ID: 921565051

View in Genome Browser
Species Human (GRCh38)
Location 1:216706740-216706762
Sequence GCATCAGTTAAGTTTATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921565051 Original CRISPR GCATCAGTTAAGTTTATAGA AGG (reversed) Intronic
908048981 1:60207221-60207243 GTATCAGTTAAGTTTATGCTTGG + Intergenic
908123653 1:61008751-61008773 GCATCAGATGAGGTTAGAGAGGG + Intronic
909338362 1:74502955-74502977 ACTTCAGTTAAGTTCCTAGAAGG - Intronic
911200076 1:95035466-95035488 ACATCAGTCAAGTTCATATAGGG - Intronic
911679760 1:100701907-100701929 GTATCAGTTAACTTTTAAGAAGG + Intergenic
911709350 1:101052063-101052085 GCTTCAGTATAGTTTAGAGAAGG - Intergenic
913445468 1:118945769-118945791 GCATCACTGGAGTTTAAAGATGG + Intronic
917129744 1:171728962-171728984 GCATCAGAGAAGAGTATAGAGGG + Intronic
917731058 1:177875435-177875457 GCAAAAGTCCAGTTTATAGAAGG - Intergenic
917866494 1:179200652-179200674 GGATCAGATAAGTTTATAATTGG - Intronic
921565051 1:216706740-216706762 GCATCAGTTAAGTTTATAGAAGG - Intronic
923234251 1:232017232-232017254 GCATCAGCTAAGCTCATGGATGG + Intronic
1064570724 10:16690157-16690179 TCATCACTTAAGTTTCCAGAAGG - Intronic
1065076656 10:22086594-22086616 ACACCATTTTAGTTTATAGATGG - Intergenic
1065368420 10:24956942-24956964 GCATTAGTTAGGTTCACAGAAGG - Intergenic
1069453889 10:68538578-68538600 CCATCTGTAAAGTTTTTAGAGGG - Intergenic
1070738639 10:78885964-78885986 GCATCAGTTATTTTAATAGAAGG - Intergenic
1071324143 10:84495044-84495066 ACATCAGTTTAGCTTATTGATGG + Intronic
1073868729 10:107836251-107836273 GCTTCAGTTGAGAATATAGAAGG + Intergenic
1079838831 11:25368450-25368472 GGATCAGTTGACTTTATACATGG + Intergenic
1080951913 11:37043670-37043692 GCATCAGATATGATTATTGATGG - Intergenic
1082665356 11:55970044-55970066 GTATCAGTTTAATTTCTAGAAGG + Intergenic
1087220232 11:95539338-95539360 GGATCTGATAAGTTTATAAAAGG - Intergenic
1088424807 11:109691830-109691852 GCTTCAGATAATTTTATAGTTGG + Intergenic
1090110573 11:123903950-123903972 GAATCAGAAAAGTTTAGAGAAGG + Intergenic
1093100485 12:15022613-15022635 GTATAAGTTAACTTTATATAAGG + Intergenic
1093739588 12:22668326-22668348 TCAGAAGTTAAATTTATAGAAGG + Intronic
1095274749 12:40267406-40267428 GGAACAGTTAAGTTTATTCATGG + Intronic
1095354866 12:41260659-41260681 CCATCAGTTAAGTATTTTGATGG - Intronic
1095752087 12:45724300-45724322 GTAGCAGTTAAGTTTCTTGAGGG + Intergenic
1096885863 12:54718535-54718557 GCATAAATTAAATTTATAAAGGG + Intergenic
1099062350 12:77927908-77927930 GCATCACTAAAGGTTAGAGAAGG + Intronic
1100126156 12:91428268-91428290 GCATTAGATATTTTTATAGATGG + Intergenic
1104063309 12:125285873-125285895 GCATCATTTAACATTAGAGAAGG + Intronic
1106804586 13:33293075-33293097 GCATCAGTTAAGCTGATACTTGG - Intronic
1108179428 13:47826123-47826145 GCAACAGGTCAGTTTATAAATGG - Intergenic
1109062937 13:57642637-57642659 GCATCTGTTAAGTATTTAGGTGG - Intronic
