ID: 921562774

View in Genome Browser
Species Human (GRCh38)
Location 1:216678466-216678488
Sequence TGGCAAAAAGAAGTGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 786
Summary {0: 1, 1: 0, 2: 7, 3: 89, 4: 689}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921562774_921562780 1 Left 921562774 1:216678466-216678488 CCTTCCCCCACTTCTTTTTGCCA 0: 1
1: 0
2: 7
3: 89
4: 689
Right 921562780 1:216678490-216678512 TTAACATTATACCTCCTAAAAGG 0: 1
1: 0
2: 0
3: 15
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921562774 Original CRISPR TGGCAAAAAGAAGTGGGGGA AGG (reversed) Intronic
900035355 1:403186-403208 GGACAGAAAGAAGTGGGAGAAGG + Intergenic
902782460 1:18713217-18713239 TGGTATAAACAAGTGGGGAAGGG + Intronic
902962475 1:19974649-19974671 GTGCAAAATGAAGTGTGGGAAGG + Intergenic
903279810 1:22244034-22244056 TGGCCAAAAGGACTGGGGCAGGG - Intergenic
903353147 1:22730313-22730335 TGCCCACAAGAAGTGGGGGAAGG - Intronic
903865209 1:26392776-26392798 GGGTAAAAAGAAGTGGGTGGGGG + Intergenic
903967423 1:27099399-27099421 AGGCAGAGAGACGTGGGGGAGGG + Exonic
904686243 1:32262843-32262865 TGAAAGAAAGAAGTGGAGGAAGG + Intronic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
906061012 1:42948528-42948550 CGGCTCAAAGGAGTGGGGGAGGG + Intronic
906201215 1:43961503-43961525 TGGAAGAAGGAAGTGGGGGTGGG + Intronic
906513514 1:46424660-46424682 TGGCAGAGAGAAGGGCGGGAAGG + Intergenic
906994045 1:50770984-50771006 TGACAAAAACAAATGGGGAAAGG + Intronic
907049375 1:51319325-51319347 TGGGAAAAAGGAGAGGGAGAGGG + Intronic
907451271 1:54547415-54547437 TGGCTAAGGGAAGTGGGGGGTGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907661221 1:56394358-56394380 TGGCAAAGAGGAGCCGGGGATGG - Intergenic
907745894 1:57213175-57213197 AGGTACAAAGAAATGGGGGATGG + Intronic
907964415 1:59315405-59315427 TGGGGGAAAGAAGTGGGGGAAGG - Intronic
908260163 1:62334128-62334150 TCTCAAAAAAAAGTGGGGGGGGG + Intergenic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
909471930 1:76039120-76039142 TGGAAAAAAAAAGCGGGGAATGG - Intergenic
909856700 1:80542780-80542802 AGGCAAAAAGAACAAGGGGATGG - Intergenic
909899172 1:81110835-81110857 TGCCAAAATGGAATGGGGGAGGG + Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910616954 1:89208955-89208977 GGGGAAAAATAAGTGGGAGATGG - Intergenic
910826069 1:91408572-91408594 GGGAAAAAAGAAGGGAGGGAGGG - Intergenic
911143995 1:94535108-94535130 TGGTGAAAAGAAGGGGTGGACGG - Intronic
911253830 1:95611199-95611221 TACCAAAGAGAAGTGGGTGAAGG - Intergenic
911286715 1:96003375-96003397 AGGAACACAGAAGTGGGGGAAGG - Intergenic
911470963 1:98317630-98317652 TGGGAAAAAGAGGGGGTGGAGGG - Intergenic
912103654 1:106243427-106243449 TGGCAAAAAGCAGTGTTGGCAGG + Intergenic
912420729 1:109540593-109540615 TGGAAGTAAGTAGTGGGGGAAGG + Intronic
912901689 1:113657433-113657455 TGGTAAAAAGAATTGGTGCATGG - Intronic
913044738 1:115064236-115064258 GGTCAAATAGAAGTGTGGGATGG - Intronic
914415445 1:147477172-147477194 TTACAAAAAGAAGTTGAGGATGG - Intergenic
915777239 1:158502969-158502991 TGGCAAAAGGTAGTGGGAGCAGG + Intergenic
916414394 1:164578960-164578982 TGGCAAATAGCAATGGGGGCGGG - Intronic
916487963 1:165276051-165276073 TGGCAGGAAGAAGAGGGGGAGGG + Intronic
916667711 1:166981571-166981593 TAGGAAAATTAAGTGGGGGAGGG + Intronic
917255086 1:173106727-173106749 TAGCACAAAGAAGAGGTGGAGGG - Intergenic
917364635 1:174216554-174216576 TGGCAAAAAAAAAAAGGGGAGGG - Intronic
917389772 1:174522524-174522546 AAGAAAAAAGAAGAGGGGGAAGG + Intronic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917706928 1:177644259-177644281 AGGCAAAAAGAAGTGATGTAGGG - Intergenic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
917760259 1:178149007-178149029 AGGAAAAAAGAAGGGAGGGAAGG - Intronic
917910408 1:179638717-179638739 GGGGAAAAAGAAGTGGGGGATGG + Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919105319 1:193142671-193142693 AGGGAAAAGGAAGTGAGGGAAGG - Intronic
919457652 1:197838960-197838982 TGGCAAAATAAAGAGGGGGATGG - Intergenic
919531171 1:198723039-198723061 TGGCAAACAGAATTGTGGGTGGG - Intronic
919921000 1:202166329-202166351 CGGGGAAAAGAAGTGGGGGAAGG + Intergenic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920227729 1:204450444-204450466 CAGCAGCAAGAAGTGGGGGAGGG - Intronic
920324034 1:205147499-205147521 TGGCCAAAAGGTGAGGGGGAAGG + Exonic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920807957 1:209252790-209252812 TGGCAGAAAGAGCTGGGGGCTGG + Intergenic
921216304 1:212939818-212939840 GGGGAAAAAAAAGTGTGGGATGG - Intergenic
921562774 1:216678466-216678488 TGGCAAAAAGAAGTGGGGGAAGG - Intronic
921938445 1:220816019-220816041 AGGCAGAAAGAAATTGGGGAAGG + Exonic
922238073 1:223736368-223736390 AGACAAAAAGATGTGTGGGAAGG + Intronic
922257889 1:223908745-223908767 GGACAGAAAGAAGTGGGAGAAGG + Intergenic
922818527 1:228468735-228468757 AGGAAAAAAGAAGAGAGGGAAGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923031228 1:230250428-230250450 AGGCAGAAAGAAGAGGGGGGAGG - Intronic
923399614 1:233603662-233603684 TGGCAAAAAGGTGGGGGGCAGGG - Intergenic
923446295 1:234074519-234074541 TGGAAAGATGAAGTGGGGGAGGG + Intronic
923731736 1:236557810-236557832 AGTCAAAAAGCAGTGGGTGAAGG - Intronic
924339086 1:243011520-243011542 GGACAGAAAGAAGTGGGAGAAGG + Intergenic
924398450 1:243650665-243650687 TGACAAAAAGCAATGGGGAAAGG - Intronic
924418399 1:243883449-243883471 TGTCACAAAGATGTTGGGGACGG + Intergenic
924583600 1:245342715-245342737 TGGCAAGAAGAAGGGGAGGGAGG + Intronic
924594063 1:245429973-245429995 GGGAAAAAAGAAGATGGGGAGGG + Intronic
1064158970 10:12927247-12927269 TAGCAAAAAGTAGTTGGGGAAGG - Intronic
1064441124 10:15354492-15354514 TCTCAAAAAAAAGTGGTGGACGG + Intronic
1064987910 10:21229417-21229439 TCTCAGAAAAAAGTGGGGGAGGG + Intergenic
1065473267 10:26105344-26105366 TGGCAGGAATGAGTGGGGGAAGG - Intronic
1066589369 10:36977102-36977124 TGAAAAAAAGAAGTAGGGGCGGG + Intergenic
1066780543 10:38941844-38941866 TGGCAAAAAGCAGCGGCGGCAGG - Intergenic
1066780757 10:38942735-38942757 TGGCAAAAAGCGGTGGTGGCAGG - Intergenic
1067519369 10:46984754-46984776 TGGAAAAGAGAGGTGGGGCAGGG + Intronic
1067642878 10:48067085-48067107 TGGAAAAGAGAGGTGGGGCAGGG - Intergenic
1067921673 10:50464804-50464826 TGGAACAAAGAAGGGGAGGAGGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068802987 10:61162867-61162889 TGGCAACAAGACCTGGGGGCCGG + Intergenic
