ID: 921570076

View in Genome Browser
Species Human (GRCh38)
Location 1:216767198-216767220
Sequence TATGAGTAACTAGGAAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921570076_921570078 -5 Left 921570076 1:216767198-216767220 CCTTTCTTTCCTAGTTACTCATA 0: 1
1: 0
2: 1
3: 26
4: 288
Right 921570078 1:216767216-216767238 TCATATTTTTGAAGTTACATTGG 0: 1
1: 0
2: 0
3: 28
4: 371
921570076_921570079 18 Left 921570076 1:216767198-216767220 CCTTTCTTTCCTAGTTACTCATA 0: 1
1: 0
2: 1
3: 26
4: 288
Right 921570079 1:216767239-216767261 CTTCTAAAAAAAGAAAAGAAAGG 0: 1
1: 2
2: 41
3: 566
4: 5576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921570076 Original CRISPR TATGAGTAACTAGGAAAGAA AGG (reversed) Intronic
903914150 1:26750950-26750972 CAAGAGTAATTAGGAAAGAGGGG + Intronic
903936539 1:26899058-26899080 TAGGAGTTAATAGGAGAGAATGG - Intronic
905055549 1:35090547-35090569 TTTGAGGAACTACGAAAGCAAGG - Intronic
906627857 1:47340068-47340090 AATAAATAAATAGGAAAGAAAGG - Intronic
907087186 1:51686382-51686404 CAAGAGTAACAAGGAAGGAAAGG - Intronic
908488169 1:64615868-64615890 TATGAGGTACTAAGAAGGAACGG - Intronic
909020352 1:70424461-70424483 TATCTGTAATTAGGAAAGAAAGG + Intronic
910144717 1:84066236-84066258 TAAGAGTAATCTGGAAAGAAGGG - Intergenic
910822422 1:91366067-91366089 CATTAGTAACTAGGTAAGAGTGG + Intronic
911272420 1:95818870-95818892 TCTGAGAAACAAGGAAAGATAGG - Intergenic
911433102 1:97818013-97818035 TATTAAGGACTAGGAAAGAAGGG - Intronic
911433332 1:97821871-97821893 TATGAGGAACTAGGATATAGAGG - Intronic
912619635 1:111141826-111141848 TATAAAGAACAAGGAAAGAAAGG - Intronic
913550125 1:119909084-119909106 AATAACTAACTGGGAAAGAAAGG + Intergenic
914258913 1:145982623-145982645 TCTTTGTATCTAGGAAAGAAGGG + Intergenic
916304428 1:163313441-163313463 TAGGAGATTCTAGGAAAGAAAGG + Intronic
916325885 1:163559483-163559505 TTTGAGTAAGTGAGAAAGAATGG + Intergenic
916984828 1:170179994-170180016 GATGAGTAAGTATGAAAGAGAGG + Intergenic
917110492 1:171542547-171542569 TAGGAGAAACTGAGAAAGAAGGG - Intronic
919007577 1:191918550-191918572 TATTAGTACATAGTAAAGAAAGG + Intergenic
919497308 1:198289085-198289107 CATGAGTATGAAGGAAAGAATGG + Intronic
921253089 1:213315631-213315653 TATTAGTATATAGGAAAGAGTGG + Intergenic
921570076 1:216767198-216767220 TATGAGTAACTAGGAAAGAAAGG - Intronic
921695571 1:218205225-218205247 TATTAGTGACTAGGTAAGGATGG + Intergenic
923839346 1:237651133-237651155 TGTGAGTGGTTAGGAAAGAAAGG + Intronic
924006232 1:239614674-239614696 TCTGAGTTCCAAGGAAAGAATGG - Intronic
1064652633 10:17524633-17524655 CATGAGTAAATATGAAAGCATGG + Intergenic
1065163993 10:22955391-22955413 TATGAGAAAATAGGGCAGAAAGG + Intronic
1065574785 10:27106248-27106270 TAGGAGTTAAGAGGAAAGAAAGG - Intergenic
1067031820 10:42883253-42883275 TAAAATTAATTAGGAAAGAAGGG - Intergenic
1068351793 10:55857208-55857230 TATGAAAAAATAGGAAAAAAGGG - Intergenic
