ID: 921573615

View in Genome Browser
Species Human (GRCh38)
Location 1:216807770-216807792
Sequence AAAGAGAACCAAGATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 697
Summary {0: 1, 1: 0, 2: 14, 3: 52, 4: 630}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921573615 Original CRISPR AAAGAGAACCAAGATGAGGA TGG Intronic
900545746 1:3228215-3228237 AAAGAGAAGCAAACCGAGGATGG + Intronic
901390774 1:8944616-8944638 AAAGAGAAAAAAGAAAAGGAAGG + Intergenic
902361596 1:15945133-15945155 CAAGAGGAGCAAGAGGAGGAGGG - Exonic
902598972 1:17528158-17528180 AAAGAAAACCAAGAGGAAAAGGG - Intergenic
902732287 1:18377353-18377375 AAAGAGAACCAAAGGGTGGATGG - Intronic
902892658 1:19455583-19455605 CAAGAGACCCAAGATGCGGCAGG - Intronic
904199665 1:28811849-28811871 AAAGAGAATGAAGCTGAGGGAGG + Intergenic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905479099 1:38248967-38248989 AAACAGAAACAAAATGGGGAGGG - Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
905917878 1:41698532-41698554 GATGAGAACCAAGTTGATGAGGG + Intronic
908436337 1:64110517-64110539 AAGCAGAAGAAAGATGAGGATGG - Intronic
908710964 1:67013598-67013620 AAAGACAGCAAAGAGGAGGAAGG - Intronic
909049271 1:70748896-70748918 AAAGATAACCAAGATCAGAGTGG - Intergenic
910496953 1:87840624-87840646 AAAGACATCCAGGCTGAGGATGG - Intergenic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914440569 1:147702197-147702219 AAAGAGAAGCTGGATGATGATGG + Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
915006996 1:152647586-152647608 AAAGAGAACAAATATTGGGAGGG - Intergenic
915249077 1:154575936-154575958 AAAGAGCATGGAGATGAGGAAGG - Exonic
915573175 1:156757081-156757103 AAACAGAACCAAGCTGGGCACGG - Intronic
915871287 1:159562203-159562225 AAAGAGAAGAAAGAAAAGGAAGG + Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916058932 1:161085985-161086007 GAAGAGAATCTAAATGAGGAGGG - Intronic
916175995 1:162039039-162039061 CAAGAGAACCCAGATCAGCAAGG - Intergenic
916281610 1:163057855-163057877 AAGGAGAACCAAGCTGAGGAGGG - Intergenic
916350549 1:163844844-163844866 ATTAAGAACCAATATGAGGAAGG - Intergenic
916378202 1:164179169-164179191 AAAAAGAGCCCAGATGATGAAGG - Intergenic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
916890719 1:169109753-169109775 TAAGAGCACCAAGATGAGGTGGG + Intronic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
916988568 1:170217750-170217772 TAAGAGAACTAAGCTCAGGATGG - Intergenic
917053327 1:170949870-170949892 AAAGACAAGGAAGATGAGAAAGG + Intronic
917140886 1:171834233-171834255 AAAGATAACCAAGATTTGGCCGG - Intergenic
917607031 1:176642171-176642193 AAAGAGTACATAAATGAGGAAGG + Intronic
917831058 1:178886868-178886890 CAAGAGAGCTAAGATGAGAATGG + Intronic
919132775 1:193472356-193472378 AAAGACAATTAAGATGATGAAGG - Intergenic
919236946 1:194858777-194858799 AAATAAAACCAAGATGAAGAAGG + Intergenic
919470409 1:197971944-197971966 AAAGTGAAACAAGAGGGGGAAGG - Intergenic
919822934 1:201484296-201484318 AAGCAAGACCAAGATGAGGAGGG - Exonic
920113719 1:203604788-203604810 AAAGAGAGACAAGCTGGGGAAGG + Intergenic
920226640 1:204443814-204443836 AAGGAGAAACAAGATGCAGAGGG - Intronic
921177294 1:212606684-212606706 AAAGTGAAGCAAGGAGAGGAGGG - Intronic
921200599 1:212801865-212801887 AGAGAGAACAAAGATGAAGGAGG - Intronic
921233794 1:213102402-213102424 AAGAAGAACCAAGAAGTGGAAGG - Intronic
921573615 1:216807770-216807792 AAAGAGAACCAAGATGAGGATGG + Intronic
922108196 1:222530814-222530836 ATAGAGAATCTAGATGTGGAAGG + Intronic