1068887686 10:62114495-62114517 TGGGAAGAAGAAGTGGAGCAGGG + Intergenic
1069734980 10:70648103-70648125 TGGCCAAGAGAAATGGAGGAGGG + Intergenic
1070340653 10:75495252-75495274 TGGAAAACAGAAGGGAGGGAGGG - Intronic
1070897365 10:79996219-79996241 TGGCTACAAGCAGTGGGGGTGGG + Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1072365439 10:94704023-94704045 TGGCAAACAGAAGCAGGGTAGGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072894938 10:99358755-99358777 TGGCAGGCAGAGGTGGGGGAGGG - Intronic
1073809466 10:107136860-107136882 TTGCAAAAGGAAGCAGGGGACGG - Intronic
1073977543 10:109118070-109118092 TGGGGAACAGAAGAGGGGGATGG - Intergenic
1074662832 10:115681808-115681830 TCTCAAAAAGAAGTGGTGGGTGG - Intronic
1074761221 10:116668851-116668873 TGGCTGTCAGAAGTGGGGGATGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077437572 11:2550185-2550207 CGGCAAAGAGAGGCGGGGGAGGG - Intronic
1077485721 11:2837604-2837626 GGGCAGACAGAGGTGGGGGATGG + Intronic
1077552332 11:3206200-3206222 TGCCCAACACAAGTGGGGGAGGG - Intergenic
1078360679 11:10665347-10665369 TAGTAAAAAGAAGTGGGGACAGG - Intronic
1078619217 11:12892286-12892308 TGGAAGAAAGAAGAGGGGGATGG + Intronic
1078860384 11:15241080-15241102 TAGCAAAAAGAAGTTGGGTGGGG - Intronic
1078953344 11:16161053-16161075 TTCAAAAAAAAAGTGGGGGAGGG + Intronic
1079496467 11:21050269-21050291 TGTTAAAAAAAAGTGGGGGGCGG - Intronic
1079613180 11:22458164-22458186 GGGCAGAAAGAAGTGAAGGAAGG - Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079784240 11:24650992-24651014 TGACAAGAAGAAGCAGGGGAAGG - Intronic
1080195789 11:29607108-29607130 TGACAAAAAGAACTGGTGTATGG - Intergenic
1080479060 11:32626705-32626727 TGACAAAAAGAAATGGGGAAAGG + Intronic
1080790340 11:35516953-35516975 GGGAAAAAAGAGGTGGGAGAAGG + Intronic
1080907725 11:36563313-36563335 TAGAACAAAGAAGTGGAGGAAGG + Intronic
1082083483 11:48030154-48030176 TGGGATTAAGAAGTGGGGGCAGG + Intronic
1082800924 11:57414349-57414371 AGACAAAAATTAGTGGGGGATGG + Intronic
1083089421 11:60184712-60184734 TGGAAAAAAAAAGAGGGGGGAGG - Intergenic
1084321175 11:68374107-68374129 AAACAAAAAGAAGTCGGGGATGG + Intronic
1084563671 11:69918024-69918046 TGACAAGAAGAAGCGGGGGGGGG - Intergenic
1084596775 11:70121194-70121216 GGACAGAGAGAAGTGGGGGAGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1084990084 11:72914615-72914637 TGACAAAAAGCAATGGGGAAAGG + Intronic
1085255836 11:75172469-75172491 GGGGAAGAAGAAGTAGGGGATGG - Exonic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085898705 11:80670847-80670869 TGAAAAAAAGAAGTTGGGGAGGG - Intergenic
1085984786 11:81772394-81772416 AGCCAAAAAAAAGTGGGGGAGGG - Intergenic
1086442661 11:86844589-86844611 AGGCAGAAAGAAATGGGGGCAGG - Intronic
1086515872 11:87612804-87612826 TTCCAAAAATAAGTGGAGGAGGG - Intergenic
1086576994 11:88349855-88349877 TGGCAAGAAAAAGGGGGGAAAGG - Intergenic
1086611102 11:88757252-88757274 TGGCAAAATGATGTGGAGGGTGG - Intronic
1086727401 11:90204710-90204732 AGAAAAAAAAAAGTGGGGGAGGG + Intronic
1088095935 11:106101579-106101601 TTGCAAATAGAGGTGGGGGAGGG + Intergenic
1088272397 11:108047933-108047955 TGGCAAAAAAAAGTAGGGGAGGG + Intronic
1088436064 11:109814443-109814465 TGGAAAAAAGAAATGAAGGAAGG - Intergenic
1088560824 11:111114380-111114402 TGAAAAAAAGAAGATGGGGAGGG + Intergenic
1088606439 11:111538044-111538066 TAGCCAAAAGAAGTGGAGAATGG + Intergenic
1088828718 11:113517125-113517147 TGGCAACAAGAAGAGAGGGAGGG + Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088898784 11:114098835-114098857 GGGGAAAAGGAAATGGGGGAGGG + Intronic
1089030708 11:115325351-115325373 TGCCAAAAAGAAGTGGTGGGGGG + Intronic
1089755240 11:120681480-120681502 GGGCAAAATGAAGAGAGGGAGGG - Intronic
1090444871 11:126755646-126755668 TGGCAACAAGAATTGGGGGCGGG - Intronic
1090503063 11:127280680-127280702 TGACAAAAAGAACTTGGGGGTGG + Intergenic
1090709311 11:129371843-129371865 TGGGAAAAAGAAAAGGGAGATGG + Intergenic
1090867011 11:130709960-130709982 TTGCAAAAAGAAGAGGGTGGTGG - Intronic
1091416820 12:295127-295149 TGCTAAAAAGAAGCGGGGAAGGG - Intronic
1091417581 12:302401-302423 TGACAAAAAGAAATGGGGAAAGG + Intronic
1092051117 12:5470980-5471002 TGCCAAAAGGAAGGGTGGGAAGG - Intronic
1092816831 12:12319612-12319634 TGGCACGAGGAAGTGGGAGATGG - Intergenic
1092829474 12:12429806-12429828 TCGCAGAATGAAGTGGAGGAAGG - Intronic
1092980970 12:13793836-13793858 TGGAAGAAGGAAGTGGGAGAGGG + Intronic
1092999511 12:13981636-13981658 TCTCAAAAAGAGGTGGGGGGTGG + Intergenic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093397526 12:18701655-18701677 TGGGAAGAAGAAGTGGCAGATGG - Intronic
1093460526 12:19403398-19403420 TGGCAAAACCAGGTGGGGGCTGG + Intergenic
1093989372 12:25572810-25572832 TGGCAGAAGGAAGGGAGGGAGGG - Intronic
1094356701 12:29585701-29585723 TGACAAAAAGCAATGGGGAAAGG - Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095198076 12:39347233-39347255 TGGCAAAAAAAAAAGGGGGGTGG + Intronic
1095622119 12:44269461-44269483 TTGCAAAAAGTAGTCTGGGAGGG - Intronic
1095691010 12:45088455-45088477 GGGCAAAAAGGAATGGGTGAAGG + Intergenic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1097332736 12:58349901-58349923 TGGCAAAAAAAAGTAGTGGGTGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1097884071 12:64711542-64711564 TGGGAAAGAGAAGTGGGTGCTGG - Intergenic
1098240905 12:68466005-68466027 AAGCAAAAAGAAAAGGGGGAGGG + Intergenic
1100773549 12:97950114-97950136 TGGGAAACAGGGGTGGGGGATGG + Intergenic
1101019468 12:100538529-100538551 TGGCAAAAAGAATTTGAGGCTGG - Intronic
1101343622 12:103864949-103864971 TGGCAAAAGGTAGTTGGGTAAGG - Intergenic
1101643445 12:106605924-106605946 AGGCTACAAGAAGTGGGAGAGGG - Intronic
1102520051 12:113472376-113472398 TGACAAAAAGAAGCCGGGGCCGG - Intergenic
1102895712 12:116596718-116596740 TAGCAAAAAGAAAAGGGGAAGGG + Intergenic
1103051863 12:117787109-117787131 TGGCAGAGAGTAGTGGGGTAGGG - Intronic
1103184537 12:118945106-118945128 TGTCAGAAAGAATTAGGGGAGGG - Intergenic
1103344031 12:120237600-120237622 TGCTGAGAAGAAGTGGGGGAGGG + Intronic
1104733689 12:131122950-131122972 TGACAACAAGGAGTGGGGTAGGG - Intronic
1105035992 12:132921427-132921449 TGGCAAAATAAAGGGGGGCATGG + Intronic
1105450168 13:20492576-20492598 TGGCAGAAACAGGTGGGGCAGGG - Intronic
1105601597 13:21892880-21892902 TTGCAACAAGAATTGGGGGCCGG + Intergenic
1105683281 13:22751951-22751973 TGGCAAGAAGAAGTGGTCGGTGG - Intergenic