1068737349 10:60429307-60429329 TAGGAGAAAGTAAGAAAGAAAGG + Intronic
1070207511 10:74278542-74278564 GATGATCAACTAGGAAAGAAAGG - Intronic
1071461758 10:85903462-85903484 TGTGATTATCTAGGAAAGGAAGG - Intronic
1072454712 10:95565606-95565628 TGTGAGGAATTAGGAAAGGAGGG + Intergenic
1072702781 10:97656000-97656022 TCTGTGCAGCTAGGAAAGAAGGG - Intronic
1072858285 10:98973838-98973860 AATGAGTAAAAAGGAAAAAAAGG + Intronic
1074671079 10:115791740-115791762 TATGCCAAACTAGGGAAGAAAGG - Intronic
1074788464 10:116863096-116863118 TAGGATTTACTAAGAAAGAAAGG + Intronic
1074797269 10:116960222-116960244 TGTGAGAAACTAGGAATGAGGGG + Exonic
1077900831 11:6487033-6487055 TATCAGTAACTATCAAACAATGG + Intronic
1080066250 11:28017864-28017886 TGTGAGTTACTAGGAAATGATGG - Intergenic
1081086030 11:38802456-38802478 TATGAGTGACAAGAAAAGATAGG + Intergenic
1081114190 11:39177719-39177741 TATGTTTAATCAGGAAAGAAAGG + Intergenic
1081321722 11:41699873-41699895 TATGAATAATTTGGCAAGAAGGG + Intergenic
1082654781 11:55840381-55840403 TATCAGTCACCAGGAAAGAAAGG - Intergenic
1083234260 11:61341799-61341821 TATGAGAAACAAGGCATGAAGGG - Intronic
1084163972 11:67366608-67366630 GATGTATAACTGGGAAAGAAGGG + Intronic
1088559884 11:111103483-111103505 TATAAGAAACTAGAAAACAATGG - Intergenic
1088597960 11:111453919-111453941 TGTGAGTAGCAAGGATAGAAGGG - Intronic
1089220478 11:116866863-116866885 TATGAGTAACTTGGTAAAAATGG - Intronic
1090000302 11:122950508-122950530 GATGAGAACCTAGGAATGAATGG - Intronic
1090432945 11:126661991-126662013 TTTGGGTAAAGAGGAAAGAAGGG + Intronic
1090590117 11:128258660-128258682 TATCAGGAACTAGAAAAGGAGGG + Intergenic
1092846379 12:12588947-12588969 TAGGAGTAGGGAGGAAAGAAAGG + Intergenic
1094573039 12:31658844-31658866 TATGAATTATTAGAAAAGAAAGG + Intronic
1094774690 12:33711638-33711660 TATGAATACTTAGGAAACAAAGG - Intergenic
1095134764 12:38586735-38586757 TATGAGTGCCTAGAAAACAATGG - Intergenic
1097509369 12:60517731-60517753 TATGGTTAACTAGGCAGGAAGGG - Intergenic
1097717864 12:62985401-62985423 TATGAGAAATTAAGCAAGAATGG - Intergenic
1097868139 12:64577079-64577101 AATGATAAACTAAGAAAGAAGGG + Intergenic
1097879110 12:64671170-64671192 GATGAGGGACCAGGAAAGAAAGG + Intronic
1098195670 12:67999004-67999026 AATGAGTTACTAGTAAGGAAAGG + Intergenic
1098651413 12:72975284-72975306 TATGGCTAATTAGGCAAGAAGGG + Intergenic
1099480549 12:83160466-83160488 TTTGAGTAGTTTGGAAAGAAAGG + Intergenic
1100082541 12:90870481-90870503 AAGAAGTAAATAGGAAAGAAAGG - Intergenic
1102607481 12:114079506-114079528 TATGAGTTCCTATGAATGAAGGG + Intergenic
1105816566 13:24041654-24041676 TATCAGAAAGTAGAAAAGAAGGG + Intronic
1106822913 13:33486299-33486321 TATCATTATGTAGGAAAGAAAGG - Intergenic
1106829075 13:33558911-33558933 GATGAGTAACTTGGTTAGAAAGG - Intergenic
1107201259 13:37721087-37721109 TATGAATAGTTAGAAAAGAAAGG + Intronic
