ID: 921562753

View in Genome Browser
Species Human (GRCh38)
Location 1:216677945-216677967
Sequence TTGCAGCATCAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 285}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921562753 Original CRISPR TTGCAGCATCAGAATGAGGA AGG (reversed) Intronic
903076510 1:20772373-20772395 GAGCAGCATCATAGTGAGGATGG - Intronic
903117830 1:21192678-21192700 TGGCAGCAGGAGAGTGAGGAAGG - Intergenic
903413812 1:23168227-23168249 CTGCAGCAGCAGGAGGAGGAGGG - Intronic
905016157 1:34780344-34780366 TGGCAGCATCCAGATGAGGAAGG - Intronic
905035362 1:34914645-34914667 TTGTAACATCACAATGAGAAAGG - Intronic
905252150 1:36656426-36656448 CTGCTGCATCAGCATGAGGCTGG + Intergenic
906907799 1:49914372-49914394 TTGCAACTTTATAATGAGGATGG + Intronic
909950081 1:81708709-81708731 TTGAAGCATAAAAATTAGGATGG + Intronic
913093364 1:115494818-115494840 CTCCAGCATCACAATGATGATGG + Intergenic
916662750 1:166937046-166937068 CTGTAGCATCAGAATAAGGATGG + Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917475228 1:175363570-175363592 ATGCTGCATCAGAATGAGAGTGG - Intronic
918323866 1:183391195-183391217 TTGCAGAGTGAGGATGAGGATGG - Intronic
918547012 1:185696517-185696539 TAGCTGCAGCAGAAGGAGGACGG - Intergenic
918725611 1:187918097-187918119 TTGGAGACTCAGAATGGGGAGGG + Intergenic
919492261 1:198219540-198219562 TTGGAGACTCAGAATGGGGAAGG + Intronic
920034494 1:203056988-203057010 TTGGGGCATCAGAAGCAGGAAGG + Intronic
920844877 1:209585365-209585387 TTACAGCATCATAAGGATGAAGG + Intronic
921021006 1:211235621-211235643 TTGGAGGATCACAATGAGGTTGG + Intergenic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921714369 1:218402840-218402862 ATGCAGCATCAGCCTGTGGAAGG + Intronic
922332490 1:224589742-224589764 TTGCAGCATGGGATTGAGAAAGG + Intronic
923308439 1:232709955-232709977 TTGAAGCATCTGAGTGAGCAGGG - Intergenic
924110541 1:240695339-240695361 TTTCACCATCAAAATGAAGAAGG + Intergenic
1062911722 10:1216166-1216188 TTGGGGCATCAGACTGAGGTTGG + Intronic
1063237332 10:4130720-4130742 TTTCAGCATTAAAATGAGGTGGG - Intergenic
1064559880 10:16585507-16585529 TGGCAGCATCAGAATGTGCTGGG + Intergenic
1068820616 10:61373811-61373833 TTTCGGCATCAGAATGATGCTGG + Intergenic
1070102223 10:73399150-73399172 TGGTAGGATCAGAATAAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070724136 10:78776938-78776960 TCCCAGCATCAGAAAGAGGAAGG + Intergenic
1070736696 10:78867952-78867974 GAGCAGCATCTGAAAGAGGATGG - Intergenic
1070982529 10:80660910-80660932 TTGTTGCAACAGAAAGAGGAAGG - Intergenic
1071786854 10:88910537-88910559 ATGTAGCATCAGAATTAGAAGGG - Intronic
1073261191 10:102191738-102191760 TGGCTGCTTCATAATGAGGAGGG - Intergenic
1074210001 10:111322524-111322546 TGGCAGCAGCAGTAGGAGGATGG + Intergenic
1074386543 10:113020862-113020884 TTGCATCTACAGAATGAGGGAGG + Intronic
1076146733 10:128127736-128127758 TGGGAGCATGAGAATGAGAAGGG - Intergenic
1076518781 10:131066274-131066296 TTTTAGCATTACAATGAGGAAGG - Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1077849151 11:6057727-6057749 TTTTCGCAACAGAATGAGGAAGG + Intergenic
1077937082 11:6799756-6799778 TCAAAGCATCAGAAGGAGGAGGG - Intergenic
1078724178 11:13913912-13913934 CTACAGCAACAGAATGAAGAGGG - Intergenic
1079859928 11:25656421-25656443 ATGCAGCTTCTGAATCAGGAGGG - Intergenic