1106009185 13:25801572-25801594 TGGCAAGAAGAAGAAGGAGAAGG - Intronic
1106082839 13:26514782-26514804 TCAAAAAAAAAAGTGGGGGAGGG + Intergenic
1106362649 13:29046718-29046740 GGACAAAAGGAGGTGGGGGAGGG - Intronic
1106417188 13:29555659-29555681 TGGAAAAAAAAAGGGGGGGCGGG + Intronic
1107518133 13:41151909-41151931 TGGCAAAAACAAGTTATGGAAGG - Intergenic
1107971918 13:45651424-45651446 AGGCAAAAAGAAGGGAGAGAGGG - Intergenic
1108557253 13:51606010-51606032 TGGCAAAAGGCAGTGTTGGATGG + Intronic
1108811846 13:54235461-54235483 TGGCAAAAAGAAGGCAGAGAGGG - Intergenic
1108866190 13:54925423-54925445 TGGGAAAAAGAAGTGTGGTTGGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1110244516 13:73306856-73306878 TGGCAAAAAGAAGTGAGCTCTGG - Intergenic
1110397561 13:75049328-75049350 GAGCAGAAAGAAGTTGGGGAGGG + Intergenic
1110608520 13:77461996-77462018 AGGAAAGAAGAAGTAGGGGAGGG - Intergenic
1110677507 13:78266866-78266888 TGGCAAAAGGAGGTGCAGGAAGG + Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111947493 13:94681218-94681240 GGGAAAAAAGCAGTGGAGGATGG + Intergenic
1112474712 13:99720972-99720994 TGGCACAGAGAAGTAGGAGATGG - Intronic
1112682977 13:101788178-101788200 AGGAAAAAAAAAGTGGAGGAGGG - Intronic
1114027782 14:18544334-18544356 GGGCACAAAGAAGTGGGAAATGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115747359 14:36451316-36451338 TGGCAAAAAGACATGGGGTATGG - Intergenic
1117140211 14:52782981-52783003 TGTCTAAAAGAAGAGGGGCAGGG + Intronic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117494866 14:56293165-56293187 TGCTAATAAGAAGTGGTGGATGG + Intronic
1117511802 14:56459281-56459303 TGACAAAAACAAATGGGGAAAGG + Intergenic
1118201247 14:63675851-63675873 TAAAAAAAAAAAGTGGGGGAGGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119161475 14:72456252-72456274 TGGGAAAAAGAAGGGAGAGAGGG - Intronic
1119237430 14:73031284-73031306 CGGAAAAGAGATGTGGGGGAGGG - Intergenic
1119507665 14:75186882-75186904 TGGGAGAAAGAGGTGGGGTAAGG + Intergenic
1121208016 14:92185684-92185706 TGAGAAAAAGAAGGGAGGGAGGG + Intergenic
1121222133 14:92293992-92294014 TGGCAAAGAGAAATAAGGGAAGG + Intergenic
1121782010 14:96627997-96628019 TAGCAGGAAGAAGTGGGTGAAGG + Intergenic
1122129816 14:99598531-99598553 TGGCATGGAGGAGTGGGGGAAGG - Intronic
1122301844 14:100735859-100735881 GGGCAAAGAGGGGTGGGGGAGGG - Exonic
1122662112 14:103303390-103303412 AGGCAATTAGAAGCGGGGGAAGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123170132 14:106365093-106365115 TGAGAAAAAGAAGGAGGGGATGG - Intergenic
1125223659 15:37369333-37369355 GGGCAAAAAGATGGGGTGGAGGG + Intergenic
1125274630 15:37977892-37977914 TGGCAACAAATAGTGGGGGCAGG + Intergenic
1125518731 15:40336820-40336842 GGGACAAAAGAAGTGGGGAAAGG + Intronic
1125711561 15:41791182-41791204 TGGGATTGAGAAGTGGGGGAAGG + Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127659650 15:61088457-61088479 AAGCAAAAAGCGGTGGGGGATGG + Intronic
1127819198 15:62640367-62640389 AGGCAGAGAGAAGAGGGGGACGG + Intronic
1128085305 15:64882383-64882405 TGGCTAAACGAAGGGAGGGAGGG - Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1128426393 15:67545748-67545770 TGTGAAAAAAAAGTTGGGGAGGG + Intronic
1128581951 15:68817281-68817303 AGGCAAAAATAAAAGGGGGAAGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1129867200 15:78918219-78918241 TCTCAAAAAAAAGAGGGGGAGGG - Intergenic
1130090696 15:80818807-80818829 TGGGAACAAGAAGTGGGGAGTGG + Intronic
1130913843 15:88289779-88289801 TGGCAAAGAGAAGGGGGGGGGGG - Intergenic
1130924094 15:88372283-88372305 TGGCAAAGAAAAGTAGGGAAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132046073 15:98563766-98563788 TGGCCAAAAGACCTGGGGCAAGG - Intergenic
1133733140 16:8593113-8593135 TGGCAAGAAGAAGAGGAAGAGGG - Intergenic
1137783381 16:51116333-51116355 AGACAACAAGCAGTGGGGGAGGG - Intergenic
1139200730 16:64974085-64974107 TGGCAAAGTGAGGTGGGAGATGG + Intronic
1140020409 16:71233049-71233071 TCTCAAAAAAAAGGGGGGGAGGG + Intergenic
1141660198 16:85437276-85437298 CCCCCAAAAGAAGTGGGGGAGGG + Intergenic
1141865920 16:86749698-86749720 TGGAAAAATAAAGTGGGGGTTGG - Intergenic
1142224723 16:88871887-88871909 TGGAAACAAGGAGTGGGAGAGGG + Intergenic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1142870409 17:2816116-2816138 TGGTAAAAATAGGCGGGGGAGGG + Intronic
1143267640 17:5652385-5652407 TGGCAAAAAGGAGAGAGGAAAGG - Intergenic
1143395516 17:6592339-6592361 AGACAAAAGGAAATGGGGGATGG - Intronic
1143554291 17:7651105-7651127 AGGCAGAGAGAGGTGGGGGAGGG - Exonic
1144059392 17:11568899-11568921 TGGCAAAAGGAAAGGGGGGTGGG - Intergenic
1144097831 17:11917803-11917825 TGACAAAAAGATGTGAAGGAAGG - Intronic
1144115327 17:12084121-12084143 TGGCAAAATAAATTTGGGGAAGG - Intronic
1144217583 17:13069973-13069995 TCGCAGGAAGAAGTGGTGGAGGG + Intergenic
1144819170 17:18059411-18059433 TGGGAAAAGGATGTGGTGGAGGG - Intronic
1144883827 17:18444922-18444944 TTTTAAAAAGAAGTGGGGAAGGG - Intergenic
1145070458 17:19801275-19801297 TCTCAAAAAGAAGTTGGGGCCGG + Intronic
1145074258 17:19838191-19838213 GGGAATAAAGAAGTGGGGGTGGG - Intronic
1145148405 17:20499455-20499477 TTTTAAAAAGAAGTGGGGAAGGG + Intergenic
1146229694 17:31096133-31096155 TGGCAAAAAAAAAAGGGGGGGGG - Intronic
1146248211 17:31310413-31310435 AGGCAAAATGAAGTTGGGGGTGG + Intronic
1146269136 17:31473044-31473066 AAGAAAAAAGAAGTGAGGGATGG + Intronic
1146375836 17:32293804-32293826 AAGCAAACAGAAGTGGGTGAGGG + Intronic
1147119100 17:38325101-38325123 TGGCAAAGGGAGGTGGGAGAGGG - Intergenic
1147136627 17:38437784-38437806 TGGCATAACGAAGGGGGGGGAGG + Intronic
1147757748 17:42780006-42780028 TGGCAAACAGAAGGGGAGGAAGG + Intergenic
1147991879 17:44338952-44338974 GGGGAAAAAGAGGTGGGGGTGGG + Intergenic
1148183482 17:45623786-45623808 TGGAAAATAGAAGTGGGGAGAGG + Intergenic
1148208124 17:45792264-45792286 TGGCAGAAAGAGGAAGGGGAAGG - Intronic
1148253556 17:46107784-46107806 TGGCATATAGGAGTTGGGGAGGG - Intronic
1148395001 17:47300781-47300803 TGGGAAGCAGAAGTGGTGGATGG - Intronic
1148422336 17:47558427-47558449 TCAAAAAAAAAAGTGGGGGATGG - Intronic
1148492003 17:48029226-48029248 TGGCAAGGAGAAGGGGCGGAGGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1150922029 17:69494195-69494217 AGGCAAAAAGAAATGGAGGGAGG + Intronic
1151118432 17:71765623-71765645 TGACAAGAGAAAGTGGGGGATGG - Intergenic
1151171779 17:72252677-72252699 TAACCAAAAGAAGTGGGGGGTGG + Intergenic