1107371176 13:39750239-39750261 TATGAGTAGCTAGGGATGACAGG + Intronic
1107640904 13:42442233-42442255 TTTCATTAACAAGGAAAGAAGGG - Intergenic
1107769080 13:43770595-43770617 TATGAGTTATTATGAAAAAATGG + Intronic
1107905758 13:45059748-45059770 TTTGATTAACTACGAAAGAGAGG - Intergenic
1108984772 13:56572779-56572801 TAAGAATAACTAGTAAAAAAGGG - Intergenic
1109569050 13:64162277-64162299 TTTGAGTAAATAGGAAATTAAGG - Intergenic
1109919240 13:69034515-69034537 TATGAGTAACATGGACAAAAAGG + Intergenic
1110386856 13:74922356-74922378 GCTGAGTAACTATGAAACAAGGG - Intergenic
1110870476 13:80446759-80446781 TATAAGTAACTAACAAATAATGG + Intergenic
1111489291 13:88949722-88949744 AATGAGTAAGTAGGAATGAATGG - Intergenic
1112550349 13:100414384-100414406 TTTTAGTAAATAGGAAAGCAGGG + Intronic
1112922996 13:104638798-104638820 TAAAAGTAACTATCAAAGAAAGG - Intergenic
1113348908 13:109508782-109508804 TATTTGTAACTGGTAAAGAAAGG - Intergenic
1114607718 14:24011377-24011399 AAAGAGAAACTGGGAAAGAAAGG - Intergenic
1114721332 14:24885457-24885479 TAAGAGTACCTAGGATAGACAGG + Intronic
1115472316 14:33780720-33780742 TAAAAGTAAATCGGAAAGAAAGG - Intronic
1115605498 14:34997779-34997801 TATGAGGAACTAGGAAAAAAAGG - Intronic
1116858625 14:49975914-49975936 TGTAAGGAACAAGGAAAGAATGG - Intergenic
1117518300 14:56524556-56524578 TATGAGCACCTAGAAAGGAAAGG - Intronic
1119376014 14:74193812-74193834 TATGAGTGGCCAGGAAACAAAGG - Intronic
1120313801 14:82865979-82866001 TATGAATAATTAGGAAACAGAGG - Intergenic
1120333314 14:83121465-83121487 TAGGGGTAACTTGGAGAGAAGGG + Intergenic
1122484525 14:102069787-102069809 TTTGAGTTAATAGGAAATAAGGG - Intergenic
1123111518 14:105869972-105869994 TCCGAGTACCTAAGAAAGAATGG - Intergenic
1123975028 15:25545283-25545305 AATGATTCACCAGGAAAGAAAGG + Intergenic
1125168804 15:36742156-36742178 TGTGAGATACTAGGAAAGGAAGG + Intronic
1125875884 15:43144071-43144093 TATGAGAAATTAGAAAAGCATGG + Intronic
1127465714 15:59242508-59242530 AATCAGTAAATAGGAGAGAAAGG + Intronic
1128300398 15:66563293-66563315 TCTGGGTAACTTGTAAAGAACGG - Intronic
1129687007 15:77692112-77692134 GATGAGTAAGTAAGAAGGAAAGG - Intronic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1148629350 17:49094595-49094617 CAAGATTAAATAGGAAAGAATGG - Intergenic
1148754376 17:49965010-49965032 CCTGAGTTACTAAGAAAGAAAGG + Intergenic
1149343530 17:55711417-55711439 TGTGATTAACTTGGAAAGGAAGG + Intergenic
1149347374 17:55751758-55751780 TAAGAGCAACTTGGAAGGAAGGG - Intronic
1149710172 17:58734530-58734552 TATAGGCAACTGGGAAAGAAAGG - Exonic
1150671505 17:67203331-67203353 TGTGAGTGACTTGGCAAGAATGG + Exonic
1151564728 17:74891816-74891838 TATGAATAAATAGGAAAGCTGGG - Intronic
1153528993 18:6024763-6024785 TTTGAGTAATTAGAAAAAAAAGG - Intronic
1154394360 18:13973342-13973364 TATGAGAAACTTGGGAACAAAGG + Intergenic
1155874826 18:31073548-31073570 TATGACAAATTAGAAAAGAAAGG - Intronic