922273616 1:224056694-224056716 AAAGACAACCAAGATGATGATGG + Intergenic
922825833 1:228517827-228517849 AAAGATAGCCAAGATGAGGATGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
924123087 1:240822886-240822908 AAATATAACCAAGATGAGGCTGG + Intronic
924289126 1:242520258-242520280 CAAGGCAACCAAGATGAGGATGG + Intronic
924551763 1:245084641-245084663 CAAGGGGACCAATATGAGGATGG - Intronic
924684796 1:246278027-246278049 AAAGAAAACAGAAATGAGGAAGG + Intronic
924947449 1:248855951-248855973 AAGGAGAACAAAGAGGAAGATGG + Intronic
1064523831 10:16231989-16232011 AAGGAGAAGCAAGTTGATGATGG - Intergenic
1065444787 10:25787123-25787145 AAAGAGAAAAAAGAAAAGGAAGG + Intergenic
1065675822 10:28173148-28173170 AAGGAGAACCAGGGTGAGCAGGG + Intronic
1067056373 10:43054744-43054766 ACAGAGAACCAAGATGGGCCAGG - Intergenic
1067843743 10:49702198-49702220 AAAGAAAACAAAGAAAAGGAAGG + Intronic
1068016643 10:51525164-51525186 GAAGAGAAGGAAGAGGAGGAGGG + Intronic
1068467593 10:57415089-57415111 GAAGAGAAAGAAGATGAGGAGGG + Intergenic
1069377562 10:67809269-67809291 AAAGAGACCCAGGGTGTGGATGG - Intronic
1069567817 10:69475118-69475140 AAAGAAAACCAGGGGGAGGAGGG + Intronic
1070515949 10:77206597-77206619 AAACAGAAAGAAGATGAGTATGG - Intronic
1071301326 10:84258038-84258060 ACAGAGAACAAAGATGGAGAGGG - Intronic
1072270136 10:93768368-93768390 AAAGAAAACCGAGGTGAGGGAGG - Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1073150123 10:101305717-101305739 AAACTGATCCAAGCTGAGGAAGG - Intergenic
1074134412 10:110614427-110614449 AAAGAGAACCATGGTGAAGACGG - Intergenic
1074247739 10:111712153-111712175 AAAGAGAGGCAAGGTGAGGGAGG + Intergenic
1075188222 10:120282538-120282560 AAAGTGAACCAAGAGTAGGAGGG + Intergenic
1075212107 10:120500228-120500250 AAAGACAAACAAGACGAGGAAGG + Intronic
1076211265 10:128646866-128646888 AATGACAACCCAGCTGAGGAGGG + Intergenic
1077800540 11:5531686-5531708 CAACAGAACAAAGATGAGGGAGG - Intronic
1078459227 11:11500713-11500735 AAAGAGAAGTAAGGAGAGGAGGG - Intronic
1078477238 11:11641412-11641434 AAGGAAAAAGAAGATGAGGAAGG - Intergenic
1078598145 11:12706905-12706927 AGAGAAAACCAAGCTGAGAAAGG + Intronic
1078919832 11:15819362-15819384 AAAGAGAAGCAAGATGATTGAGG + Intergenic
1079568471 11:21913110-21913132 ATAGAGAATCTAGATGAAGAAGG + Intergenic
1079681843 11:23306797-23306819 AAAAAGAACTGAGATGAGGCCGG + Intergenic
1079901864 11:26197257-26197279 AAAAAGATCCTACATGAGGAAGG + Intergenic
1081174754 11:39913728-39913750 AAAGATAAATAAGATGAGGCAGG + Intergenic
1081489283 11:43554871-43554893 CAAGAGAACCTATCTGAGGAGGG + Intergenic
1081557345 11:44177458-44177480 AAACAGAAGTAAAATGAGGAGGG - Intronic
1081882799 11:46468380-46468402 AAAAAGAAAAAAGAAGAGGAAGG + Intronic
1082105548 11:48217432-48217454 AGAGGACACCAAGATGAGGAAGG - Exonic
1082180243 11:49108233-49108255 AAAGAGAAAATAGAGGAGGAAGG - Intergenic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083274553 11:61589181-61589203 AAAGAAAACCACGAGGAGGGAGG - Intergenic
1083446042 11:62708597-62708619 AAAGAGAACCCATTTGGGGAGGG + Intronic
1083717576 11:64586716-64586738 AAAGAGACCCAAGTAGATGAGGG - Intergenic
1083828290 11:65215449-65215471 AGAGAGAGCGAAGAGGAGGAAGG - Intergenic
1084368928 11:68725006-68725028 AAAGAGTACAAAGATGGGGAAGG + Intronic
1084848046 11:71916263-71916285 AAAGAGAAACAAAATCAGGGGGG + Intronic
1084929789 11:72545832-72545854 AAAGAAAAAAAAGATGTGGAAGG - Intergenic
1084983062 11:72842730-72842752 AAAGAAAACCAAGATGATGATGG - Exonic
1085235165 11:75008994-75009016 AAAGAGAAAAAACATGAGGCAGG - Exonic
