ID: 921573117

View in Genome Browser
Species Human (GRCh38)
Location 1:216802232-216802254
Sequence CAAGTTTTACCCAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921573112_921573117 -7 Left 921573112 1:216802216-216802238 CCATATGGAGGCCAAGCAAGTTT 0: 1
1: 0
2: 0
3: 7
4: 77
Right 921573117 1:216802232-216802254 CAAGTTTTACCCAGGGAAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921573117 Original CRISPR CAAGTTTTACCCAGGGAAGA GGG Intronic
904108984 1:28110244-28110266 CAAGTTTTACTCAGTGAATGTGG + Intergenic
906042564 1:42799377-42799399 AAAGTTATATCCAGGGTAGAAGG - Intergenic
913663709 1:121028796-121028818 CAGGTCCTACCCATGGAAGATGG + Intergenic
914015107 1:143812076-143812098 CAGGTCCTACCCATGGAAGATGG + Intergenic
914162714 1:145149149-145149171 CAGGTCCTACCCATGGAAGATGG - Intergenic
914653724 1:149720616-149720638 CAGGTCCTACCCATGGAAGATGG + Intergenic
915801162 1:158794896-158794918 CATATGTTACCCAGGGAAGGTGG + Intergenic
917208765 1:172608781-172608803 CAAGTTTTCTCCAGAAAAGAAGG + Exonic
917857172 1:179110170-179110192 CATGCTTTCCCCAGGGAGGACGG + Intronic
918437971 1:184536201-184536223 GAAGTTTGACCCAGGTCAGATGG - Intronic
919025937 1:192170457-192170479 GAAGTTTTACTCACGGAGGAAGG - Intronic
920770811 1:208883324-208883346 CAAGTTATCGCCAAGGAAGAAGG + Intergenic
921573117 1:216802232-216802254 CAAGTTTTACCCAGGGAAGAGGG + Intronic
924907403 1:248470849-248470871 CAACTTTTCCCCACGAAAGATGG + Intergenic
924916709 1:248577252-248577274 CAACTTTTCCCCACGAAAGATGG - Intergenic
1062983838 10:1748205-1748227 AAAGTTTTTCCTAAGGAAGAGGG - Intergenic
1067701129 10:48573209-48573231 AAAGTTCCACCCAGGGGAGAAGG + Intronic
1068566466 10:58580961-58580983 AAGGTTTTAATCAGGGAAGAGGG + Intronic
1070236454 10:74632580-74632602 AAAGATATACACAGGGAAGAAGG - Intronic
1072222213 10:93335959-93335981 CAAGTTGTACCGAGGCAAGTCGG - Exonic
1073403692 10:103278330-103278352 CCAGTTTTACCAGAGGAAGAGGG - Intronic
1075628899 10:123987697-123987719 GAAGTTTTACTCATGGCAGAAGG + Intergenic
1075646818 10:124102322-124102344 CAAGTGGGACCCAGAGAAGAAGG - Intergenic
1077395788 11:2320529-2320551 CTAGCTTTTCCCAGGGACGAAGG - Intergenic
1078649204 11:13171689-13171711 CCAGTTATACCCAGGGAGAAAGG - Intergenic
1080445256 11:32332309-32332331 CAAAAATTAGCCAGGGAAGATGG + Intergenic
1080643635 11:34173135-34173157 CAAGTATGAACCAGGGAGGAGGG - Exonic
1081886556 11:46502501-46502523 TAACTTGTACCCAAGGAAGAGGG - Intronic
1082805679 11:57448433-57448455 GAAGTTTTACTCATGGCAGAAGG + Intergenic
1086427796 11:86703989-86704011 CAAGTTTTCCCCAAGGCAAAGGG - Intergenic
1086729410 11:90229064-90229086 GAAGTTTTACTCATGGTAGAAGG + Intergenic
1088142710 11:106636704-106636726 CTATTTGTACCCTGGGAAGAGGG - Intergenic
1089457579 11:118634414-118634436 AAAATTTAACCCAGGGAAAAAGG - Intronic
1089577024 11:119452085-119452107 CAAGATTTAGGCAAGGAAGAGGG - Intergenic