1156686787 18:39659082-39659104 TTTGGGTAAGTAGAAAAGAAAGG + Intergenic
1156726291 18:40132204-40132226 TATCAGTAAAAATGAAAGAATGG + Intergenic
1157047732 18:44123101-44123123 TAATAGTAACTAGGAAAAAATGG + Intergenic
1157243637 18:46034440-46034462 TATGAGTAAGTAGTAAAGCTGGG - Intronic
1157350235 18:46877600-46877622 TATGAATAATTAGGTAGGAAGGG - Intronic
1157643991 18:49247980-49248002 TAGCAGTAACCAGGAAAGGAAGG - Intronic
1159123448 18:64196262-64196284 AATGAATAAATAAGAAAGAAAGG + Intergenic
1159716397 18:71828599-71828621 TGTGAGGTATTAGGAAAGAAAGG - Intergenic
1160051647 18:75439416-75439438 AATAAGTAACTGGGCAAGAAGGG + Intergenic
1165128375 19:33617021-33617043 TATGACTAACTTGCAAAGAAAGG - Intergenic
1165189684 19:34052288-34052310 TAGGAGAAGCTATGAAAGAAAGG + Intergenic
1165694245 19:37888506-37888528 GAAGAGAAACTAGCAAAGAAAGG - Exonic
1166438861 19:42792989-42793011 TCTGGGTAACAATGAAAGAAGGG - Intronic
1168118487 19:54239505-54239527 TCTGGGACACTAGGAAAGAAGGG - Intronic
1168442062 19:56377666-56377688 TATGAGTAACAAGAGAAGAATGG - Intronic
926546794 2:14251419-14251441 TCTGAGAAAACAGGAAAGAAAGG - Intergenic
926884943 2:17588376-17588398 ATGGAGTAACTAGGAAGGAAAGG + Intronic
928407663 2:31027098-31027120 GATGAGAAACTAGGAAACACAGG + Intronic
929899882 2:45991678-45991700 TGTGAATAATTATGAAAGAAAGG + Intronic
931241647 2:60459505-60459527 GATGATTAACTAGGACATAATGG + Exonic
933176148 2:79175490-79175512 TATTAGTAACTAGAGAAGAAAGG + Intergenic
933533387 2:83538921-83538943 TAGGAGGGACTAGAAAAGAAGGG + Intergenic
934151093 2:89148291-89148313 GCAGAGAAACTAGGAAAGAAGGG - Intergenic
935448580 2:103183924-103183946 TTTCAGGAAATAGGAAAGAAGGG + Intergenic
936745111 2:115566405-115566427 AATGAATAAATGGGAAAGAATGG - Intronic
939174445 2:138733300-138733322 TGAGAGTAACTCAGAAAGAACGG + Intronic
940433677 2:153625017-153625039 TATTTGAAAGTAGGAAAGAAAGG + Intergenic
940813714 2:158275116-158275138 TATGAGGAAGTAGGGATGAAGGG - Intronic
941027439 2:160473493-160473515 TATGATTAAGGAGGAAGGAAAGG + Intronic
941621424 2:167783601-167783623 TAAGAGCAAATAGGAAAGAAGGG + Intergenic
941812149 2:169765835-169765857 TTTTAGTAAGAAGGAAAGAATGG + Intronic
942526090 2:176854506-176854528 TACAAGTAACAAAGAAAGAAAGG + Intergenic
942823249 2:180141675-180141697 TATGAGAAACAAGCAAATAATGG + Intergenic
942900303 2:181108999-181109021 AATAAGTAACTGGAAAAGAAGGG - Intergenic
943183814 2:184578695-184578717 ACTAAGTAAATAGGAAAGAATGG + Intergenic
944464982 2:199992007-199992029 TATATGTAAATAGCAAAGAACGG + Intronic
945782112 2:214188036-214188058 TATGAGAAACTGGGATAGATAGG + Intronic
946145585 2:217728398-217728420 CATGAGGAACCATGAAAGAAAGG + Intronic
947020953 2:225674957-225674979 TATGTGTTAACAGGAAAGAAAGG + Intergenic
1168880879 20:1205003-1205025 TCTGAGGAATTAGGAAAAAATGG + Intronic
1169912682 20:10660148-10660170 TATAAGTGACCAGGAGAGAAGGG + Intronic