1080152304 11:29067299-29067321 TTTTGGCATCAGAATGATGAAGG - Intergenic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080697371 11:34614350-34614372 TTGCATACTAAGAATGAGGATGG + Intergenic
1083443900 11:62694505-62694527 TGGCAGGATCAGAATGGGTAGGG - Intronic
1084098378 11:66928447-66928469 TGGCAGCAGCAGAATGACCATGG + Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084915412 11:72425552-72425574 TTGTGGCAACAAAATGAGGAAGG - Intronic
1085446815 11:76606298-76606320 TTGCAGCAGAAGAGTGAGAAGGG - Intergenic
1085803917 11:79617294-79617316 TTCCTGCATCTGCATGAGGAAGG - Intergenic
1085881740 11:80475192-80475214 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1086591428 11:88519469-88519491 TTGCAGAATCAGACTGAGTTGGG + Intronic
1087458076 11:98412794-98412816 TTACAGCATAACACTGAGGAAGG - Intergenic
1088060644 11:105645101-105645123 ATGCAGCTTCATAATCAGGAAGG + Intronic
1091446739 12:548058-548080 CTGCACAAGCAGAATGAGGAGGG + Exonic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091843026 12:3633928-3633950 TTCCAGCATCCGCAGGAGGAAGG + Intronic
1092522927 12:9292166-9292188 TTGCACCAGCTGTATGAGGAAGG + Intergenic
1093194559 12:16114660-16114682 TTGCATCAGAAGAATGAGGCAGG - Intergenic
1095542416 12:43325967-43325989 TTACAGCATCAGAAAAAGGAAGG + Intergenic
1097157824 12:57025734-57025756 ATGCAGCATCTCAAAGAGGATGG + Intronic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098187648 12:67914892-67914914 TTACAGCAGAAGGATGAGGAAGG + Intergenic
1098905796 12:76161140-76161162 TTTTAGCATGAAAATGAGGAAGG - Intergenic
1099541817 12:83919616-83919638 CTGCAGTATCAGATTGATGATGG + Intergenic
1100747719 12:97663896-97663918 TTGCATCATTAACATGAGGAGGG - Intergenic
1101019463 12:100538471-100538493 TGGCACCATCAGAATGAGTGTGG - Intronic
1101450230 12:104769569-104769591 TTGCAACATCTCAAAGAGGAAGG - Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1106500482 13:30323630-30323652 TTGCAGCAGCAGTAGGAGGAGGG + Intergenic
1106611965 13:31292296-31292318 TTTTAGTATCAGAATGAGGCTGG + Intronic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1109138798 13:58687399-58687421 TTGCAGCATGAGGATGAGAGAGG + Intergenic
1109403811 13:61871403-61871425 TTGCAGAAACAGAAGGAGAATGG + Intergenic
1109564648 13:64096060-64096082 ATGCAGCATGAGAATAAAGAAGG + Intergenic
1109887361 13:68559324-68559346 TTTTAGCATTAAAATGAGGAAGG - Intergenic
1110582324 13:77144942-77144964 TTGCAGCATAAAAATGTTGAGGG - Intronic
1110937771 13:81314497-81314519 TTTCAGTATCATAATGAGGCTGG - Intergenic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114860725 14:26517228-26517250 TAGCAGCAGCAGAATGAGCAAGG - Intronic
1115427529 14:33277744-33277766 TTGCTGGAGCAGAATGAGAAAGG + Intronic
1116975102 14:51106951-51106973 TGGCCTCATGAGAATGAGGATGG + Intergenic
1117168733 14:53068078-53068100 TGGCAGAATTAGAATGTGGATGG - Intronic
1119707189 14:76790395-76790417 TTGCAGCATTAAAGAGAGGAGGG - Intronic
1119896073 14:78220902-78220924 CTGTGGCATCTGAATGAGGAAGG + Intergenic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1121661710 14:95640081-95640103 TTGCAGAAACCCAATGAGGAAGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122664189 14:103317345-103317367 TCTCAGGATCAGATTGAGGAGGG - Intergenic
1123195748 14:106614897-106614919 TTGAAACATCAGAATCAAGAAGG - Intergenic
