ID: 921561918

View in Genome Browser
Species Human (GRCh38)
Location 1:216669328-216669350
Sequence GGTTCCAGTAAGTCAAAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921561916_921561918 16 Left 921561916 1:216669289-216669311 CCGTGGAAAAGGAATCACTACTC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 921561918 1:216669328-216669350 GGTTCCAGTAAGTCAAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921561918 Original CRISPR GGTTCCAGTAAGTCAAAACC AGG Intronic
No off target data available for this crispr