1151175491 17:72284509-72284531 TGCCAAAAAGGAGTCGGGGGAGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1152630634 17:81409332-81409354 TGGGAGACAGAAGTGGGGGTGGG + Intronic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1152946144 17:83198656-83198678 AGGCAAGAAGAAGCGGGGGTGGG - Intergenic
1153269976 18:3310749-3310771 TGGAAAAGAGGAGTGAGGGAGGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153478092 18:5518440-5518462 GGGCAGAATGAAGTGGGGCAAGG - Intronic
1153706007 18:7746802-7746824 TGGTAAAAAGAAATGTGGAAAGG - Intronic
1155278907 18:24218011-24218033 TGGCAAGAAAAAATGGGGGAGGG + Intronic
1155672515 18:28388671-28388693 TGGCAACAGGAAGTGGGGAGCGG - Intergenic
1155762131 18:29581780-29581802 TGTCAAAAAAAAGGGGGGGCGGG + Intergenic
1156036241 18:32770636-32770658 TGGCAGACAGGGGTGGGGGATGG + Intronic
1157139533 18:45091885-45091907 TGGCCTAGAGAAGTGGAGGAGGG - Intergenic
1157242611 18:46025180-46025202 TGACAAAAAGCAGTGGGGAGAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1157475550 18:48021249-48021271 TGGAAAAAAGAAGAAAGGGAGGG - Intergenic
1157713266 18:49864448-49864470 TGGACAAAAGAAGGGGAGGAGGG - Intronic
1157839737 18:50945478-50945500 TAGGAAAAAGAAGTAGGGAAGGG - Intronic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158075421 18:53522647-53522669 TGGCAAAAAGCACCGGGGAAAGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158308039 18:56127997-56128019 TGGCAACAAGAGGTGGAGGATGG - Intergenic
1158757772 18:60347492-60347514 TGGCAGAAAGAAGGTGGGGATGG + Intergenic
1159538342 18:69743707-69743729 AAGCAAAAAGAAGTGTGGGGGGG + Intronic
1160232647 18:77059870-77059892 TGGGATAAAGAAGTGTGGCATGG + Intronic
1162278019 19:9673760-9673782 TGTCAAAAATAAGTGGCGGGTGG + Intronic
1162787797 19:13046466-13046488 AGGCAAAAAAAAGAGGGGGGGGG - Intronic
1164897176 19:31886941-31886963 TGGCCCAAAGAAATGGGAGAAGG - Intergenic
1165375104 19:35436326-35436348 GGAAAAAAAAAAGTGGGGGAAGG + Intergenic
1167383861 19:49152992-49153014 TGGCAAAGAGAGTCGGGGGAAGG - Intronic
1167640266 19:50677897-50677919 TGGCTGAAGGAGGTGGGGGAGGG - Intronic
1167694246 19:51004943-51004965 TGGTAAACAGAAGTCGGGGACGG + Intronic
1167869090 19:52352649-52352671 AGGAAAAAAAAAGTGGGGGTAGG - Intronic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168484744 19:56751411-56751433 TGGAAACAGGCAGTGGGGGAGGG + Intergenic
925376584 2:3389993-3390015 TGGAAAAAACCAGTTGGGGAAGG + Intronic
925663447 2:6226921-6226943 TGGCAACAAGAAAATGGGGATGG - Intergenic
925803948 2:7630024-7630046 TGTAAAATAGAAATGGGGGAGGG + Intergenic
926623950 2:15074324-15074346 TGGAAAGAAGAAGGGAGGGAGGG + Intergenic
927583481 2:24277181-24277203 TGGAGGAAAGAAGTGGGGGCGGG + Intronic
927652818 2:24922548-24922570 TCTCAAAAAAAAGTGGGGGTTGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928002615 2:27538020-27538042 TGGAAAAAAGATGTGGGAAAGGG + Intronic
928032399 2:27792707-27792729 GGGCAAGAAGGAGTGGGAGAAGG - Intronic
928136610 2:28692758-28692780 TGGCATAAAGAAGGGAGGAAAGG - Intergenic
929483621 2:42336162-42336184 TGGCCACAGGAAGTGAGGGATGG - Intronic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929644395 2:43612333-43612355 AGGCAGAAAGAAGTGAGGCAAGG - Intergenic
929884145 2:45863488-45863510 GGGCAAGAAGAAGGGAGGGAGGG - Intronic
930264970 2:49189123-49189145 TGGAGAAAACAAGTGGGGGAGGG - Intergenic
930360055 2:50366683-50366705 TGGCAAAAAATAGTGGGGTGGGG - Intronic
930551599 2:52841493-52841515 AGGGAAAAAAAAGTGAGGGATGG - Intergenic
930641150 2:53855642-53855664 AGGCTAAGAGAAGTGGGGGTAGG + Intronic
930772302 2:55140549-55140571 AAGCAAAAAGAAGTGGGGAGAGG + Intergenic
930774493 2:55158987-55159009 TGGCAAAAAAGAGTGGGGCTTGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931152095 2:59585689-59585711 GGGAAAAAAGAAAAGGGGGAGGG - Intergenic
931414283 2:62066222-62066244 GGGAAAAAAAAAGTGGGGTAGGG - Intronic
931815333 2:65895130-65895152 TGACAAAAAGCAATGGGGAAAGG + Intergenic
931853238 2:66275057-66275079 TGTAAAAAAAAAGTGGGGGTAGG - Intergenic
931941029 2:67252583-67252605 TGGTTAAAAGAAGGAGGGGATGG - Intergenic
932115018 2:69038114-69038136 TGGAAAAAAGAAAAGGGGAATGG - Intronic
932533767 2:72568771-72568793 TGGCAAGAAGAAGGGGGTAAAGG + Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
933010095 2:77050689-77050711 TAGCAAAAAGAAATAGGTGAAGG - Intronic
933126973 2:78620943-78620965 TGATAAAAAGAAATGGGGAAAGG - Intergenic
934098337 2:88627668-88627690 AGGTAAAAAGACGTCGGGGAAGG - Intergenic
934154485 2:89183448-89183470 TGACAAAAACAAATGGGGAAAGG + Intergenic
934212751 2:89998492-89998514 TGACAAAAACAAATGGGGAAAGG - Intergenic
934331417 2:92073283-92073305 GGGCAAAAAGCAGTGGGAGCGGG - Intergenic
935870175 2:107439440-107439462 GGCCAAAAAAAAGTGGGGGCGGG - Intergenic
936407765 2:112222374-112222396 TGGCTACAAGAGGTGGGGGGAGG + Intronic
936562125 2:113549152-113549174 TGGAAGAAAGAAGGGAGGGAGGG + Intergenic
937221418 2:120344940-120344962 TGGCAGAAAAAAGGGGGGGAGGG - Intergenic
937541913 2:122966140-122966162 TGGCCTGAAGCAGTGGGGGAAGG - Intergenic
938299683 2:130201183-130201205 TGGCAAAAGGAGGAGGGGCAGGG + Intergenic
938457025 2:131473303-131473325 TGGCAAAAGGAGGAGGGGCAGGG - Intronic
938466144 2:131526923-131526945 TGGCAGTAAGATGTGGGGAAAGG + Intergenic
938701048 2:133880100-133880122 TGGCAATAAAATGTGAGGGAGGG - Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939494109 2:142907501-142907523 TGGCAAATAGCAGTTGTGGATGG + Intronic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941032287 2:160526280-160526302 TGACAAAAAGAAATGGGGAAAGG - Intergenic
942600289 2:177634209-177634231 TGGAATAAAGAAATTGGGGAGGG + Intronic
942636670 2:178014920-178014942 TCCCAAAAAGATGTGGGGTATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
943094585 2:183413311-183413333 TGGTAATAGGAAGTGGGGGTGGG + Intergenic
943544338 2:189256177-189256199 AGGCAAAAAGAAGTTTGTGAAGG + Intergenic
943694440 2:190909474-190909496 TGGTTACCAGAAGTGGGGGAGGG - Intronic
943963589 2:194300335-194300357 AAGCAAAAAGAGGTAGGGGAAGG - Intergenic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945875312 2:215272166-215272188 TGGCAATAGGAAGTGGGGTGTGG - Intergenic
946103736 2:217351502-217351524 TGGCAAAGATATGTGGGGGGTGG + Intronic
946350331 2:219146897-219146919 GGGCAAAAAGTAGTGGGAGAGGG + Intronic
946759829 2:222982657-222982679 TCGCAAATGGGAGTGGGGGAAGG - Intergenic
948132541 2:235611138-235611160 TGGCAAAATGAAGTGAGAGGTGG - Intronic