1089881013 11:121773791-121773813 CATGTATTACCCAGAGGAGATGG - Intergenic
1095373337 12:41496290-41496312 CAAGAGTTACCCAGGAAGGAAGG + Intronic
1096968481 12:55647273-55647295 AAAGTTTTGCCCAGGGACCAGGG + Intergenic
1102073822 12:110044257-110044279 CAAGATTTAGCCAGGCAAGGGGG + Intronic
1105627989 13:22132392-22132414 GAATTTTTACCAAGGGAGGAGGG - Intergenic
1105709345 13:22991515-22991537 GAAGTTTCAACCAAGGAAGATGG + Intergenic
1109342850 13:61084040-61084062 AAACTTTTACACATGGAAGACGG + Intergenic
1112406318 13:99123740-99123762 CTAGTTCTCCCCAGGGAAGGAGG + Intergenic
1117544768 14:56783727-56783749 CCAGTTTCACCTGGGGAAGATGG - Intergenic
1118710446 14:68514517-68514539 GAACTTTTAGCCAGGGAAGCCGG - Intronic
1120079152 14:80195953-80195975 CAAGTTCTTCCCTGGGAATAAGG + Intergenic
1124649168 15:31462305-31462327 GAATTTCTACCCAGGGGAGATGG - Intergenic
1125038154 15:35151112-35151134 CAACTTTAACCCGGGGAAGTGGG + Intergenic
1127585539 15:60374508-60374530 CCAGTTTCACCCAGGGACAATGG - Intronic
1128763791 15:70238326-70238348 CAGGACTTACCCAGGGAGGAAGG - Intergenic
1130067118 15:80614067-80614089 CAAGGATGACCCAGGGAACATGG + Intergenic
1132264900 15:100461228-100461250 CTAGTTTTACCCAGTGACTAAGG - Intronic
1132875053 16:2133509-2133531 TGGGTTTTCCCCAGGGAAGAGGG - Intronic
1134519936 16:14913881-14913903 TGGGTTTTCCCCAGGGAAGAGGG + Intronic
1134553995 16:15152356-15152378 TGGGTTTTCCCCAGGGAAGAGGG - Intergenic
1134707608 16:16312535-16312557 TGGGTTTTCCCCAGGGAAGAGGG + Intergenic
1134959935 16:18399590-18399612 TGGGTTTTCCCCAGGGAAGAGGG - Intergenic
1135141199 16:19923575-19923597 CAGGTTTTGCCCAGGGAGGATGG + Intergenic
1135497562 16:22965716-22965738 CAAGTGTTACAAAGGGAAAATGG + Intergenic
1135953194 16:26934477-26934499 CAAGTCTTCCCAAGGGTAGATGG + Intergenic
1138302561 16:55944725-55944747 GAAGCTGTACCCAGGGAAGATGG - Intronic
1138824391 16:60301380-60301402 CAAGTTATACCTAGAGAAGCTGG + Intergenic
1138945953 16:61850176-61850198 GAAGTTTTACTCATGGCAGAAGG + Intronic
1139067440 16:63335619-63335641 CAAGGTTTTCCTAGGTAAGAAGG + Intergenic
1139122965 16:64042888-64042910 CCAGCTATACCCAGGGAGGATGG + Intergenic
1140465068 16:75174920-75174942 TGAGTTTTACCCAGGTGAGAAGG - Intergenic
1141208899 16:81957983-81958005 CAAGTTTTACTCATAGAAGCTGG + Exonic
1141426866 16:83949793-83949815 TCAGTTTTACCCAGGGGAAATGG - Intronic
1144210486 17:13010652-13010674 CAGGTGTTAGCCAGAGAAGAGGG - Exonic
1147951482 17:44110342-44110364 CAAGTTTGGGCAAGGGAAGAAGG - Intronic
1148559880 17:48599869-48599891 CAAGTTCTGCCCACTGAAGATGG + Intronic
1149327513 17:55547230-55547252 CAATGTATAACCAGGGAAGAGGG - Intergenic
1149875486 17:60228527-60228549 CAAGTTTTGGCCAGGGATGGTGG + Intronic
1150498214 17:65625520-65625542 CAGGTTTGAGTCAGGGAAGAAGG - Intronic
1158016268 18:52788187-52788209 TAAATTTTGCCCAGGGATGAGGG - Intronic