1085363565 11:75915768-75915790 AAACAGAACCAAAAGGAGAAAGG - Intronic
1085954431 11:81374118-81374140 AAAAAGAAAAAAGATAAGGAAGG - Intergenic
1086685247 11:89726599-89726621 AAAGAGAAAATAGAGGAGGAAGG + Intergenic
1086926529 11:92646631-92646653 TAAGAAAATCAACATGAGGAAGG + Intronic
1087981124 11:104615931-104615953 AAAGAAAAGAAAGAGGAGGAAGG - Intergenic
1088030274 11:105240257-105240279 AAAGAGAAACAAGATGAGAAGGG + Intergenic
1088047985 11:105476851-105476873 ACAGAGGAGCAGGATGAGGAAGG - Intergenic
1088480104 11:110288912-110288934 AGAGAGAACCAACATGAACATGG + Intronic
1088543545 11:110937516-110937538 AGAGAGAACCCAGATCTGGATGG - Intergenic
1088900454 11:114112444-114112466 AGAGGGCACGAAGATGAGGAAGG + Intronic
1088982843 11:114879193-114879215 CAAGAGAAAGAAGGTGAGGAAGG + Intergenic
1089659770 11:119978292-119978314 AAAGGGTGCCAAGGTGAGGATGG + Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090598460 11:128344546-128344568 AAAGAGAAGAATTATGAGGATGG + Intergenic
1090672998 11:128963486-128963508 AAAGAGAAAAAGGAAGAGGAGGG + Intergenic
1090678234 11:129025665-129025687 AAAGAGAAAGAAGAGAAGGAGGG + Intronic
1090685966 11:129119901-129119923 GAAGAGAAGAAAGATGAGGTCGG + Intronic
1090968924 11:131622973-131622995 AAAGAGAAAGAGGAAGAGGAAGG + Intronic
1091070612 11:132559149-132559171 AGAGAGAAGCAAGAAGGGGAGGG + Intronic
1091251743 11:134149752-134149774 AAAAACAACCAAAATCAGGAAGG + Exonic
1091323453 11:134667489-134667511 AAAGAGAAAGAAGGGGAGGAAGG - Intergenic
1091868549 12:3865905-3865927 AAAGAGAACAAAGAACAGGTGGG - Intronic
1092267695 12:6995496-6995518 ACAGAGAACCAATATGAAGAAGG - Intronic
1093091272 12:14923543-14923565 AAAGAGAACCAACAGGAGATAGG - Intronic
1093140757 12:15507958-15507980 TAAGAGAACAAAGCTAAGGATGG + Intronic
1093499791 12:19798727-19798749 AAAGAGAACAAGGAAGAGGGAGG - Intergenic
1093888861 12:24495309-24495331 AAAGAGAACCAGTATGAAGTAGG + Intergenic
1094178603 12:27567232-27567254 AAAAAGAAAAAAGATGAAGAAGG + Intronic
1094774493 12:33708601-33708623 AAATAGAATGAAGATGAGGGAGG + Intergenic
1095055212 12:37590451-37590473 ACAGAGAACCAAGGAGAGGATGG - Intergenic
1095237251 12:39812429-39812451 AAAGAGAAGAAAGAAAAGGAAGG - Intronic
1096241420 12:49962076-49962098 AAAGAAGACGAAGATGAGGGTGG - Exonic
1097030136 12:56083920-56083942 AAAGAGGAGCAGGTTGAGGAAGG - Intronic
1098011717 12:66060457-66060479 AAAGATAAGGAAGAGGAGGAGGG - Intergenic
1098012749 12:66071758-66071780 CAAGAGAAGCAAGAAGTGGAGGG - Intergenic
1098558205 12:71842852-71842874 AAAGAAAAAGAAAATGAGGAGGG + Intronic
1099865814 12:88279328-88279350 AAAGAGAAAGAAGCAGAGGATGG - Intergenic
1102446163 12:113004373-113004395 AAAGAGGAGGAAGAGGAGGAGGG + Intronic
1102988384 12:117297202-117297224 AGAGAGACCCATGAGGAGGATGG + Intronic
1103219790 12:119234131-119234153 AGAGAGCACCAAGATGGTGATGG - Intergenic
1103609949 12:122117231-122117253 CAAGAGATCCACGAGGAGGATGG + Intronic
1104415335 12:128593067-128593089 AGAGAGAAGGAAGATGAGAAAGG - Intronic
1104424171 12:128660880-128660902 CCAGAGAAACAAGATGAGGAGGG + Intronic
1106563228 13:30864296-30864318 AATGAGAAGGAAGATGTGGAGGG - Intergenic
1106852330 13:33807737-33807759 AAACAGAAATAAGAAGAGGATGG - Intergenic
1107860223 13:44653633-44653655 AAAGATAAAGAAGCTGAGGATGG + Intergenic
1107918961 13:45183457-45183479 AAAGGGAAGCAAGACGGGGAAGG + Intronic
1108032795 13:46254016-46254038 AAAGAGAACCAAGAGTATCATGG + Intronic
1108150387 13:47527756-47527778 CAACAGAACCAAGAGGAGCAGGG - Intergenic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108969403 13:56353775-56353797 AAACACACCCAAGATGAGAATGG - Intergenic