948244033 2:236462929-236462951 TTTTAAAAAGCAGTGGGGGAGGG - Intronic
949086313 2:242158731-242158753 GGACAGAAAGAAGTGGGAGAAGG - Intergenic
1168836589 20:881691-881713 TGGCACAGAGAAGGTGGGGAAGG + Intronic
1169386697 20:5156019-5156041 AGGCAAAAATGAATGGGGGAGGG + Intronic
1169543897 20:6631026-6631048 TGGCAATTAGGAGTAGGGGATGG - Intergenic
1169694390 20:8370609-8370631 GGAAAAAAAGAAGTTGGGGAGGG - Intronic
1170624403 20:18020418-18020440 TGGCCAAAAGAAGTGGACGTTGG - Intronic
1170946548 20:20896016-20896038 AGGAAAAGAGAAGAGGGGGAAGG + Intergenic
1170998386 20:21388609-21388631 TGGCAAAATGAGGTGGGAGGGGG + Intronic
1171058776 20:21934947-21934969 TAGCAAAAAGATGTGGGAGGAGG - Intergenic
1171087586 20:22252256-22252278 TGGTAAGAACAAGTGGGGGAAGG - Intergenic
1171429961 20:25076832-25076854 TTGCACAAACAGGTGGGGGAGGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171862354 20:30412749-30412771 TGGCAAAAAAATGAGGGAGAGGG + Intergenic
1172482714 20:35280464-35280486 TGTCAGAAAGAAGCTGGGGAGGG - Intronic
1172936864 20:38626717-38626739 TGGAAAACAGAGGTGGGTGAAGG - Intronic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173229670 20:41184283-41184305 TGGAAAAAAGACATGGGGTAGGG - Exonic
1173331548 20:42079919-42079941 TGTCAAAAAGAAGGGGGCGGGGG - Exonic
1174708977 20:52685192-52685214 TGGCAGAGTGCAGTGGGGGAAGG + Intergenic
1175067434 20:56301441-56301463 TGGAAAAAAAAAGTCGGGGGAGG - Intergenic
1175618753 20:60425198-60425220 TGGCCAAGAGAAGAGGGAGAGGG - Intergenic
1175709673 20:61209266-61209288 TGACTAACAGAAGTGGAGGAAGG - Intergenic
1176690120 21:9896508-9896530 TTGCAACATGAAGTGGGAGAAGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177637198 21:23802639-23802661 TGAAAAAAAAAAGTGGGGAAGGG + Intergenic
1177647371 21:23917222-23917244 TTACCAAAAGAAGTGGAGGAAGG - Intergenic
1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1177967889 21:27751175-27751197 TGACAAAAAGCAATGGGGAAAGG + Intergenic
1178029047 21:28504226-28504248 TTGCATAAGGAGGTGGGGGATGG - Intergenic
1178163772 21:29948549-29948571 AGGCAAAAAGAAGGAGGAGAAGG - Intergenic
1178499827 21:33116503-33116525 TGGAAAAAAAAAGATGGGGAAGG + Intergenic
1178613733 21:34111452-34111474 CTTCAAATAGAAGTGGGGGAGGG - Intronic
1178761268 21:35405072-35405094 AGCCAAACAGAAGTGGGGCAGGG - Intronic
1179112445 21:38459030-38459052 GGGCATAAAGAGATGGGGGATGG - Intronic
1179136569 21:38684885-38684907 TGGCAGAAAGATGGTGGGGAGGG + Intergenic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1180205466 21:46256730-46256752 TGGTAAAACCAAGTGGGGGCAGG + Intronic
1180451907 22:15471383-15471405 GGGCACAAAGAAGTGGGAAATGG + Intergenic
1180617746 22:17139578-17139600 TGTCAAGAAGGAGTTGGGGAGGG - Intronic
1180823275 22:18846672-18846694 AGGCAAAGTGAACTGGGGGATGG - Intronic
1181123701 22:20689771-20689793 AGGCAAAGTGAACTGGGGGATGG - Intergenic
1181189468 22:21127874-21127896 AGGCAAAGTGAACTGGGGGATGG + Exonic
1181399780 22:22644323-22644345 AGGCAAAGTGAACTGGGGGATGG + Intergenic
1181649631 22:24251745-24251767 AGGCAAAGTGAACTGGGGGATGG - Intergenic
1182652362 22:31862407-31862429 TTGCAAAAAGTAGTCGGGCATGG + Intronic
1184420768 22:44381748-44381770 TGGCAAGAAGCAGTGTGGGGAGG + Intergenic
1184800887 22:46758558-46758580 TGGCTGAAAGGAGTTGGGGAAGG + Intergenic
1203217214 22_KI270731v1_random:12812-12834 AGGCAAAGTGAACTGGGGGATGG + Intergenic
1203273416 22_KI270734v1_random:72578-72600 AGGCAAAGTGAACTGGGGGATGG - Intergenic
949541626 3:5036918-5036940 TGGCATCCAGAAGTGGGGGTTGG + Intergenic
950257416 3:11517183-11517205 AGGCAAAAATTAGTTGGGGATGG + Intronic
950552336 3:13674283-13674305 TGGGGAAAGGAAGTGAGGGAGGG - Intergenic
951164039 3:19462893-19462915 TGACAAAAACAAATGGGGAAAGG - Intronic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951247678 3:20359944-20359966 AGGAATCAAGAAGTGGGGGAGGG - Intergenic
951973840 3:28480759-28480781 TGGTATAAGGAAGTGGGGCAGGG + Intronic
952586211 3:34895601-34895623 TTGCAAAAAAAAGTGTGAGAAGG - Intergenic
953042943 3:39271074-39271096 TGGGAAAAAGGAATGGGGAAGGG - Intronic
953061403 3:39431009-39431031 TGGCAAAAAGAAGTTTGGAATGG + Intergenic
953256620 3:41296913-41296935 TGGCAGGAAGAAGAGAGGGATGG + Intronic
953348398 3:42195597-42195619 AGACAACAAGGAGTGGGGGATGG - Intronic
953561703 3:43997542-43997564 TGGAGAAATGAGGTGGGGGAGGG + Intergenic
954558472 3:51536806-51536828 AGGAAAAGAGAAGTGGGGGGAGG + Intergenic
955027527 3:55184028-55184050 TGGAAAAAGAAAGTTGGGGATGG + Intergenic
955123307 3:56083691-56083713 TGGGAGAATGAAGTGGGGGTTGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
955407281 3:58633457-58633479 TGGCAAAGGGAAGGAGGGGAAGG - Intergenic
955615198 3:60800158-60800180 AGGCAGAGAGAAGTGGGGGAAGG - Intronic
956864889 3:73359478-73359500 TGACAAAACTAAGTGGGGAAAGG + Intergenic
956941424 3:74166343-74166365 TAGCCAAAAAAAGGGGGGGAAGG + Intergenic
958460085 3:94383527-94383549 TGCCACAGAGAAGTTGGGGAAGG - Intergenic
958874917 3:99605056-99605078 TGACAAAAACAAATGGGGAAAGG - Intergenic
959484226 3:106908773-106908795 AGGCACCAAGAAGTGTGGGAGGG + Intergenic
959926879 3:111932007-111932029 TGGCAGGAAGAAGGGAGGGAAGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
960036772 3:113109973-113109995 TGGAAAAGAGAAGAGGAGGAGGG + Intergenic
960299671 3:115986688-115986710 TGGAAAAAAAAAGAGGGGGGTGG + Intronic
960306404 3:116066898-116066920 TTGCAAAAAAAAATGGGGGCAGG - Intronic
960389499 3:117059302-117059324 TTACAAAAGGGAGTGGGGGAGGG + Intronic
960683363 3:120272560-120272582 TGGCAAAATGTGGTGGGAGAGGG + Intronic
960962987 3:123085016-123085038 TGGCAGAAGGCAGTGGGGGCAGG - Intronic
961377675 3:126477058-126477080 TGGGAAAAAGAGGTGGGGTGCGG - Intergenic
961651569 3:128419204-128419226 GTGCACAAAGAAGTGGGGCACGG + Intergenic
962563468 3:136632998-136633020 TGGCAAAAGTAGTTGGGGGAGGG + Intronic
962740974 3:138362383-138362405 AGGCAGAAAGTTGTGGGGGAGGG - Intronic
962915086 3:139894044-139894066 TCCCAAACAGAAGTGGGGAAGGG - Intergenic
963000883 3:140680474-140680496 AAGAAAGAAGAAGTGGGGGAGGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963631477 3:147736356-147736378 TGGCAAAAAGAAGAAATGGATGG + Intergenic
964119141 3:153163579-153163601 TGGAAAAAAAATGGGGGGGAAGG + Exonic
964696711 3:159516290-159516312 TGGCCAAAGGGAGTGGAGGAAGG - Intronic
964786320 3:160400046-160400068 TGGCAGAAGGAAGAGGGGTAGGG - Intronic
965335342 3:167426400-167426422 TGGAAAAGAGGAGTGGGGAAAGG - Intergenic