1161299412 19:3535697-3535719 CAAGTCTTGCGCAGGGAAGGAGG - Intronic
1164838889 19:31377522-31377544 CAAGGTTAACCCAGGAAGGAAGG - Intergenic
1165487989 19:36106967-36106989 CAAGCTTTGCCCAGGGATGTTGG - Intergenic
1168529296 19:57114858-57114880 CAAGTTTAACAAAAGGAAGAAGG + Intergenic
929785209 2:44984840-44984862 CAAGCTATGCCAAGGGAAGAGGG + Intergenic
931223057 2:60305765-60305787 CAAGTTTTTCAGAGGGGAGATGG + Intergenic
933400407 2:81789192-81789214 CAAGATTTTCCCAAGGATGAAGG + Intergenic
934159330 2:89233540-89233562 TACGTTTTTCCCAGTGAAGAGGG - Intergenic
934207943 2:89948892-89948914 TACGTTTTTCCCAGTGAAGAGGG + Intergenic
936936768 2:117846521-117846543 GAACTTTTAAACAGGGAAGATGG - Intergenic
937192487 2:120117235-120117257 CAGGTTTCTCGCAGGGAAGAAGG - Intronic
937928657 2:127187944-127187966 CCAGTTTTACCCTGGGAGGCAGG - Intronic
937928788 2:127188707-127188729 CCAGTTTTACCCTGGGAGGCAGG - Intronic
940467354 2:154048078-154048100 AAAGTTTTAACCATGGCAGAAGG + Intronic
942243902 2:173989928-173989950 CAAGTTTAGGCCAAGGAAGAGGG + Intergenic
942826728 2:180186853-180186875 CAAGTTTTAGCCAGGCATGGTGG + Intergenic
943456640 2:188116185-188116207 CTAGTTATACTCAGGGTAGAAGG - Intergenic
945843521 2:214916058-214916080 AAAATATTACCCAGGGAAAAGGG + Intergenic
946110833 2:217414535-217414557 GAGCTTTTACTCAGGGAAGAAGG + Intronic
946585193 2:221178202-221178224 CAAGATTTCCCTAGTGAAGAAGG + Intergenic
947502486 2:230681594-230681616 CTAGGATTACCCAGTGAAGATGG + Intergenic
948275989 2:236709214-236709236 CAAGTGTTAGCCAGGCAAGAAGG + Intergenic
948574969 2:238943995-238944017 TAGGTTTTAACCAGGGAGGAGGG - Intergenic
1170205371 20:13792276-13792298 CAAGTTTCAGACAGGGAAGTGGG + Intronic
1172117106 20:32579606-32579628 CAGCTCCTACCCAGGGAAGAAGG + Intronic
1172207714 20:33176290-33176312 CAGGTTTGACTCAGGCAAGAGGG + Intronic
1174396575 20:50250528-50250550 CCAGTTTGGGCCAGGGAAGAAGG - Intergenic
1176005227 20:62858636-62858658 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005236 20:62858666-62858688 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005245 20:62858696-62858718 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005254 20:62858726-62858748 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005263 20:62858756-62858778 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005272 20:62858786-62858808 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005281 20:62858816-62858838 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176005290 20:62858846-62858868 CAGGTGTTTCCCAGGGAGGAAGG + Intronic
1176908000 21:14527456-14527478 CACGTTTTATCCAGGGATAAAGG + Intronic
1178728637 21:35078705-35078727 AGAGTTTTATCCAGGAAAGAAGG - Intronic
1181328301 22:22068585-22068607 AAATATTTACCCAAGGAAGATGG - Intergenic
1181949984 22:26546852-26546874 TAAATTTTATCAAGGGAAGAGGG + Intronic
1182619575 22:31611510-31611532 CCAGTGTCTCCCAGGGAAGACGG + Intronic