1108975017 13:56430599-56430621 AAATAAAAACAAGATGAGTAGGG + Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109395798 13:61756863-61756885 GAACAGGAACAAGATGAGGATGG - Intergenic
1109881492 13:68483982-68484004 AAAAAGAAACAAGAAGTGGAAGG + Intergenic
1110331746 13:74280799-74280821 AAAGAAAAAAAAGATGAGTATGG - Intergenic
1111181005 13:84665049-84665071 AAAGAGAAATAGGAAGAGGAAGG + Intergenic
1112066848 13:95802070-95802092 AAAGATAACAAAGATAAGTAAGG - Intronic
1112194694 13:97213644-97213666 AAAGATAAGCAAGATGTAGATGG - Intergenic
1112729166 13:102340354-102340376 AAAGAGAAGCAAGATTATTATGG - Intronic
1112788991 13:102982808-102982830 AAGGAGGAGGAAGATGAGGAGGG + Intergenic
1113270145 13:108664404-108664426 AAAGAAAACCAAGTTGAGAGAGG - Intronic
1113859039 13:113469059-113469081 AAAGAGAGAAAAGCTGAGGAGGG + Intronic
1114257296 14:21014297-21014319 AAAGAGAAGGAAAAAGAGGAAGG + Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1114400279 14:22403704-22403726 AAAGAGAGCCAACAGGATGAAGG - Intergenic
1114656568 14:24319283-24319305 AATGAGAGCCCAGAGGAGGATGG + Intronic
1115739420 14:36372562-36372584 AAAGGGAGCTCAGATGAGGAGGG - Intergenic
1115801240 14:36996247-36996269 ACAGAGAACTAAGATAATGAAGG - Intronic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1117063517 14:51986295-51986317 AAAAAAAACCAAGATAAGAATGG - Intergenic
1117233685 14:53749163-53749185 AATGACAACCGAGATGAAGAAGG + Intergenic
1117499905 14:56341230-56341252 AAAGAGTACTAAAATGAGAAAGG - Intergenic
1117568844 14:57025015-57025037 AAAGAAAACCTAGCTGGGGATGG + Intergenic
1118413988 14:65512963-65512985 AAAGAGTACTAAGAAAAGGATGG - Intronic
1118566899 14:67151520-67151542 AAACAGAACCAAAATGAATACGG + Intronic
1118968938 14:70615323-70615345 GAAGAAAACAAAGATGAGAAAGG + Intergenic
1119071983 14:71595755-71595777 AAGGAGAGCAATGATGAGGAGGG - Intronic
1119162063 14:72460890-72460912 ACAGGGAGCCAAGCTGAGGATGG + Intronic
1120333647 14:83125710-83125732 ACAGAGAAAGAAGAGGAGGAAGG - Intergenic
1121532871 14:94670923-94670945 AAAGAGAACCATGAAGGGGAAGG + Intergenic
1121807903 14:96848157-96848179 GAACAAAACCAAGAAGAGGAGGG - Intronic
1122322240 14:100862054-100862076 AAGGAGAAAGAAGAAGAGGAAGG - Intergenic
1124081514 15:26502386-26502408 AAAAATAAACAAGAAGAGGAAGG - Intergenic
1124476122 15:30036244-30036266 AAAGTGAATCTAGATGAGCAAGG - Intergenic
1124807085 15:32895338-32895360 AAAGGGAAACAAAAAGAGGAAGG + Intronic
1124963510 15:34415970-34415992 AAAGAGAAGCTACATGAAGAGGG - Intronic
1124980131 15:34562196-34562218 AAAGAGAAGCTACATGAAGAGGG - Intronic
1125346737 15:38726061-38726083 AAAAAAAACCCAAATGAGGAAGG + Intergenic
1125751859 15:42034639-42034661 AAAGAGGACGTAGAAGAGGAGGG - Intronic
1126030084 15:44488395-44488417 AAAGAGAATAGAGATGAAGATGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1127532210 15:59854513-59854535 ACTGAGATCAAAGATGAGGAAGG - Intergenic
1127747408 15:61994003-61994025 AATGAGACCTAAGATGAAGACGG + Intronic
1127765731 15:62184203-62184225 AAAGAGAAAGAAAATAAGGAAGG + Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128414617 15:67433567-67433589 AAAGAGCTCCATGATGAGAATGG - Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1129410921 15:75349851-75349873 GAGGAGAGCCAAGAGGAGGATGG + Intronic
1129880974 15:79005813-79005835 AAAGAGAAAGGAAATGAGGAGGG - Intronic
1131062087 15:89410529-89410551 CAAAAGAACCAAGATGAAGGGGG - Intergenic