1171355465 20:24542122-24542144 TATGACTAAGTATGAATGAAAGG - Intronic
1172016260 20:31875474-31875496 GATCAGTAACTAGGAAAGAGTGG - Intronic
1174282262 20:49447777-49447799 TTTGAGAAAGAAGGAAAGAAAGG - Intronic
1175532536 20:59684037-59684059 GATGAGAACCTTGGAAAGAAAGG + Intronic
1176900333 21:14433963-14433985 AATAAGTAATTAGGAGAGAATGG + Intergenic
1176963735 21:15188717-15188739 TATAGGGAACGAGGAAAGAAAGG - Intergenic
1179299605 21:40094735-40094757 TAAGAATAATTAGGAAAGACTGG - Intronic
1181642109 22:24207415-24207437 TCTCAGCAACTAGGAATGAAAGG - Intergenic
1181929552 22:26389492-26389514 TATTAGAGACTAGGAAAGGATGG + Intergenic
1182560549 22:31155882-31155904 TATGATTAACGCAGAAAGAAGGG + Intergenic
950861958 3:16155923-16155945 TCTGAGGAATTAGGAAAGAATGG + Intergenic
951959073 3:28294913-28294935 TATGGGTAACAAAGAAAGAAGGG - Intronic
955840278 3:63105463-63105485 TATGAGTAACTTGGATAAACAGG + Intergenic
957859028 3:85919356-85919378 TCTGAGTATCAAGGAAAGGAAGG + Intronic
958716673 3:97791856-97791878 TATGAATAAAAAGGAAACAAAGG - Intronic
958859399 3:99427893-99427915 TATGAGTAAAAAGGAGATAATGG - Intergenic
959441339 3:106379043-106379065 TATAATTCAATAGGAAAGAAGGG - Intergenic
959571617 3:107890779-107890801 TTTGGGTAAGGAGGAAAGAATGG + Intergenic
961844279 3:129748033-129748055 TTTGAATAACTAGGAAAACATGG + Intronic
963658887 3:148098341-148098363 GATTAGCAACTAGGAAATAACGG - Intergenic
964236829 3:154541112-154541134 TATGACTCATTAGGAAAGACAGG + Intergenic
967364032 3:188665320-188665342 TATTAGGAAAAAGGAAAGAATGG + Intronic
967368956 3:188720963-188720985 TAAGGGTGACTAGGAAAGAAAGG - Intronic
970337618 4:15066397-15066419 TCTGTTTAACAAGGAAAGAAAGG + Exonic
970705756 4:18800084-18800106 TTTGAGTAGCAAGGACAGAACGG + Intergenic
970929902 4:21497362-21497384 CATGAGTTACTTGGTAAGAATGG - Intronic
974193700 4:58541191-58541213 TATGGGAAATTAAGAAAGAATGG - Intergenic
976100903 4:81562186-81562208 TCTGAGTAATTTGGAAGGAAAGG - Intronic
976507874 4:85870578-85870600 GATGAGTTAGTAGAAAAGAAGGG - Intronic
976572116 4:86624575-86624597 TCTGAGTAATTAGGAAAGTCTGG + Intronic
976858493 4:89632503-89632525 TATGAGAATCCAAGAAAGAAAGG + Intergenic
977278203 4:95005622-95005644 AAAGAAAAACTAGGAAAGAAAGG - Intronic
979807076 4:124987611-124987633 TATAAGAAAATAAGAAAGAAAGG + Intergenic
979824759 4:125219269-125219291 TTGGAGTAACTAGCAAAGTATGG - Intergenic
981371954 4:143968830-143968852 TATGAGGACCTAGGCAAGGAGGG + Intergenic
981381045 4:144072029-144072051 TATGAGGACCTAGGCAAGGAGGG + Intergenic
981662183 4:147180915-147180937 TATTATTAAATAAGAAAGAATGG + Intergenic
981807858 4:148737879-148737901 TATGAGGAAATTGGAAACAAAGG + Intergenic
982366248 4:154582627-154582649 TCTGAATAACTAGAAATGAATGG + Intergenic
982588007 4:157267091-157267113 TTTGAGAATCTAGGAAAAAAAGG + Intronic