1123509132 15:20978354-20978376 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1123566354 15:21552101-21552123 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1123602618 15:21989387-21989409 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1124434525 15:29635908-29635930 TTACCTCATCAGAATGTGGAAGG - Intergenic
1125525408 15:40370931-40370953 GTGCAGCAGGAGAAGGAGGATGG + Exonic
1126180872 15:45783938-45783960 CTGCAGCATCACAAAGGGGAAGG + Intergenic
1126463704 15:48940624-48940646 TAGCAGCATCAGTATGATGGTGG + Intronic
1128479325 15:68023704-68023726 TTTCAGCCTCCAAATGAGGAGGG + Intergenic
1128767561 15:70260489-70260511 CTGCAGCAGCAGAATGAGTGTGG - Intergenic
1130011257 15:80154428-80154450 TTTCAACATCAGAATGTGCAGGG + Intronic
1131923001 15:97350886-97350908 CTGCAGCTTCAGCATGAGGCCGG + Intergenic
1131976415 15:97950762-97950784 TTGCTGCATAAAATTGAGGAAGG - Intergenic
1202974723 15_KI270727v1_random:279189-279211 TCCCAGCATCAGTATGTGGAAGG - Intergenic
1133994739 16:10739911-10739933 TTGCAGGACCAGGAGGAGGAGGG + Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135948590 16:26889844-26889866 TTCCAGACTCAGAAAGAGGAGGG - Intergenic
1136884225 16:33921727-33921749 TGGCTGCATGAGAAGGAGGAAGG - Intergenic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137593027 16:49705424-49705446 TTGCAGAACAAGAATGTGGATGG + Intronic
1139532622 16:67550110-67550132 ATGCAGCCTCAGCATGTGGATGG - Intergenic
1140636807 16:76924565-76924587 TAGTAGCATCAGAATGACCAAGG - Intergenic
1141787339 16:86210588-86210610 TGGCAGCATCAGAACTTGGAGGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1143145345 17:4771786-4771808 TGGCAGGATCAGAATGATAAGGG - Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144951306 17:18995514-18995536 TTGCAGTCTCAGAAGGTGGAAGG + Intronic
1146633725 17:34488840-34488862 TTGCAGCTTCTGAATGATCATGG + Intergenic
1149447991 17:56728677-56728699 TTGCTGCATCTGTAAGAGGAAGG - Intergenic
1149695753 17:58614929-58614951 TTGTAGCATGAGAATCAGAAGGG + Intronic
1150997549 17:70336263-70336285 AGGCAGCATCAGAGTGAGGCAGG - Intergenic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1155137014 18:23005858-23005880 TTGCATCTGCATAATGAGGAGGG - Intronic
1155403166 18:25460525-25460547 TTGCAGAAGCAGAAAGAGAATGG + Intergenic
1157186971 18:45549052-45549074 TGGCAGCATAGGAAGGAGGATGG - Intronic
1160699545 19:499146-499168 TGGCTGCAGCAGAATGAGGAGGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161620913 19:5296680-5296702 TTGCTGGAGCAGAGTGAGGAAGG + Intronic
1161649887 19:5477958-5477980 TGGCTGCAGCAGAGTGAGGAGGG - Intergenic
1161756423 19:6137447-6137469 TGGCTGCAGCAGAGTGAGGAGGG + Intronic
1163769255 19:19180720-19180742 TTCCAGGATCAGGCTGAGGAGGG + Exonic
1163832898 19:19555605-19555627 TTGCTGTTTCAAAATGAGGAAGG + Intergenic
1164250380 19:23470459-23470481 TTGCACCATCTGAATCAGGGCGG - Intergenic
1166023694 19:40057355-40057377 TTACATCATCATAATGATGAAGG + Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166189578 19:41167080-41167102 TTCCAGCACCTGAATGAGCAGGG - Intergenic
1166932171 19:46308141-46308163 TTGGAGCAGGGGAATGAGGATGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
926929188 2:18019547-18019569 TTTCAGTATCAGAATGATGCTGG + Intronic
929326251 2:40614791-40614813 TTGTAGCATGAGACTGAGGTGGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
931496436 2:62812628-62812650 TTGCAACTTCATAATAAGGATGG - Intronic