1131597865 15:93816792-93816814 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1131692189 15:94839465-94839487 AAAGAAAAAGAAGATGAGAAAGG - Intergenic
1131699361 15:94917510-94917532 AAAGGGAAAGAAGATGAGAAGGG + Intergenic
1132032022 15:98446165-98446187 AGAGTGAACCAGGATGAGGTGGG - Intronic
1132979832 16:2731723-2731745 AAAGAGAAAAAAGATAGGGAGGG + Intergenic
1133572359 16:7054072-7054094 ACAGAGAACAAAAATGAAGAGGG - Intronic
1133597978 16:7311275-7311297 AAACAGAATCAAAATTAGGAAGG + Intronic
1134402357 16:13921094-13921116 AAAGGGAACAGTGATGAGGATGG + Intronic
1135106148 16:19651601-19651623 AAAGAGAAGCAAGGTGACAAAGG - Intronic
1136091355 16:27922555-27922577 AAAGAGGGACGAGATGAGGAGGG - Intronic
1136134993 16:28250488-28250510 AAAGTGGAGCAAGAAGAGGATGG - Intergenic
1136474406 16:30503630-30503652 AAAGAGAAGAAAGAAAAGGAAGG + Intronic
1137373771 16:47933092-47933114 AAAGAGAACAACCATGGGGAGGG - Intergenic
1137869870 16:51939786-51939808 AGAGAGAGCCAAGATGGGGGAGG - Intergenic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1139432253 16:66917546-66917568 AAAGAGAAACAGCAAGAGGAAGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140442211 16:74997057-74997079 AAAGAAAACCAAAAAGAGCAAGG - Intronic
1140761598 16:78113825-78113847 AAATAGAATGAGGATGAGGATGG + Intronic
1140840454 16:78833464-78833486 GAAGAGGACAATGATGAGGAAGG - Intronic
1141774682 16:86115360-86115382 GAAGAGGTCCAAGGTGAGGAGGG + Intergenic
1142477338 17:196895-196917 AAAGAGAGAAAAGAGGAGGATGG + Intergenic
1143178727 17:4971266-4971288 TAGGAGAACCAAGATGACGGAGG - Intronic
1143206734 17:5147054-5147076 AAACAGCAGCAAGATGAGAAGGG - Intronic
1143270041 17:5668653-5668675 GAAGAGAAGAAAGAGGAGGAAGG - Intergenic
1143277732 17:5724757-5724779 ACAGAGAACAAAGTTAAGGATGG + Intergenic
1144589789 17:16514387-16514409 AAAGAGAAGCGAGAGGAGCAAGG - Intergenic
1144769452 17:17751512-17751534 AAAAAGAAGGAAGGTGAGGAGGG + Intronic
1144840338 17:18182243-18182265 AAAAAGAACGAGGAGGAGGAGGG + Intergenic
1145376060 17:22350055-22350077 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1145747600 17:27331992-27332014 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1146644198 17:34565907-34565929 GAGGAGAAACAAGATAAGGAAGG + Intergenic
1147049090 17:37777615-37777637 AAAGAGAGCAAAAATGAAGAAGG - Intergenic
1147484413 17:40798230-40798252 AAAAAGAACCACGAAGAGGTAGG - Exonic
1148245602 17:46027942-46027964 TTGGAGAACAAAGATGAGGAGGG - Exonic
1148458677 17:47825030-47825052 AAAAAGAATCAGGATGAGGTTGG + Intronic
1148574588 17:48700493-48700515 AAAGAAAACAAACATCAGGAAGG - Intergenic
1148667910 17:49388431-49388453 AAAGAGAAATAAGAACAGGAAGG - Intronic
1149095982 17:52841565-52841587 ATGGAGAACTAAGATTAGGATGG + Intergenic
1149384094 17:56124846-56124868 AAAGAGAACCAAGGACAGCATGG - Intronic
1149524292 17:57341906-57341928 AAAGAGAACAAGGAGGAAGAAGG - Intronic
1149841120 17:59965692-59965714 TAAGAAAACGAAGCTGAGGAGGG + Intronic
1149873663 17:60207139-60207161 AAACAGAAGCAAGATGAGAAGGG + Intronic
1150087448 17:62284395-62284417 AAACAGAAGCAAGATGAGAAGGG + Intergenic
1150089462 17:62310088-62310110 AAAGAGAAAGAAGAAGAAGAAGG - Intergenic
1150489237 17:65563006-65563028 AAAGAGATCCAAGAAGTGAAAGG + Intronic
1150502027 17:65660231-65660253 AAAGAAAACAAAAAAGAGGAAGG - Intronic
1150584811 17:66507855-66507877 AAACAAAGCCAAGGTGAGGAAGG - Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1151065472 17:71144589-71144611 AGACAGAACCAAGGTGAGAAGGG + Intergenic