1183658393 22:39204292-39204314 CAACTTTGACCAAGTGAAGATGG - Intergenic
949925878 3:9041248-9041270 CTAAGTTTACCCAGGGAAGCTGG + Intronic
952198421 3:31100059-31100081 AAAGTATTACCCAGGTAAAACGG - Intergenic
952326406 3:32324343-32324365 CAAGTTATTCCCAGAGAAAAAGG + Intronic
952829745 3:37554600-37554622 TGAGCGTTACCCAGGGAAGAGGG + Intronic
953702522 3:45207829-45207851 CAGGCTATACCCAGGGAAGTGGG - Intergenic
953781548 3:45875789-45875811 TAAGTTTGACCCAGAGTAGAAGG + Intronic
957042725 3:75348768-75348790 CACCTTTTACCCAGAAAAGAGGG + Intergenic
961618730 3:128206224-128206246 CAGATTTTGCCCAGGGCAGATGG - Intronic
965019453 3:163209474-163209496 CTAATTTTATCCAGGGAAAAAGG - Intergenic
967269715 3:187723014-187723036 AAAGTGTTACCCACTGAAGAAGG - Intronic
970990204 4:22204261-22204283 CAGGTTTTCCCAAGGGAAGCAGG + Intergenic
971388683 4:26165479-26165501 CAAGGGTTACCTAGGTAAGATGG + Intronic
973118713 4:46491459-46491481 CAAGTTTTTCCCACAAAAGATGG - Intergenic
975358930 4:73443452-73443474 CAAGTTCTATCTAGGGAAGAGGG + Intronic
977736636 4:100424961-100424983 CACGTTTTAAGCAGGGAAGTTGG - Intronic
987138393 5:14920830-14920852 CAATTTTTACACAGGGATGTGGG - Intergenic
988538131 5:32087153-32087175 CATCTCTTCCCCAGGGAAGAAGG + Exonic
989465763 5:41753557-41753579 GAAGGTTTTCCTAGGGAAGATGG - Intronic
990073036 5:51808529-51808551 TAACTTTTACCCAGGGAAGTGGG - Intergenic
992362786 5:76058345-76058367 CAAGTTTTTTCCAGGGTTGATGG - Intergenic
992761595 5:79955584-79955606 CAAACTTAATCCAGGGAAGACGG - Intergenic
993414340 5:87607941-87607963 CAATCTTTACCTAGGGAACAGGG - Intergenic
995106495 5:108381894-108381916 CATGCTTTGCCCAGGGAAGCCGG + Exonic
995818094 5:116194421-116194443 CAAGTTTAACCAAGAAAAGAAGG + Intronic
996476428 5:123927563-123927585 TAAATTTTGCCCAGGGATGAAGG - Intergenic
999038923 5:148385068-148385090 CATGATTTTCCCAGGGAAGGAGG + Intronic
999322353 5:150623536-150623558 CATCTTGTACCCAGGGTAGAGGG - Intronic
1003450195 6:6223593-6223615 TAAATATAACCCAGGGAAGAAGG - Intronic
1003513075 6:6797561-6797583 GAAGTTTTACTCACGGCAGAAGG - Intergenic
1006657574 6:35608948-35608970 CAAGATTTAGCCAGGCATGATGG - Intronic
1008831639 6:55770888-55770910 CAAATTTTACCCATATAAGATGG - Intronic
1010044881 6:71430005-71430027 CAAGTTTCACACTGGGATGATGG - Intergenic
1010193194 6:73214238-73214260 CAAATTCTAGCCAGGCAAGATGG + Intronic
1016587446 6:145705895-145705917 CAAGATATACCAAGGAAAGATGG + Intronic
1016882972 6:148929228-148929250 CAAGTTTTACCCTAAGAGGAAGG + Intronic
1018299832 6:162389327-162389349 CAATCATTACCTAGGGAAGAAGG - Intronic
1018617839 6:165704785-165704807 CAAGTCTGAAACAGGGAAGATGG - Intronic
1020637863 7:10718104-10718126 GAAGTTTTATTCAGGAAAGAGGG - Intergenic
1021289426 7:18824405-18824427 GAAGTTTAACCCAGATAAGAAGG + Intronic
1021436657 7:20625057-20625079 CAACTTTTATCAAGAGAAGAGGG + Intronic