931889725 2:66658287-66658309 TTTCAGCATCAGGATGATGCTGG + Intergenic
932362285 2:71118824-71118846 TTGCAGTGTCAGAGTGAGGAGGG - Intronic
932884416 2:75535766-75535788 TTGGAGACTCAGAATGGGGAAGG + Intronic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935310810 2:101781504-101781526 TTGCTGCATCATAACGTGGAAGG + Intronic
936048275 2:109203241-109203263 GGGCAGCATCAGGATGAGGCAGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936489934 2:112961271-112961293 AGGCAGCATCAGAATGACGCTGG - Intergenic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940976518 2:159951607-159951629 TTGCAGCATCTGGATGACAAAGG + Intronic
941843272 2:170110037-170110059 TCGCAGCATCTGAATCAGGGTGG - Intergenic
942151767 2:173082733-173082755 TTGCAGCATGAGGAAGAGAATGG - Intronic
942224797 2:173805589-173805611 TTACAGAATCAGAATCAGCAGGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
945098200 2:206239347-206239369 TTGCTGAATCAGTATGTGGAGGG + Intergenic
947816837 2:233043075-233043097 TTGCAGCATCAGAATCATCTAGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948112892 2:235471251-235471273 CTGGAGCAGCATAATGAGGATGG + Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169794186 20:9443620-9443642 CTGCAGGATCAGACTGAGGCTGG + Intronic
1170577123 20:17672635-17672657 TTGCAGGACCAGAAGGAGGTAGG - Intronic
1171196583 20:23204700-23204722 AGCCAGCATCAGAATGTGGACGG + Intergenic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1173059618 20:39648747-39648769 TTGGAGATTCAGAATGGGGAGGG + Intergenic
1173645074 20:44628219-44628241 TTGCATCTTCAGGATGAGGATGG + Intronic
1173818990 20:46008752-46008774 TGGCAGCACCAGCATGAGAAAGG - Intergenic
1173859491 20:46273550-46273572 TTGATGCATCAGAAAGAGTAGGG - Intronic
1173958392 20:47052389-47052411 TGGCAGCATCAGCATCACGAGGG + Intronic
1174181954 20:48680550-48680572 TGGCTGCCTCAGAGTGAGGAGGG - Intronic
1174595715 20:51681841-51681863 TTGCTGCATGAAAAGGAGGACGG + Intronic
1175376760 20:58532607-58532629 TTGCAGCATAGGACTGGGGAAGG - Intergenic
1176267270 20:64216775-64216797 TGACAGCATCAGATAGAGGAGGG - Intronic
1178372487 21:32037876-32037898 TTTTAGCATTAAAATGAGGATGG - Intronic
1178810667 21:35878445-35878467 GTTCAGCATGAGAAAGAGGAGGG - Intronic
1184695664 22:46137542-46137564 TTTCAGCAACCGAATGAGGTAGG + Intergenic
950340080 3:12235605-12235627 TTGTAGCACCAGTATGAAGAAGG + Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951359517 3:21708314-21708336 TTACAGCAACACAATGAGGGTGG + Intronic
951678626 3:25271109-25271131 TTTTAGCATCAAAATGAGGTTGG + Intronic
952925891 3:38318944-38318966 TTGCAGCATCAGCAGAAAGATGG - Intergenic
953038361 3:39233182-39233204 TTTTAGCATTAAAATGAGGAAGG - Intergenic
953386630 3:42509984-42510006 TTGAAGCAGGAGACTGAGGATGG - Intronic
955545898 3:60029820-60029842 TTGTAGCACCAGAAAGAGGTTGG + Intronic
956695328 3:71914038-71914060 TTAGAGACTCAGAATGAGGAGGG - Intergenic
961440026 3:126947249-126947271 CTGCAGCATCAACATGAGGTGGG - Intronic
961488250 3:127232546-127232568 ATGCAGGATGAGATTGAGGAGGG - Intergenic
961498465 3:127312654-127312676 TTACAACATCAAAATGAGGAAGG - Intergenic
961740216 3:129028572-129028594 TTGCAGCTTTACCATGAGGAGGG + Intronic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
962662983 3:137623871-137623893 TTTTAGCATTAAAATGAGGAAGG - Intergenic