1151869679 17:76827846-76827868 AAAGAGAAACGGGATGAGCACGG - Intergenic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152878639 17:82803090-82803112 GAAGACAACCAAGAAGAGAACGG - Intronic
1152982742 18:294262-294284 AAAGAGAATGAGGATGAAGAGGG - Intergenic
1153062515 18:1008507-1008529 AAATACAAGCAAAATGAGGAGGG - Intergenic
1153151384 18:2097865-2097887 AAAGAAAAGAAAGATGAGGTAGG + Intergenic
1153478379 18:5521479-5521501 AAACAGCACCACGATGAGCATGG + Intronic
1153741533 18:8134659-8134681 AAAGAAAAACAAGAGGAGAAAGG - Intronic
1153741962 18:8138545-8138567 AAAAGGAACCAAGAAGATGAGGG - Intronic
1154073963 18:11180740-11180762 AAAGACAAATAAGATGAGAAAGG + Intergenic
1155409880 18:25532140-25532162 AAAGAGAAGCAACAGGAAGAGGG + Intergenic
1156024416 18:32635337-32635359 CAATAGAACCAAGAGGCGGATGG - Intergenic
1156241383 18:35257894-35257916 AGAGAGAAGCAGGATTAGGAAGG - Intronic
1156451844 18:37270959-37270981 AAGCAGAACAAAGGTGAGGAAGG + Intronic
1156488477 18:37481766-37481788 AGAGAGAACCAGGATGACCATGG - Intronic
1156554798 18:38054996-38055018 AAAGAGAAACAGAATTAGGAAGG - Intergenic
1156727254 18:40144029-40144051 AAAGATAATCAAGATGTGGTAGG + Intergenic
1157023148 18:43810780-43810802 AAAGACAAGAAAGAAGAGGAAGG + Intergenic
1157419254 18:47531628-47531650 AAAGAGAAGGAAGATGGGGGTGG + Intergenic
1157740400 18:50087831-50087853 CAGGAAAACCAAGATGAGAAAGG + Intronic
1158285601 18:55878133-55878155 AAAGATGACCAAGATGATGTAGG + Intergenic
1158439230 18:57459318-57459340 ACTGTGAACAAAGATGAGGAGGG + Intronic
1159610058 18:70514775-70514797 AAAGATGACCAAGATGGGGCAGG - Intergenic
1159765061 18:72479590-72479612 AAAGACAACACTGATGAGGAGGG + Intergenic
1160085196 18:75770823-75770845 AAAATGACCCAAGATGTGGATGG - Intergenic
1160570106 18:79810279-79810301 AAAGAGGACCAAGATGAGACTGG + Intergenic
1161059733 19:2208901-2208923 AAAGAGAACCCTGATTAGAAGGG - Intronic
1161836054 19:6647429-6647451 AAACAGAACCAAGGAGGGGAAGG - Intergenic
1162110449 19:8397109-8397131 AAAGTTAACCAAGATAAGGAGGG + Intronic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163717609 19:18881018-18881040 AGAGGTCACCAAGATGAGGAGGG - Intronic
1163733830 19:18966344-18966366 AAAGAAAAAAAAGATTAGGATGG + Intergenic
1164592624 19:29514554-29514576 AAGGAGAGGGAAGATGAGGAAGG + Intergenic
1164653780 19:29905287-29905309 AAAGAGAACAAACAAGACGAAGG - Intergenic
1164851591 19:31488812-31488834 AAAGAAAACCTAGATGAGCTTGG - Intergenic
1164868643 19:31625649-31625671 AAAGAGAAACATGAGGGGGAGGG - Intergenic
1165220115 19:34309434-34309456 AAAAAGAAAAAAGATGGGGAAGG + Intronic
1165598402 19:37031463-37031485 AAAGAGAAGCAAGGAGAGGATGG - Intronic
1165848710 19:38836274-38836296 ACAGAGACCCAAGAGGAGCAGGG - Intronic
1165948159 19:39457848-39457870 AGAAAGAAGCAAGGTGAGGACGG - Intronic
1165990410 19:39808837-39808859 AAAGAGAAGCAAGAAAAGAAGGG + Intergenic
1167191268 19:47991670-47991692 AAAGAGAAGGAAGAGGAGGAGGG - Intronic
1167234047 19:48303186-48303208 AAAGAAAGTGAAGATGAGGAAGG + Intronic
1167350872 19:48973842-48973864 AATGTGAACCAACAAGAGGAAGG + Intronic
1167386362 19:49166318-49166340 AAAGAGAGCCAAGACAGGGATGG - Intronic
1167806882 19:51793201-51793223 GAAGAAAACCAATATGATGATGG + Intronic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168338376 19:55609808-55609830 AGAGAGAAGCATGATGGGGAGGG - Intronic
925036470 2:690613-690635 AATGTTAAGCAAGATGAGGAAGG + Intergenic
926807268 2:16722474-16722496 CAAGATGACTAAGATGAGGAAGG - Intergenic
926952298 2:18255274-18255296 AGAGAGAAGTGAGATGAGGAAGG - Intronic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
