCACAGAAGGCTTCGG + Intronic
1019352199 7:559553-559575 GCTATGAGCACAGCGGGCCTGGG - Intronic
1019738745 7:2662675-2662697 GGGATGTTCACAGCCGGCTCGGG - Exonic
1020046254 7:5042880-5042902 GCTATGTAAAAAGGAGGCTTTGG + Intronic
1021231842 7:18094480-18094502 GCTGTGATCACACCAGCCTTGGG - Intronic
1031639029 7:124139778-124139800 CCTATGTTCACTGAAGGCTCTGG + Intergenic
1032496899 7:132369391-132369413 CCTCTGTTCTCACCAGGCTTGGG - Intronic
1036530520 8:9581950-9581972 CCTCAGTTCACAGTAGGCTTTGG + Intronic
1043998107 8:86843723-86843745 GTGGTGTTCACAGCAGGCCTTGG + Intergenic
1044710762 8:95055057-95055079 GGTATTTTTACATCAGGCTTTGG - Intronic
1045476560 8:102557653-102557675 GCTATGGCCACAGCTGGTTTTGG - Intronic
1046717423 8:117583034-117583056 GCTTTATTAATAGCAGGCTTAGG + Intergenic
1048204325 8:132403369-132403391 GGTCTGTGCACAGAAGGCTTGGG - Intronic
1048376005 8:133822778-133822800 GCTATGTAGACACCAGGCTGAGG + Intergenic
1048975845 8:139672686-139672708 TCTCTGTCTACAGCAGGCTTGGG + Intronic
1056412622 9:86346337-86346359 GCTAGGCTTACAGCAGGCTGAGG - Exonic
1056752415 9:89362268-89362290 GCTGTGTTCAGAGCAGGCTTGGG + Intronic
1057212982 9:93210592-93210614 GGTATGATCTCAGCAGGCTCAGG - Intronic
1057994025 9:99803426-99803448 GCTATGTTCTGAGGAGGGTTCGG - Intergenic
1061674290 9:132207015-132207037 GCCAGGGTCACAGGAGGCTTGGG + Intronic
1203474204 Un_GL000220v1:137293-137315 GGAAAGTTCTCAGCAGGCTTAGG - Intergenic
1190413064 X:50156177-50156199 GCTATGGCCACAGCAGGCCACGG - Intergenic
1190582671 X:51903743-51903765 GCTGTGTCCACAGCCAGCTTGGG + Intergenic
1190911750 X:54777474-54777496 GATGTGGTTACAGCAGGCTTTGG + Intronic
1190929159 X:54933778-54933800 GCTGTGTCCACAGCCAGCTTGGG + Intronic
1191663171 X:63671200-63671222 GGTCTGTTCACAGCAGTCCTCGG + Intronic
1193329819 X:80223495-80223517 GCTATAATTACAACAGGCTTAGG - Intergenic
1197469921 X:126855139-126855161 GCAGTGGTTACAGCAGGCTTTGG - Intergenic
1199340547 X:146671929-146671951 GCTATTTCCTCAGCAGGTTTTGG - Intergenic
1200275579 X:154729333-154729355 GCTTGGTTCACAGTAGGCATTGG - Intronic