965354508 3:167657086-167657108 TGGCAATAAATTGTGGGGGAAGG - Intergenic
965517991 3:169642770-169642792 TGGCAGGATGAAGTAGGGGAAGG - Intronic
966486755 3:180479595-180479617 TGTCTAAAATAATTGGGGGATGG + Intergenic
967624200 3:191666768-191666790 TGGCAAAAATTTTTGGGGGATGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
971539774 4:27801339-27801361 TGGTGAAAAGAAATGGAGGAAGG - Intergenic
971618073 4:28819592-28819614 TGGCAAAAAGAAGTGGTAATTGG - Intergenic
971621595 4:28861069-28861091 TGGCAAAAAAAGGTGGGTGTAGG - Intergenic
971721605 4:30252157-30252179 TGACAAAAAGTAATGGGGAAAGG - Intergenic
972381768 4:38526201-38526223 TGGCAGTAGGAAGTAGGGGAGGG - Intergenic
972386533 4:38572064-38572086 GGAAAAAAAAAAGTGGGGGAAGG + Intergenic
972468302 4:39379656-39379678 TTCCAAAAAGTAGTGGAGGAGGG - Intergenic
972476244 4:39452501-39452523 TGACAAAAACAAGTGGAGAAGGG + Intergenic
972645329 4:40962709-40962731 GAGGACAAAGAAGTGGGGGAAGG + Intronic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
973331137 4:48911056-48911078 AGGAAAAAGGAAGTGAGGGAGGG - Intergenic
974615612 4:64275693-64275715 TGTCAAAAAGAAATATGGGATGG + Intronic
975148410 4:70994200-70994222 TCGCAAAGGGAAGCGGGGGAAGG + Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975428493 4:74259057-74259079 TGGAAAAAAGTAGTGGGTCATGG - Intronic
975671593 4:76786476-76786498 TAACAAAAATAAGTGAGGGACGG + Intergenic
975946478 4:79711419-79711441 TGGAAATAAGAAGTAGGAGAAGG + Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977575546 4:98670490-98670512 TGGAGAAAAGAAGGTGGGGATGG - Intergenic
978457795 4:108914197-108914219 TGGAAACAAGACATGGGGGATGG + Intronic
978498836 4:109387074-109387096 TGCCAAAAACATGTGGGGAAAGG + Intergenic
978537692 4:109779862-109779884 TGACAACAAGAAATGGGGAAAGG + Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978596183 4:110379659-110379681 TGGCAAAGTGATGTGGGGGGTGG - Intronic
979238033 4:118423714-118423736 GGACAGAAAGAAGTGGGAGAAGG - Intergenic
979449329 4:120851922-120851944 TGGCAAAAGTAAGAGGGGAAGGG - Intronic
979526246 4:121720283-121720305 CAGCAAAAAGATGTTGGGGAAGG - Intergenic
979876422 4:125897386-125897408 TGACAAAATGCAGTGGGGAAAGG + Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980194354 4:129568782-129568804 TGGCAAGAAGGAATTGGGGATGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
980940347 4:139268152-139268174 TGGGAAAAAGAAGTGTAGGAAGG + Intronic
980966333 4:139524812-139524834 AAGAAAAAAAAAGTGGGGGAGGG - Intronic
981157279 4:141453921-141453943 TGGCAAAAGGGAGGGAGGGAGGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983175931 4:164587743-164587765 TGACAAAAACAAATGGGGAAAGG + Intergenic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984864266 4:184267873-184267895 CGGCAAAAAGAAGGGTGAGATGG + Intergenic
984947976 4:184984545-184984567 AGGCAACAAGAAGTTGGGGAAGG + Intergenic
986097496 5:4574060-4574082 TGGCAAAAAGACCTGAAGGATGG + Intergenic
986887348 5:12256134-12256156 TGGAAAAAAGCAGTGGAGGAAGG - Intergenic
986943410 5:12985053-12985075 TGGCAAAAAGGTGGGGGTGAAGG + Intergenic
987183605 5:15391422-15391444 TTGCATTTAGAAGTGGGGGATGG + Intergenic
987205864 5:15624976-15624998 TGGGAAAAAGCAGGAGGGGAGGG - Intronic
987472207 5:18346287-18346309 TGTTGAATAGAAGTGGGGGAAGG + Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988474573 5:31572479-31572501 TGTAAAAAAGAAGTGGGGGTGGG + Intergenic
988572261 5:32380189-32380211 TGGCAAAATGCAGTGAGGAATGG + Intronic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989404823 5:41048639-41048661 AGGGAAAAAGAAATGGGAGAAGG - Intronic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990154358 5:52857893-52857915 TGGGGAAAAGAAGAGTGGGAAGG - Intronic
990191652 5:53266566-53266588 TGGGAAAATGGAGTGGGGGTGGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991608819 5:68429471-68429493 TGAGAAAGAGAAGTCGGGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992607627 5:78475475-78475497 AGGCACAAAAAAGTGGGAGAAGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993581099 5:89661776-89661798 AGGAAAAAATAAGTGGGGAAAGG - Intergenic
993755274 5:91721430-91721452 TCCCAGAAAGGAGTGGGGGAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994105270 5:95940960-95940982 CTGCAAAAAGAAGGGGGGGAGGG + Intronic
995159836 5:108966814-108966836 TTCCAACAAGAAATGGGGGAGGG - Intronic
995339647 5:111043683-111043705 TACCCAATAGAAGTGGGGGAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995842752 5:116459428-116459450 TAGCAACAGGAAGTGGAGGATGG - Intronic
995919489 5:117294438-117294460 TGACAAAAAGCAATGGGGAAAGG - Intergenic
996128268 5:119751524-119751546 TGGCAAACAGCAGTGGCAGATGG - Intergenic
997287877 5:132695978-132696000 TGGCAAAAAAAAGTTAGGAAAGG + Exonic
998038460 5:138935981-138936003 TGGCAAGAGGAAGGGGGGGAGGG - Intergenic
998939201 5:147262203-147262225 AGGCAAACAGAAGTGGGGTGAGG - Intronic
1000220800 5:159211836-159211858 AAGAAAAAAGAAGTGGGGGTGGG + Intergenic
1000289013 5:159852606-159852628 TGACAAAAAGAAATGGGGAAAGG + Intergenic
1000609485 5:163358841-163358863 TGTCAAGCAAAAGTGGGGGAGGG - Intergenic
1000880054 5:166686979-166687001 TGCCTGAAAGAAGTGGGGGCCGG - Intergenic
1001401562 5:171449470-171449492 CGGGGAAGAGAAGTGGGGGATGG - Intronic
1001883726 5:175269750-175269772 TGAGAAAGAGAACTGGGGGAAGG + Intergenic
1002057487 5:176606926-176606948 TGGAAAATACAAGTTGGGGACGG - Intronic
1002381623 5:178833390-178833412 TGGGAAAAACAATTGGGGGGGGG + Intergenic
1002406008 5:179032071-179032093 TGGGAAAAAGAAGAGGAGGAAGG - Intronic
1002469396 5:179426514-179426536 TTGCATAAAGAAGTGCAGGAAGG + Intergenic
1002641356 5:180632083-180632105 TGGCATGAAGGAGCGGGGGAGGG + Intronic
1002738464 5:181415685-181415707 GGACAGAAAGAAGTGGGAGAAGG - Intergenic
1003363404 6:5450346-5450368 TGGTAACAGGGAGTGGGGGAGGG + Intronic
1004860002 6:19794140-19794162 TGGCACAAGGAAGGGGGGGGGGG - Intergenic
1005214451 6:23508808-23508830 CAGCAAAAATAAGTGAGGGAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1007052293 6:38844431-38844453 TGTTAAAAAGAGGTAGGGGAAGG - Intronic
1007618872 6:43199384-43199406 TGGCAAGGAGAAGAGAGGGAAGG + Intronic
1007829220 6:44625484-44625506 TGGGAAAAGGAGATGGGGGAAGG - Intergenic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008683930 6:53903449-53903471 TGACAACTAAAAGTGGGGGAAGG - Intronic
1008916717 6:56795728-56795750 TGTCAAGAAAGAGTGGGGGAGGG + Intronic