962826529 3:139104704-139104726 TTCCAGCCACAGAGTGAGGAGGG - Intronic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965786756 3:172343324-172343346 TGGCACCATCAGGAAGAGGAAGG - Intronic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
970490789 4:16571535-16571557 TTGCAGCATGATAGTGAGGAAGG + Intronic
970653931 4:18210114-18210136 TTTCAGTATCAGAATGATGCCGG + Intergenic
971227074 4:24764233-24764255 TTACAGCATCAGACTCAGGCTGG + Intergenic
971925730 4:33007164-33007186 TTTTAGCATTAAAATGAGGAAGG - Intergenic
972357188 4:38291127-38291149 TCTGAGCATCAGAGTGAGGAGGG + Intergenic
972704227 4:41525909-41525931 TTGCAGCATAAAACTAAGGAAGG + Intronic
972969763 4:44558969-44558991 TTGGAAGATCAGAATGAGGTCGG + Intergenic
973339911 4:48993416-48993438 TAACAGGATCAGAGTGAGGAGGG - Intronic
973589711 4:52428626-52428648 TTGGAGCATTAGAATGAGCTGGG + Intergenic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974671755 4:65039172-65039194 TTGCACCAGCTGCATGAGGATGG + Intergenic
974985852 4:69025572-69025594 ATGCAGCATCAGAAAAAGGTGGG + Intronic
975940741 4:79642516-79642538 CTGCAGCATCAGAATGTGAGAGG + Intergenic
977521410 4:98089033-98089055 TGGCAGGATTAGAATGAAGAAGG - Intronic
978461349 4:108956847-108956869 TTGCAGAATCAGAATCCAGAGGG + Intronic
978913685 4:114097081-114097103 TTGGAGACTCAGAATGGGGAAGG - Intergenic
979040232 4:115781855-115781877 TTTTAGCATTAAAATGAGGAAGG + Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980701462 4:136437577-136437599 TTGAATCAGCAGACTGAGGAAGG + Intergenic
980897844 4:138876752-138876774 TTGCATCATCCCAAAGAGGATGG - Intergenic
981166710 4:141567730-141567752 CTGTAGGATCAGAATGGGGAGGG - Intergenic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
982793202 4:159616183-159616205 TAGTAGCAACAGAATGAGAAGGG - Intergenic
982887672 4:160802469-160802491 TTGGAGACTCAGAATGGGGATGG + Intergenic
983924480 4:173385107-173385129 TTGCAGCAACTGAATGAGATAGG - Exonic
984070257 4:175102352-175102374 TGACATCATTAGAATGAGGAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
986286197 5:6360847-6360869 TGGCACCTTCAGGATGAGGATGG - Intergenic
990722023 5:58707650-58707672 TGCCAGCATCAGAATGACCAAGG + Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
995614827 5:113950194-113950216 TGGGAGCAGCAGAATGAGGGAGG - Intergenic
996865218 5:128113263-128113285 TGGGAGCATCAGAATCAAGAAGG + Intronic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
997866843 5:137471426-137471448 TTGCAGCAACTGAATGAAGTAGG - Intronic
998538559 5:142957148-142957170 TTGAATCAAAAGAATGAGGATGG + Intronic
998921674 5:147075018-147075040 TTGCAGTATCAGAAAGAAAATGG + Intronic
999539834 5:152559300-152559322 GTGTAGCATCAGTATGGGGATGG + Intergenic
1001794204 5:174488502-174488524 TTGCAACTTCAGACTCAGGAAGG + Intergenic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1003127362 6:3366023-3366045 TGTCAGCATCAGAAAGAGAAGGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006264170 6:32903355-32903377 TTGCATCATCACACAGAGGAAGG - Intergenic
1006686016 6:35834888-35834910 TGCCAGCATAAGGATGAGGAGGG - Exonic
1007221932 6:40285630-40285652 TGGCAGGATCAGATTGAGGTTGG + Intergenic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1009806697 6:68608510-68608532 TTGTAGTATCAGATGGAGGAAGG + Intergenic
1011135323 6:84093771-84093793 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1012182137 6:96167404-96167426 TTGCAGCATCACAAGGTGGAGGG + Intronic