983035597 4:162861834-162861856 TATGAGTAGATAAGAAAAAAAGG - Intergenic
983568635 4:169180963-169180985 TGTGAGTAAAGAGAAAAGAAAGG - Intronic
986060592 5:4186578-4186600 TATGAGAAACTGGGACACAAAGG + Intergenic
986751420 5:10791345-10791367 TATCAATAACTAGGAAGGGAAGG - Intergenic
986801180 5:11261744-11261766 TATTGGTAAATAGGAAAGAAAGG + Intronic
987996743 5:25292114-25292136 TATGACATACTAGGCAAGAATGG - Intergenic
989034698 5:37157977-37157999 TATTAAAAACAAGGAAAGAAGGG + Intronic
991550735 5:67833264-67833286 TATGAAACAATAGGAAAGAAAGG + Intergenic
992057340 5:73003683-73003705 TATTAGGAACAAGCAAAGAAGGG + Intronic
993591298 5:89798632-89798654 TTTGCTTCACTAGGAAAGAAAGG + Intergenic
994956031 5:106533809-106533831 TTTGAGTAACTAGAAAAAGAAGG - Intergenic
995015127 5:107301420-107301442 TGCCAGTAAATAGGAAAGAATGG - Intergenic
995751006 5:115453333-115453355 TACCAATAACAAGGAAAGAAGGG + Intergenic
995857065 5:116604682-116604704 TTTTAGTATCTAGGAAAAAAGGG - Intergenic
996047659 5:118893496-118893518 TATGTGGAAATAAGAAAGAAGGG + Intronic
996230906 5:121061998-121062020 CAAGTGTAACTGGGAAAGAAAGG + Intergenic
996496184 5:124159510-124159532 TATAAGTAAAAATGAAAGAAGGG - Intergenic
996538013 5:124598462-124598484 TATTGGTAACAAAGAAAGAAAGG - Intergenic
997475354 5:134139365-134139387 TATGAGTAACTGAGGAAGAAAGG + Intronic
997681920 5:135762627-135762649 TGCGGGTAACTATGAAAGAATGG + Intergenic
997809991 5:136957644-136957666 TATGAGTAGCAAGGCAAGAGGGG + Intergenic
998825605 5:146098309-146098331 GATGATTAACTTGGAAACAAAGG + Intronic
999429835 5:151516565-151516587 TATGAGCAAAAAGGAAAAAATGG - Intronic
1000195388 5:158952179-158952201 TTACAGTAAATAGGAAAGAAAGG + Intronic
1000523674 5:162328779-162328801 TAGGAGTAACTGAGAAAGACGGG + Intergenic
1002005599 5:176231341-176231363 AGTGAGGAAGTAGGAAAGAAAGG - Intergenic
1003626896 6:7749403-7749425 TATGTGGAAATAGGAATGAAGGG - Intronic
1003763668 6:9211226-9211248 CATGTGTAACGAGGAAAGGAGGG + Intergenic
1004435588 6:15589910-15589932 TATGAGTAGTTAGGAAATAAAGG - Intronic
1004560781 6:16748181-16748203 TATGAGTAAGAGTGAAAGAAAGG + Intronic
1005245316 6:23877499-23877521 TATTAGTAACTGGCAGAGAAAGG + Intergenic
1005271350 6:24167129-24167151 TTTTAGTGAGTAGGAAAGAATGG + Intergenic
1005525832 6:26647548-26647570 TATGATTAACTATAAAATAAGGG + Intronic
1005948167 6:30610339-30610361 TATCAGCAACTAGGGAAGACAGG - Intronic
1006346637 6:33487773-33487795 TATGACTAAAAAGGAAGGAAAGG + Intergenic
1007879453 6:45146825-45146847 CATAAGTAAGTAGGAGAGAATGG + Intronic
1008206824 6:48670259-48670281 TATGAGGAACTAGAAAAAATGGG + Intergenic
1008318555 6:50078154-50078176 TACCAGGAACTGGGAAAGAAAGG + Intergenic
1008399086 6:51043017-51043039 TAAGGGTAACTAGCAAGGAATGG - Intergenic
1008630875 6:53361970-53361992 TATGAATAACTAGTAAAGGAAGG + Intergenic
1008980386 6:57476528-57476550 CATTAATAAATAGGAAAGAATGG - Intronic