1021458142 7:20852496-20852518 CAACTTTTACCCAGAGATTATGG + Intergenic
1022677010 7:32510369-32510391 CAAATCTTACCCTGGGGAGATGG - Intronic
1022677060 7:32510645-32510667 CAAATCTTACCCTGGGGAGATGG - Intronic
1022677078 7:32510737-32510759 CAAATCTTACCCTGGGGAGATGG - Intronic
1022677131 7:32511013-32511035 CAAATCTTACCCTGGGGAGATGG - Intronic
1022677150 7:32511105-32511127 CAAATCTTACCCTGGGGAGATGG - Intronic
1022677183 7:32511289-32511311 CAAATCTTACCCTGGGGAGATGG - Intronic
1022837059 7:34128193-34128215 TAAGTTTTACCCAGGCAAAGAGG - Intronic
1022992504 7:35722285-35722307 GAGGTTATATCCAGGGAAGAGGG + Intergenic
1023153242 7:37222165-37222187 CATGTTTTTCCCAAGGAAGGAGG - Intronic
1024453373 7:49575421-49575443 CAAATTTCACCCAGGGAGCAAGG - Intergenic
1027409571 7:77900990-77901012 GAAGCTTTACCCATGGCAGAAGG + Intronic
1028715929 7:93968477-93968499 CATGTTTTTCCCACAGAAGAAGG - Intronic
1030305189 7:108010752-108010774 GTATTTTTACCCTGGGAAGATGG + Intergenic
1031913807 7:127544016-127544038 AAAGTATTAGCCAAGGAAGAGGG + Intergenic
1032014006 7:128364797-128364819 CAAGTTATACAAAGAGAAGAGGG + Intergenic
1033545364 7:142394644-142394666 CCAGGTCTACACAGGGAAGAAGG - Intergenic
1035819812 8:2579276-2579298 CAAGTTTTAGATGGGGAAGATGG - Intergenic
1039459879 8:37735320-37735342 AAACTTTTACACCGGGAAGATGG - Exonic
1041308483 8:56489168-56489190 GAAGTTTTACTCATGGCAGAAGG - Intergenic
1041585625 8:59514146-59514168 CAACTTTTATCCAGGTAATATGG + Intergenic
1044927732 8:97223809-97223831 CAGGTTTAACACAGGGAAGAGGG - Intergenic
1045019282 8:98027704-98027726 GAAGTTTTACCCAAGGAGAAGGG + Exonic
1046050855 8:109020882-109020904 GAACTTTTACTCATGGAAGAAGG + Intergenic
1050678070 9:8078985-8079007 CAATTTTTACTCAAGGAAGAAGG + Intergenic
1051153467 9:14112971-14112993 CAAGTTTCACCCAGGTGTGACGG - Intronic
1052245785 9:26332571-26332593 TAAGTTTTAAACAGGGAAGCTGG + Intergenic
1052275187 9:26667376-26667398 CAAGTATTAGCCAGGCATGATGG - Intergenic
1053413108 9:37928452-37928474 CGAGTATTCCCCAGGGAAGAGGG - Intronic
1057207597 9:93183060-93183082 CAACTGTTACCCAGAGAAGCAGG - Intergenic
1058638810 9:107063304-107063326 CAAGTTGTGCCCATGTAAGAGGG - Intergenic
1058893991 9:109384094-109384116 CATGTTTTCCACCGGGAAGATGG + Intronic
1059357628 9:113712074-113712096 CAAGTTTACTCCAAGGAAGAAGG + Intergenic
1060134190 9:121135969-121135991 CAAGACTTACCCAGGTAAGTAGG + Exonic
1188238410 X:27755977-27755999 AAACTTTTACTCATGGAAGAAGG + Intergenic
1189524599 X:41806753-41806775 CACCTTTTATCCAAGGAAGAGGG + Intronic
1189941206 X:46123409-46123431 GAAATTTTACCCAGGGAATTAGG - Intergenic
1196847195 X:119905615-119905637 CAAGTGTGGCCGAGGGAAGAAGG - Intronic
1197663728 X:129200750-129200772 CAGGCCTTGCCCAGGGAAGATGG - Intergenic
1198104046 X:133445808-133445830 CTAGTGTTTCCCAGGTAAGAAGG + Intergenic
1198881051 X:141281562-141281584 ACAGTTTTTCCCAGGGGAGAAGG + Intergenic