1014966640 6:127761486-127761508 TTTTAGCATTAAAATGAGGAAGG - Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1016034762 6:139374281-139374303 GTGCAACAACAGGATGAGGAGGG - Intronic
1016283630 6:142448338-142448360 TGGGATCATCAGAATGAAGAGGG + Intergenic
1020567899 7:9821065-9821087 TGGCAGGTTAAGAATGAGGATGG - Intergenic
1020689847 7:11340341-11340363 TTACAGAATCATAATGAGCAAGG + Intergenic
1021285225 7:18772464-18772486 TTACATCAGCAGAAAGAGGAGGG + Intronic
1022107486 7:27206948-27206970 TTGCTGCATCAGAATTATGGAGG + Intergenic
1023806379 7:43875818-43875840 TAGCAGCATCTGTCTGAGGAGGG - Intronic
1025186348 7:56862656-56862678 TTGCAGCAACCAAAGGAGGAGGG - Intergenic
1025685574 7:63714242-63714264 TTGCAGCAACCAAAGGAGGAGGG + Intergenic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1031875881 7:127140543-127140565 TAACAGCACCAGAATGAGAAGGG - Intronic
1038434508 8:27525775-27525797 TTTCAGCCAGAGAATGAGGAGGG - Intronic
1038939542 8:32288720-32288742 TTGCATCGTCAGCGTGAGGAAGG + Intronic
1039118236 8:34116255-34116277 TGGCACCATGAGAAGGAGGAAGG + Intergenic
1039201661 8:35101341-35101363 TTAGAGCCTCAGAAGGAGGACGG - Intergenic
1039208294 8:35182250-35182272 TTGCAGACTCAGAATGGGGGAGG + Intergenic
1041489283 8:58413646-58413668 TGTCAGCATCTGAATCAGGAGGG + Intronic
1041560719 8:59215302-59215324 TTGCAGCAGCAGTCTGGGGAGGG + Intergenic
1041802193 8:61812444-61812466 CAGCAGCATCAGAAAGAGGGTGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1047805593 8:128356164-128356186 TTTCATGGTCAGAATGAGGAAGG + Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048172270 8:132118712-132118734 TTGCTTCATCAAAATGAGCAAGG - Intergenic
1049480971 8:142822492-142822514 TTTTAGCATTAAAATGAGGAAGG + Intergenic
1050405926 9:5308746-5308768 TTGCAGGAGCAGAGTGAGGGAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050852396 9:10303918-10303940 TTTCAGCATCAGGATGATGCTGG - Intronic
1053118802 9:35529735-35529757 TTCCATCCTCAGAATGAGCATGG + Intronic
1056368941 9:85935097-85935119 TTCCAGTATCAGGCTGAGGAGGG + Intergenic
1056795458 9:89655781-89655803 CTGCAGCATCACAACAAGGAGGG + Intergenic
1059434500 9:114267902-114267924 TTCCAACAGCAGAATGGGGAGGG - Intronic
1059997196 9:119923212-119923234 TAGTATCATGAGAATGAGGATGG + Intergenic
1060198938 9:121640622-121640644 GTTCAGCATCAGAGTCAGGAGGG + Intronic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1188003292 X:25001638-25001660 TTGCAGCATCAGAATGACATAGG + Intergenic
1188389455 X:29601749-29601771 TTCCAGAATAAGAAAGAGGATGG + Intronic
1189276844 X:39792749-39792771 CTACAGCATCTGAGTGAGGAAGG + Intergenic
1189995442 X:46633010-46633032 ATCCTGCCTCAGAATGAGGAAGG - Intronic
1190408969 X:50115665-50115687 GGGTAGCTTCAGAATGAGGATGG - Intergenic
1192265650 X:69535834-69535856 TTGCAGCCTCAGCATGGGCAAGG + Intergenic
1192298837 X:69879539-69879561 TGGCAGCATCAGCATTAGCAGGG - Intronic
1196002790 X:110804709-110804731 AAGCAGCATCAGAATCTGGAAGG + Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198224617 X:134633733-134633755 TTCCAACATCAGGATGTGGATGG - Intronic
1198382985 X:136101546-136101568 TTGCAGCCTGTGGATGAGGATGG + Intergenic
1199865216 X:151841198-151841220 TTACAGTCTCAGAATGGGGAAGG + Intergenic
1202351630 Y:23998630-23998652 TTTTAGCATCAGAATGATGCTGG - Intergenic
1202519149 Y:25671489-25671511 TTTTAGCATCAGAATGATGCTGG + Intergenic