1113344969 13:109468188-109468210 GCATGATTTCAGTTTATAAAAGG - Intergenic
1114286216 14:21246249-21246271 GCATCATTTATTTTCATAGATGG - Intronic
1117467668 14:56009608-56009630 GGAGGAGTTAAGATTATAGATGG - Intergenic
1130097022 15:80863491-80863513 GAATGAGATAAGTTTAAAGAAGG + Intronic
1135103777 16:19629537-19629559 AAATCAGTTAACTTTATAGTGGG + Intronic
1135385193 16:22032845-22032867 GCCTGAGTTAATTTTATATATGG + Intronic
1137338752 16:47577028-47577050 GCATCAGCTAAGTTAAGAAAAGG - Intronic
1146661422 17:34667508-34667530 GCAGCAGTTATGTTTTTGGAGGG - Intergenic
1147811942 17:43177337-43177359 GTATAAGTTATGTGTATAGATGG - Intronic
1152908000 17:82980552-82980574 GATTCAGTTAATTTTCTAGAGGG + Intronic
1156282883 18:35658233-35658255 ACTTCAGTTAAGTCTGTAGATGG + Intronic
1158957821 18:62557693-62557715 GCATCAGTTTAGTTTCAAAAAGG + Intronic
925228823 2:2212073-2212095 GCATCAGTCATGTGTCTAGATGG - Intronic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
931208272 2:60168520-60168542 TCATGAGTTCAGTTTATAGTGGG + Intergenic
933912770 2:86958074-86958096 GGATCAGTTAAATTTATAATGGG + Intronic
934010225 2:87811816-87811838 GGATCAGTTAAATTTATAATGGG - Intronic
935992740 2:108735901-108735923 GGATCAGTTAAATTTATAATGGG + Intronic
936128053 2:109808542-109808564 GGATCAGTTAAATTTATAATGGG + Intronic
936216644 2:110562943-110562965 GGATCAGTTAAATTTATAATGGG - Intronic
936425783 2:112417524-112417546 GGATCAGTTAAATTTATAATGGG - Intronic
939226415 2:139370481-139370503 GCATCAGTTGAGTTTAGATGTGG + Intergenic
944716672 2:202381970-202381992 GAATCAGTTAATTTTATAATTGG + Intronic
945504951 2:210628543-210628565 GCTTCTGTTAAGTTTTTAGGAGG + Intronic
945556804 2:211287050-211287072 TCATCAGGTAAGTCTATACATGG - Intergenic
946345744 2:219109138-219109160 GCATCAGTCAAGGATGTAGAGGG - Intronic
1170087054 20:12545196-12545218 GCATCAGTTGAGTTTATTCTGGG + Intergenic
1173983600 20:47243936-47243958 CCATCTGTTAGATTTATAGATGG - Intronic
1184918204 22:47587716-47587738 TCATCCTTTAAGTTTATAGAGGG - Intergenic
953050395 3:39336568-39336590 GCACCAGGTAAAATTATAGATGG + Intergenic
953058634 3:39408265-39408287 GCATCAGTGCAGATTATAAAAGG + Intronic
955694493 3:61622115-61622137 GCCTAAGTTAACTTTCTAGAGGG + Intronic
956988276 3:74730305-74730327 GCATCAGTGAAGTTCAGAAAAGG - Intergenic
957987884 3:87594715-87594737 GCATCAGTAAAGTGTATAGTTGG - Intergenic
960467719 3:118017881-118017903 GCTTCAGGTAAGTTTTTGGAGGG + Intergenic
967750411 3:193108457-193108479 TCATTAGTTAAGTATCTAGATGG - Intergenic
970366966 4:15369303-15369325 GCATCACTTTAGATTTTAGAGGG + Intronic
973032770 4:45364464-45364486 AGATCAGTTAAGTTCACAGAGGG - Intergenic
973559871 4:52124588-52124610 GCATTAGTAAAGTATTTAGAAGG - Intergenic
977076630 4:92460323-92460345 TCATTAGTTAAATTTACAGAGGG + Intronic
977800439 4:101223681-101223703 GCATTAGTTTGGTTTATGGAAGG - Intronic