928226531 2:29453718-29453740 AAAGAGAAAGAAAAAGAGGAAGG + Intronic
928562515 2:32505180-32505202 CAAGAGATGCAAGATGAGGCTGG - Exonic
928781959 2:34833925-34833947 AAAGAGGAAAAAGAAGAGGAAGG + Intergenic
929307000 2:40374633-40374655 AAAGTGAACCAAGGTGATGGTGG + Intronic
929351835 2:40965644-40965666 AAAGAGAATCAGGATTAGGGAGG - Intergenic
929392677 2:41489231-41489253 AAAAAGAAACAAGATTAGAAGGG - Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
929651520 2:43684394-43684416 AAAGAGAAAAAAATTGAGGATGG + Intronic
930142560 2:47967522-47967544 GAAGAGAACCAAGAAGCAGAAGG - Intergenic
930297134 2:49569093-49569115 AAAGAGAACTATGTTGTGGAGGG - Intergenic
930401950 2:50901237-50901259 AAAGAAAACAAAGATGAGGCTGG + Intronic
930534321 2:52628695-52628717 AAAGACAACCAATTCGAGGAAGG + Intergenic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
930637020 2:53817427-53817449 AAAAAGAACCAAGTGGAGGCTGG - Intronic
930763156 2:55058037-55058059 AAAGAGAACTAAAACTAGGATGG + Intronic
931327162 2:61238224-61238246 AAAGTGGCCCAAGATGAGGATGG - Intronic
931467945 2:62507814-62507836 AAACAGAAGCAAGATGACAAAGG - Intronic
931682636 2:64764725-64764747 AAAGAGGAAGAAGAGGAGGAGGG - Intergenic
931875046 2:66503293-66503315 AAAGCAAAACAAGATGAGGCTGG - Intronic
933144775 2:78838338-78838360 AAAGAGAGACAAGAAGAGAATGG - Intergenic
933206255 2:79512380-79512402 TAAAAGAACCTAGAAGAGGATGG - Intronic
933272699 2:80250431-80250453 GAAGAGAAGCAGGCTGAGGATGG + Intronic
933551487 2:83782923-83782945 AAAGAAAACCAATATCAGGCAGG + Intergenic
935086295 2:99848613-99848635 AAAGACATCCAAGATGATGTTGG + Intronic
935506203 2:103906983-103907005 AAAGAGAACCAAGATCAATGGGG - Intergenic
935795231 2:106634551-106634573 AAAGAAAAGGAAGATGAGGGAGG - Intergenic
937412309 2:121687214-121687236 AAAGAAAAGAAAGGTGAGGAGGG - Intergenic
939045617 2:137246155-137246177 GAAGAGATCCAGGAGGAGGATGG + Intronic
939111027 2:138007700-138007722 AATGTGAAACAAGATGAGAAAGG - Intronic
939656315 2:144830546-144830568 AGAAACAACCAAGATGAGGAGGG - Intergenic
939821236 2:146959273-146959295 AAGGAAAACCAAGATGGGGTGGG + Intergenic
940046531 2:149416119-149416141 AGAGAGAACTCAGAAGAGGAAGG + Intronic
940405933 2:153302197-153302219 AAAGATAACATTGATGAGGATGG - Intergenic
941388045 2:164877490-164877512 AACCAGAACCATGATGAGGGTGG + Intergenic
942369149 2:175262797-175262819 ACAGAGAACAGAGATGGGGAAGG + Intergenic
943044204 2:182839175-182839197 ACAGTGAGCCAAGATGAGGAAGG - Intronic
943150349 2:184104509-184104531 AAACAATACCAAGATGAGGCTGG - Intergenic
943366209 2:186969859-186969881 AAGGAGAAACAAGCTGAAGAAGG + Intergenic
943567968 2:189539257-189539279 ATAGAGAATCAAGAAGAGGGAGG + Intergenic
944293357 2:198033650-198033672 AAAGGTAAACAAGATGAGGTTGG - Intronic
944299955 2:198112367-198112389 CAAGAGAAACAAGAGGAGGCTGG - Intronic
944738931 2:202592907-202592929 AAAGATTACAAAGATTAGGAAGG - Intergenic
945633394 2:212314270-212314292 AATGTCAACCAAGTTGAGGAAGG - Intronic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
945781914 2:214185901-214185923 ATAGAAAAACAAGATGAGTATGG - Intronic
946072279 2:217044648-217044670 AAAGAGAAGCAAGATGATTAAGG - Intergenic
946081714 2:217125791-217125813 AAGGAATACCAAGATGAGAATGG - Intergenic
946758265 2:222968078-222968100 AAAGAGAACCCAGCTGAAGATGG + Intergenic
947197918 2:227587154-227587176 AAAGAGAACCAGGGCGAGGTTGG + Intergenic
947375266 2:229489324-229489346 AAAGATAACTGAGATGAGGGCGG + Intronic
947574400 2:231261114-231261136 AAAGAGAAGCTAGATGTGCAAGG - Intronic