1009519691 6:64665713-64665735 TGGAAAAAAGAAAAGCGGGAGGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009550945 6:65090296-65090318 TGGCAGAAAGAAGTGTAAGAAGG - Intronic
1010186407 6:73148956-73148978 TGTCAAAGAGCAGTGGGTGATGG + Intronic
1010567783 6:77438421-77438443 TGGCACAAAGAAGTTTTGGAAGG + Intergenic
1011055666 6:83200909-83200931 CTGGAAAAATAAGTGGGGGATGG + Intergenic
1011435412 6:87330860-87330882 AGGGAACAAGAAGTGGGTGATGG + Intronic
1011519636 6:88191658-88191680 CAGCAACAAGAAGTGGGAGAGGG - Intergenic
1011551669 6:88536091-88536113 TGGGTGAAAGAGGTGGGGGAAGG + Intergenic
1012189034 6:96258871-96258893 TATCAAAAAGAAGTGGGAGCAGG + Intergenic
1012306838 6:97669201-97669223 TGGGAAAGGGAACTGGGGGAGGG - Intergenic
1012383279 6:98646418-98646440 TGAGAGAGAGAAGTGGGGGAGGG + Intergenic
1012444570 6:99294613-99294635 TGGTCAAAAAAAGAGGGGGAGGG + Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013506940 6:110810143-110810165 TGGAAAAAAGAAATGGTGGCAGG + Intronic
1013825797 6:114209759-114209781 GGGAAAAAAGAAATGGGAGAAGG + Intronic
1013845397 6:114444724-114444746 TGCAAAAAAAAAGTGTGGGAGGG - Intergenic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014358117 6:120437439-120437461 TGACAAAAAGAAATGGGGAAAGG + Intergenic
1014788827 6:125647761-125647783 TGGCAAGGAGGAGTTGGGGAAGG + Intergenic
1015188590 6:130447323-130447345 AGGCAAAAAGACAAGGGGGAAGG + Intergenic
1015813177 6:137181153-137181175 TACCAAAATGAAATGGGGGAAGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017988843 6:159469039-159469061 AGGCAAAAAGGAGTGAAGGAAGG + Intergenic
1019243567 6:170691238-170691260 GGACAGAAAGAAGTGGGAGAAGG - Intergenic
1019843401 7:3472984-3473006 GGGGAAAAAGAAGAGGAGGAAGG - Intronic
1020042759 7:5016626-5016648 TGGCTAAAAGAGGTATGGGAGGG + Intronic
1020289493 7:6711873-6711895 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1020679524 7:11219812-11219834 TGGGACAAAGAAGTGGGAGGGGG - Intergenic
1020746153 7:12080334-12080356 TGGCACAAAGGAGTGGGGTTGGG - Intergenic
1021712245 7:23427377-23427399 TTTCAAGAAGAAGTGAGGGAAGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1021931377 7:25584645-25584667 TGGCCAGATGAAGTGGGGGTGGG - Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022341679 7:29474454-29474476 TGGAAAAAAAAAGTTGGAGATGG - Intronic
1022714771 7:32889780-32889802 GGGCAAAGAGAAGAGGGGAAGGG + Intronic
1023019109 7:35994552-35994574 TGGTAAATGGTAGTGGGGGAGGG - Intergenic
1023108822 7:36789707-36789729 TGGCGGAAAGAAGAGTGGGATGG - Intergenic
1023448927 7:40260967-40260989 TAGAAAAAAAAAGTGGGGGTGGG - Intronic
1023826445 7:44013167-44013189 TGGCCAAAAGAGGTATGGGAGGG - Intergenic
1025553545 7:62276314-62276336 CGGCAAAAAGATGTGGCGGCGGG + Intergenic
1025878567 7:65509921-65509943 GGGCAAAAAGCAGTGGGAGCTGG + Intergenic
1026448712 7:70508261-70508283 TGTCAAAAAGGAGGGGGGTAGGG + Intronic
1026567935 7:71505180-71505202 TGGCAGGAAGAAGAGGAGGAAGG - Intronic
1026746426 7:73016820-73016842 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1026750077 7:73044963-73044985 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1026753725 7:73073073-73073095 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1026757376 7:73101109-73101131 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1027032529 7:74901378-74901400 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1027090028 7:75292377-75292399 TGGCCAAAAGAGGTATGGGAGGG - Intergenic
1027093673 7:75320305-75320327 TGGCCAAAAGAGGTATGGGAGGG - Intergenic
1027097316 7:75348272-75348294 TGGCCAAAAGAGGTATGGGAGGG - Intergenic
1027322031 7:77019400-77019422 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1027325665 7:77047320-77047342 TGGCCAAAAGAGGTATGGGAGGG + Intergenic
1027638514 7:80704934-80704956 TGGGTGAAAGAAGTGGGGAAGGG - Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029364854 7:100110167-100110189 TGGGAGGAAGAAATGGGGGAGGG - Intronic
1029398423 7:100325266-100325288 TGGCCAAAAGAGGTATGGGAGGG - Intergenic
1029489422 7:100862258-100862280 TCTCAAAAAAAAGCGGGGGAGGG - Intronic
1029717882 7:102342675-102342697 TGGCCAAAAGAGGTGTGGGAGGG + Intergenic
1029754734 7:102566571-102566593 TGGCCAAAAGAGGTATGGGAGGG - Exonic
1029772684 7:102665651-102665673 TGGCCAAAAGAGGTATGGGAGGG - Intronic
1030327570 7:108236819-108236841 TGGCCATAGGGAGTGGGGGAGGG + Intronic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030730805 7:112986265-112986287 TGGGAAAGAGAAGTGGGAAATGG + Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1030860947 7:114627665-114627687 AGGCAAAAAGAAGATAGGGAAGG - Intronic
1030920116 7:115373473-115373495 TGGCAAACAGACGTGAGGAAAGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031375390 7:121018471-121018493 TGGTAAAAGGAAGTGGAGTAGGG - Intronic
1031591372 7:123596168-123596190 TGGAAAAAAAAATTGGGGGGAGG + Intronic
1031996320 7:128233863-128233885 TGGGACAAAGAAATGTGGGAGGG - Intergenic
1033527144 7:142227473-142227495 TGGCAAAATAGAGTTGGGGAAGG + Intergenic
1033979629 7:147148092-147148114 TGGTAAAAAGTGGTGGGGGCCGG + Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034726323 7:153339534-153339556 TGGCAAAAGGAAATGGGGAGAGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035019311 7:155791350-155791372 TGGGAGGAAGAAGAGGGGGAGGG - Intergenic
1035504555 8:116920-116942 GGACAGAAAGAAGTGGGAGAAGG + Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1037691486 8:21184883-21184905 TGGGAAAATGAAGTATGGGAAGG - Intergenic
1037746472 8:21649484-21649506 TGGGAACAAGAGGTGAGGGAGGG + Intergenic
1038055677 8:23855490-23855512 TGGGAAAACGAGGTGGGGCAAGG - Intergenic
1038259519 8:25980828-25980850 TGGAGGAAAGCAGTGGGGGAGGG + Intronic
1039001522 8:32985602-32985624 TGGTTAAAAGAAGTGGAGGTGGG - Intergenic
1039141977 8:34400804-34400826 TGGCCAAGAGAAGTGGAAGAAGG - Intergenic
1039388322 8:37156648-37156670 TGGCAAAGTGACTTGGGGGATGG - Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1041309063 8:56495725-56495747 TGGTAAAATGACGTGGAGGAAGG - Intergenic
1041366922 8:57116246-57116268 AGACAACATGAAGTGGGGGAGGG + Intergenic
1041659838 8:60391079-60391101 GGGCATAGAGAAGTGGGGGTTGG + Intergenic
1041789424 8:61676369-61676391 TGGAAAAAAGAAGTGGAGGAAGG + Intronic
1041932863 8:63306364-63306386 TGGCAAAGAAAAATGGGGAAGGG + Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042170068 8:65982650-65982672 TGGAGAAAAGAAGAGGGAGAGGG - Intergenic