978393277 4:108250334-108250356 GCATCAGTTAAGTTGTTCAATGG - Intergenic
984480525 4:180295155-180295177 GCCTCAGTTAAATTCATAAATGG - Intergenic
985682292 5:1262754-1262776 GCATCAGTGAATGTTATTGAAGG - Intronic
988774562 5:34466212-34466234 GCAACAGCTAATTTTAAAGAGGG + Intergenic
988845661 5:35125126-35125148 GCAACAGTAAAGTTTAGAGCTGG + Intronic
989180729 5:38574268-38574290 GCATGAGGGAAGTCTATAGAGGG - Intronic
995235506 5:109825375-109825397 TCATCAGTTATATTTAGAGATGG + Intronic
996373384 5:122775999-122776021 AATACAGTTAAGTTTATAGAGGG - Intronic
997879983 5:137580840-137580862 GGATCAGTTAAGATTTCAGATGG + Intronic
999635745 5:153620413-153620435 GGATCAGATAAGTCTACAGATGG - Intronic
999683179 5:154078738-154078760 GCAGCAGTTAAGATGATAGCAGG + Intronic
1000930031 5:167240451-167240473 GTATCAGTTAAGTTAAAAAAAGG + Intergenic
1003004689 6:2369879-2369901 GCTTCAGTTAAGGATGTAGAAGG + Intergenic
1006071972 6:31505070-31505092 GCCCCAGTGAAGTTTATAGTGGG - Intronic
1008300881 6:49837936-49837958 GCATCAGCTAACTTTTTAGATGG + Intronic
1008529149 6:52438628-52438650 GCATCATTCTAATTTATAGAAGG + Intronic
1011522546 6:88225145-88225167 ACATCAATTTAGTTTATAAAAGG - Intergenic
1011789694 6:90885291-90885313 GCATCAGCTAAGTGTGGAGAGGG + Intergenic
1011807946 6:91094205-91094227 TCATCAGGTAAGATTCTAGAAGG + Intergenic
1014554424 6:122828839-122828861 GCATCTGTTAAGGGTATTGATGG - Intergenic
1014579188 6:123113830-123113852 GCTTCAGTCATGTTTATATAAGG - Intergenic
1015121828 6:129708523-129708545 GGATTAGTTAAGTTTTTGGAAGG - Intronic
1016471464 6:144379051-144379073 GCAACAGTTCAGTTTTTTGATGG + Intronic
1017065059 6:150520803-150520825 GCATCTGTTCAGTTTCTAGTGGG - Intergenic
1022740482 7:33115357-33115379 GAAACAGTTTAGTTTAGAGAAGG - Intergenic
1028724721 7:94074228-94074250 GCTTCAGTTTGGTTCATAGATGG + Intergenic
1030719768 7:112856903-112856925 TTATCAGATAAGTTTATAGATGG - Intronic
1039686064 8:39802486-39802508 GATTCAGTTCAGTTTATAGGTGG - Intronic
1043313838 8:78895525-78895547 GCTTCAGTAAAGTCTCTAGAGGG - Intergenic
1046676719 8:117116871-117116893 GTATGAGTCAAGGTTATAGAAGG + Intronic
1047053110 8:121135454-121135476 GAAAAAGTTCAGTTTATAGAAGG + Intergenic
1050084315 9:1948911-1948933 GGACCAGCTAAGTTTATAGTAGG - Intergenic
1051109768 9:13622821-13622843 GTATCAGTTAAGTGTCAAGATGG + Intergenic
1054744074 9:68836706-68836728 GCTTCAGATGAGTTAATAGATGG + Intronic
1057837546 9:98457505-98457527 GCATATGTAAAGTTTATATAGGG - Intronic
1203654782 Un_KI270752v1:13021-13043 GCATCAGCTAAGTTCCTGGAGGG + Intergenic
1188544223 X:31285437-31285459 GCATTAGATATGTTTGTAGAGGG - Intronic
1189601115 X:42627515-42627537 GCATCAGTTAAGTCAAGAGCAGG + Intergenic
1196594196 X:117524052-117524074 TCATCTGTTCATTTTATAGATGG - Intergenic
1197288829 X:124629861-124629883 GAATCTGTTAAATTTATAGAAGG + Intronic