1009568099 6:65340207-65340229 TATGAGTTACTGGGAAGGGAAGG - Intronic
1009589905 6:65654276-65654298 TGTGAGTAACTATTACAGAAAGG - Intronic
1009873213 6:69473756-69473778 TATCTTTGACTAGGAAAGAAGGG - Intergenic
1009879294 6:69544977-69544999 TCTGTGGAAGTAGGAAAGAATGG + Intergenic
1012053059 6:94368213-94368235 TAAGAGTGACTAGGAAGAAATGG - Intergenic
1013018319 6:106181896-106181918 TATGAGTAAGTAGGAATTCAAGG - Intergenic
1014066628 6:117134592-117134614 AATGAGAAACTAGGGAAGAGAGG + Intergenic
1014660128 6:124159709-124159731 AAGGAGGAACTAGGAAACAAAGG + Intronic
1014991134 6:128078457-128078479 TATGAGAAACTAGGTAGGCAGGG - Intronic
1015118700 6:129677439-129677461 TATTATGAACAAGGAAAGAAGGG - Intronic
1015423068 6:133033696-133033718 AAGGAGTAGCTGGGAAAGAAAGG + Intergenic
1016023214 6:139257288-139257310 TATGAGTAGCTATAAAAGACTGG - Intronic
1016076330 6:139800790-139800812 TGTGTGTAAGTAGGAGAGAATGG + Intergenic
1020082259 7:5292628-5292650 TATTAGTAATTAGGCAAGAAAGG - Intronic
1020580467 7:9992894-9992916 TATGAGAACTGAGGAAAGAAAGG - Intergenic
1020973804 7:14981215-14981237 TATGAGTACATAGCTAAGAATGG + Intergenic
1021272522 7:18608484-18608506 TATGAATAAGTGGGAAATAATGG - Intronic
1021835310 7:24666808-24666830 AATAAATAAATAGGAAAGAAGGG + Intronic
1021852744 7:24824584-24824606 GATGAGTGACCTGGAAAGAATGG - Intronic
1022225239 7:28356113-28356135 TATAAATAAATAGGAAAGAACGG + Intronic
1022789973 7:33677891-33677913 TATTAGTAACTGTGAAACAAAGG - Intergenic
1022847335 7:34223338-34223360 TTTGAATAAGAAGGAAAGAAAGG - Intergenic
1023159272 7:37281913-37281935 TATGAGTAAATATGACAGCAGGG - Intronic
1025032460 7:55569123-55569145 TCTGAGTTAATAGAAAAGAAAGG + Intronic
1025196667 7:56939519-56939541 TATTAGTAATTAGGCAAGAAAGG + Intergenic
1025675280 7:63637418-63637440 TATTAGTAATTAGGCAAGAAAGG - Intergenic
1028658940 7:93244932-93244954 TATGATTTGCTATGAAAGAAGGG - Intronic
1028714055 7:93943701-93943723 TATGATTAATTAGTAAGGAATGG - Intergenic
1028938104 7:96488265-96488287 GATGAGTACCTCAGAAAGAAAGG + Intronic
1029305114 7:99613437-99613459 TATAAATAACCAGAAAAGAATGG + Intergenic
1030171590 7:106608209-106608231 TAAGAGAAACTAGGAAAGCGAGG + Intergenic
1031714195 7:125086825-125086847 TTTGAAGAAATAGGAAAGAAGGG + Intergenic
1032479783 7:132236990-132237012 CCTGAGGAACTAGGGAAGAAAGG + Intronic
1032571199 7:133000342-133000364 TATGAGTAACTGAGACAAAAAGG + Intronic
1032607144 7:133367813-133367835 TGTGAGTAATTAGGAAAGAGTGG + Intronic
1032612611 7:133431545-133431567 CAAGAGTGATTAGGAAAGAAAGG - Intronic
1033714801 7:143989178-143989200 TCTGAGAAACTAGGACACAAAGG + Intergenic
1035872097 8:3146737-3146759 AATGAGTAATTAGGAAAGCCAGG + Intronic
1038968349 8:32602495-32602517 TTTGTATAAATAGGAAAGAAAGG + Intronic
1039021847 8:33216690-33216712 TATTAGCATCTAGGTAAGAAAGG + Intergenic
1041234992 8:55791879-55791901 TGTAAGTAACAAGGAAAGAATGG + Intronic