1042363899 8:67914546-67914568 GGGAAAAAAGAAGGGGAGGAAGG - Intergenic
1043268999 8:78305098-78305120 TGGCAACCAGAAGCTGGGGAGGG - Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044184784 8:89238539-89238561 TGGGAAAAAAAAGGAGGGGAGGG - Intergenic
1044300999 8:90582793-90582815 GGGAAAAAGGGAGTGGGGGAGGG - Intergenic
1044673599 8:94708422-94708444 TGGCAGAAGGAAGTGGAGTAAGG + Intergenic
1044744446 8:95358429-95358451 TGGCAGAAAGAGGAGGGGGTAGG + Intergenic
1045445686 8:102260894-102260916 TGGCAAACAAAAGTGTGGAAAGG - Intronic
1045523274 8:102921576-102921598 TGTCAAAAAGAAGGGAAGGAGGG - Intronic
1045586582 8:103544541-103544563 TGGCTGTAAGAGGTGGGGGAGGG - Intronic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1045947558 8:107813834-107813856 AGGCAATAAGAAGTGGGCTAGGG - Intergenic
1045959827 8:107953965-107953987 TGCAATAAAGAAGTGGGTGATGG - Intronic
1046566383 8:115906329-115906351 TGAAAATAAGAAGTGAGGGAGGG - Intergenic
1046701178 8:117402881-117402903 TGGCAAAAAGGAGTGAGTGGTGG - Intergenic
1047349242 8:124057601-124057623 AGGCAAAAAGAGGTGAGGCAAGG - Intronic
1047423212 8:124724323-124724345 TGGCAAACACAGGTGGGGGGCGG + Intronic
1048526380 8:135206604-135206626 TGGCAGAAAGAAGAGCGTGAAGG - Intergenic
1049491281 8:142904457-142904479 TGGCAAAGAACAGTGGGGGTTGG - Intronic
1049553700 8:143272106-143272128 GGGCAGGAAGAAGTGAGGGAGGG + Intronic
1049664814 8:143838232-143838254 AGGCAAAAAGAGGTATGGGATGG - Intronic
1049890553 9:66175-66197 TGGAAGAAAGAAGGGAGGGAGGG - Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1051149661 9:14066543-14066565 AGGCAAAAATTAGTGGGGTATGG + Intergenic
1051769188 9:20557804-20557826 TGGCAAAAAGTACCGGGAGAGGG + Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053332246 9:37223488-37223510 TGGGAGAAAGAAGTTGGGGGAGG + Intronic
1053542950 9:38993681-38993703 TGGCAAAACGATGTGGGGGATGG + Intergenic
1053578971 9:39383267-39383289 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1053732019 9:41067358-41067380 TGGAAGAAAGAAGGGAGGGAGGG - Intergenic
1053807393 9:41817198-41817220 TGGCAAAACGATGTGGGGGATGG + Intergenic
1053843483 9:42211342-42211364 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054100554 9:60942071-60942093 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054121950 9:61217696-61217718 AGGAAAAAAGAGATGGGGGATGG + Intergenic
1054217040 9:62369650-62369672 TTGCAACATGAAGTGGGAGAAGG - Intergenic
1054585792 9:66964815-66964837 AGGAAAAAAGAGATGGGGGATGG - Intergenic
1054623199 9:67370229-67370251 TGGCAAAACGATGTGGGGGATGG - Intergenic
1055771857 9:79725523-79725545 TTGCCAAAAAAAGGGGGGGAGGG - Intronic
1056102153 9:83310196-83310218 TGGCAAAAAGAGGTAGGGAGAGG + Intronic
1056367902 9:85924093-85924115 TGGAAAACAGAAGTGAGGTAAGG - Intergenic
1056655918 9:88508942-88508964 TGGCATAAATAACTGGGGGCAGG + Intergenic
1058016324 9:100036498-100036520 AGGCAAAAGCAAGTGGGGCAAGG + Intronic
1058777306 9:108296994-108297016 TTAGAAAAAGAAGTGGGGCAGGG + Intergenic
1058792929 9:108469390-108469412 TGGCAAGAAGAAATGATGGAAGG - Intergenic
1059040759 9:110813240-110813262 TGGCAGGAAGCAGTGGGGGTTGG + Intergenic
1059594940 9:115709529-115709551 TGGCAACAAAAAGTGGGCTAAGG - Intergenic
1059974014 9:119696742-119696764 TAGAAAGAAGAAGTGGGAGAAGG + Intergenic
1061653170 9:132067541-132067563 TGGCAAAAAGAAGAAGAGCAGGG + Intronic
1061740205 9:132697827-132697849 TGACAAATAGAGCTGGGGGAGGG + Intergenic
1062063004 9:134507512-134507534 TGAAAACAAGAAATGGGGGAAGG - Intergenic
1062613043 9:137383504-137383526 TGCCAGACAGAGGTGGGGGAGGG - Intronic
1203446683 Un_GL000219v1:63389-63411 TGGCAAAAAAATGAGGGAGAGGG - Intergenic
1203603756 Un_KI270748v1:40461-40483 GGACAGAAAGAAGTGGGAGAAGG - Intergenic
1186317534 X:8386958-8386980 TGGCAAAAGAAAGGGGTGGAGGG + Intergenic
1186410591 X:9342255-9342277 GGGTAAAAAGCAGAGGGGGAGGG - Intergenic
1186410638 X:9342374-9342396 GGGTAAAAAGCAGAGGGGGAGGG - Intergenic
1186729056 X:12388660-12388682 TAACCAAAAGAAGTGGGGGTGGG - Intronic
1186803036 X:13112653-13112675 TGGCAAAAAAAAGTTGGTGGGGG + Intergenic
1187074060 X:15916470-15916492 TGGCAAGAGGAAGTGGGAAAGGG - Intergenic
1187264609 X:17719362-17719384 TGGCAACATTCAGTGGGGGAGGG - Intronic
1187758344 X:22550309-22550331 TGGAAACAAGAAATGGGGGTGGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188537955 X:31218441-31218463 TGGGAAAAAGTAGTTTGGGATGG - Intronic
1189182358 X:39016305-39016327 TGGGAAAAGGTGGTGGGGGAGGG + Intergenic
1189439924 X:41026187-41026209 AGGCAAAAAGAAGGGGGAGAAGG + Intergenic
1189548013 X:42063090-42063112 TGCCAAAAAATAGAGGGGGAAGG - Intergenic
1189917336 X:45869223-45869245 TGGTAGATAGAAGGGGGGGAGGG - Intergenic
1189982522 X:46525310-46525332 TGGCAAAAAGAGGCCGGGCATGG + Intronic
1190708674 X:53050033-53050055 AGGAAAGAAGGAGTGGGGGATGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191596539 X:62950441-62950463 TGACAAAAAAAAATGGGGAAAGG + Intergenic
1191665598 X:63699199-63699221 AGGGAAAAAAAAGTGGGAGAAGG - Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192321703 X:70095214-70095236 TGAAAAAGAGAAGTTGGGGAGGG + Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1193482699 X:82046861-82046883 TGGTGACAAGAAGTGGGGGGTGG - Intergenic
1194013820 X:88594758-88594780 TTGGAAAAATAAATGGGGGAAGG + Intergenic
1194389091 X:93293921-93293943 TGGAAAAACAAAGTGGGGAAAGG + Intergenic
1194736638 X:97520046-97520068 TGGGAAAAAGCAGGGGGGTAGGG - Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195633195 X:107082052-107082074 TGTCAAAAAGAAGTGGGGAAAGG + Intronic
1196248167 X:113425702-113425724 TGGAAAAAAAAAGTAGGGAAAGG + Intergenic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196303116 X:114069236-114069258 TGGAATAAAGAAGGGGGAGATGG - Intergenic
1197446256 X:126554151-126554173 TTGCAAAAAGGGATGGGGGAAGG - Intergenic
1197548555 X:127858921-127858943 TGGCAACTAGAAGAGGGGGAAGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1198177989 X:134173937-134173959 TGGAAAGAAGAGGAGGGGGAGGG + Intergenic
1198486991 X:137097294-137097316 TGGCACAAAGAAAGGGTGGAGGG + Intergenic
1199765991 X:150941988-150942010 AGGCAAAGGGAAGAGGGGGAAGG + Intergenic
1199859169 X:151784274-151784296 TGGCAAGAGGAAGAGGGAGAGGG - Intergenic
1200843471 Y:7807658-7807680 TGGCCAAAAAAAGAGGGGCAGGG + Intergenic
1201451160 Y:14116234-14116256 AGGAAAAAAGAAAGGGGGGAAGG + Intergenic
1202075908 Y:21037863-21037885 TGGCAGACAGGAGTGGGGGGGGG - Intergenic