1041364769 8:57090591-57090613 TTGGAGGAACTAGTAAAGAAAGG + Intergenic
1043190136 8:77210257-77210279 TGTGAAAAACAAGGAAAGAATGG + Intergenic
1043958303 8:86388184-86388206 TAAAAGTAAGTAGGAAGGAAAGG - Intronic
1044002018 8:86894436-86894458 TATGGGAAACTAGGAAGGAGGGG - Intronic
1044012244 8:87008704-87008726 TAGGAGCAATTAAGAAAGAATGG + Intronic
1044220243 8:89662214-89662236 TATAAGCAATTAGGAAAAAAGGG + Intergenic
1045241674 8:100408060-100408082 TATCAGTAAGAAAGAAAGAATGG - Intronic
1045268021 8:100637111-100637133 TATGAGTAAGTGGGAGAGAAGGG - Intronic
1046228923 8:111327194-111327216 CATGACTAACTAGCAAAGACAGG - Intergenic
1047292089 8:123540346-123540368 GATGAGTAACCAGGAAGGGACGG - Intronic
1047562706 8:126007118-126007140 GAGGAGGAAGTAGGAAAGAAAGG + Intergenic
1050085416 9:1959958-1959980 TATGAAGAAATTGGAAAGAATGG + Intergenic
1052265700 9:26569980-26570002 AATGAGTAAATAGAAAGGAAAGG + Intergenic
1055605156 9:77961623-77961645 TTTAAGTAACTATGAAAGAGAGG + Intronic
1056099360 9:83286121-83286143 TTTGAGAAACTTGAAAAGAATGG + Intronic
1057983714 9:99688084-99688106 TATGAGTAGCTGGAATAGAAAGG - Intergenic
1058136130 9:101309530-101309552 TATAAGTGACAATGAAAGAATGG - Intronic
1059112890 9:111573546-111573568 TACGAGAAAGTAGGAAAAAAAGG - Intronic
1059288580 9:113200381-113200403 TTTGGGAACCTAGGAAAGAAAGG + Intronic
1185650863 X:1647045-1647067 AAAGAGAAACAAGGAAAGAAAGG - Intergenic
1185711959 X:2311599-2311621 TGTAAGTAAAGAGGAAAGAAAGG + Intronic
1186441416 X:9590073-9590095 TAAGAGTGACAAGGGAAGAACGG + Intronic
1188187722 X:27135623-27135645 TATAATAAACTAGGAAAGGAAGG - Intergenic
1188694386 X:33172038-33172060 TGTGAGTAACTAGAAATGCATGG + Intronic
1189502127 X:41571706-41571728 TAAAAGTAACTAGGACAAAATGG - Intronic
1189615073 X:42774761-42774783 TAGGACTAAAGAGGAAAGAAAGG - Intergenic
1189646723 X:43141055-43141077 TAGAAGTAATTTGGAAAGAAAGG - Intergenic
1192043469 X:67647014-67647036 GATGAGAAAATAGAAAAGAAAGG - Intronic
1192430829 X:71110486-71110508 TCTGGGTAATTTGGAAAGAAAGG - Exonic
1193641567 X:84015184-84015206 AATGAGAAACTAGCAAAAAAAGG + Intergenic
1194974161 X:100376315-100376337 TATGAGTAGTTAGAAAAGATTGG + Intronic
1195102746 X:101571558-101571580 GATCAGTAATAAGGAAAGAATGG - Intergenic
1195102769 X:101572058-101572080 GATCAGTAATAAGGAAAGAATGG - Intergenic
1196253725 X:113491797-113491819 TTTGAAAACCTAGGAAAGAAAGG + Intergenic
1196910928 X:120483549-120483571 GAAGAGAAACTTGGAAAGAATGG - Intergenic
1197123224 X:122915243-122915265 TATTAGAAACTAGGAAGGGAGGG - Intergenic
1197165203 X:123369425-123369447 TCTGAGCAACTGGGAAAAAAGGG - Intronic
1197697094 X:129562030-129562052 CATCAGAAACTAGGAAGGAAAGG + Intronic
1198273562 X:135079223-135079245 TATGAGCAAATAAGAAACAAAGG - Intergenic
1199613420 X:149636291-149636313 TATTAGAAACTTGGAAAGAAAGG - Intergenic
1200841572 Y:7786527-7786549 TAGCAGTAACCAGGCAAGAAGGG - Intergenic