947777560 2:232726061-232726083 AAAGGTAAGCAAGATGAGGCTGG + Intronic
947976330 2:234369396-234369418 AATGATAGCCAAGATGACGAGGG - Intergenic
948069716 2:235110642-235110664 AAAGAGAACAAAAAGGAGGAAGG + Intergenic
948075157 2:235160269-235160291 AAACAGAAGGCAGATGAGGAGGG - Intergenic
1168811016 20:704597-704619 AGGGAGACCCAAGGTGAGGATGG - Intergenic
1168934672 20:1653941-1653963 AAAAAGAACAAAGATGGGGCCGG + Intronic
1169781109 20:9311658-9311680 AAACAGCTCCAGGATGAGGAGGG - Intronic
1170024283 20:11872092-11872114 GAAGAAAAACAAGAAGAGGAAGG - Intergenic
1170032716 20:11959392-11959414 AAAGAGGACTAAGTGGAGGAAGG + Intergenic
1170314074 20:15024374-15024396 AAAGAGGAGGAAGAAGAGGAAGG + Intronic
1170833017 20:19859797-19859819 ATAGAGAACGCAGGTGAGGAAGG - Intergenic
1171527038 20:25821876-25821898 AAAGAGAACCAAGGAGAGGATGG + Intronic
1171546388 20:26005196-26005218 GTAGAGTACCAAGATGAGGCAGG + Intergenic
1171549789 20:26034008-26034030 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1172247846 20:33458175-33458197 AAAGAGAACCAGTGTGAGGGTGG + Intergenic
1172732223 20:37097550-37097572 AAATAAAACCAATATAAGGAAGG - Intergenic
1174333279 20:49838184-49838206 AGAGAGAACGAAGATGGGGGTGG + Intronic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174837113 20:53866985-53867007 AAAGAGAACCAGGCTAAGGGTGG + Intergenic
1174954767 20:55085405-55085427 GAAGGAAACCAAGATGAGGCTGG + Intergenic
1175496679 20:59419339-59419361 ACAGAGAAACAAGAGGAGGGAGG + Intergenic
1175498893 20:59435408-59435430 AAACAGCAGCAGGATGAGGAGGG + Intergenic
1175519846 20:59594404-59594426 AAAAAGTACCTAGATTAGGAAGG - Intronic
1175979671 20:62731763-62731785 AAAGAGAGCCCAGAAGTGGACGG - Intronic
1177236460 21:18396116-18396138 AATGAAAGCCAAGATGAGCATGG - Intronic
1177368361 21:20168901-20168923 AAAAAGGCCTAAGATGAGGAAGG - Intergenic
1177836382 21:26190095-26190117 AAAGAGAAGCAAGCAGAGGAGGG + Intergenic
1178038756 21:28615337-28615359 GAAGAGAAGGAAGAGGAGGAGGG - Intergenic
1178194928 21:30333790-30333812 AAAGAGAAGCTAGCTGAAGAAGG - Intergenic
1178299808 21:31442850-31442872 AAAGAAAAATAAGCTGAGGAAGG + Intronic
1178305688 21:31488435-31488457 AAAGAAAAGGAAGAGGAGGAAGG + Intronic
1178947626 21:36960975-36960997 AAAGATAATGAACATGAGGATGG + Intronic
1179115681 21:38489886-38489908 AAAGACAACAAGGATGATGAGGG - Intronic
1179801254 21:43812435-43812457 AAAGGGAAACAAGGTCAGGAGGG - Intergenic
1179805368 21:43833981-43834003 AAACAGTGCCAAGAAGAGGAAGG + Intergenic
1180763663 22:18228998-18229020 AAAGAGAACAATGAAGGGGAAGG + Intergenic
1180771981 22:18395545-18395567 AAAGAGAACAATGAAGGGGAAGG - Intergenic
1180803359 22:18645158-18645180 AAAGAGAACAATGAAGGGGAAGG - Intergenic
1180807460 22:18724799-18724821 AAAGAGAACAACGAAGGGGAAGG + Intergenic
1180942686 22:19669807-19669829 AGGGACAACCCAGATGAGGAAGG + Intergenic
1181218357 22:21350104-21350126 AAAGAGAACAATGAAGGGGAAGG + Intergenic
1181313538 22:21958122-21958144 AATGAGGACGAGGATGAGGATGG + Intronic
1181346647 22:22224194-22224216 AATGAGGACGAGGATGAGGATGG + Intergenic
1181885314 22:26017386-26017408 AAAGAGAAGGGAGAGGAGGAAGG - Intronic
1181911739 22:26243857-26243879 CAAGAGAAGAAAGATGAGCAGGG + Intronic
1182322728 22:29489066-29489088 AAAGAGGCCAAAGAGGAGGAGGG + Exonic
1182332527 22:29561206-29561228 AAAGAGAACCAAAGGGATGATGG + Intronic
1182942357 22:34288949-34288971 AAAGAGGAGGAAGAGGAGGAAGG - Intergenic
1183305139 22:37078915-37078937 AAAGAGAAAGAAGAGGAAGAAGG + Intronic
1183858000 22:40649184-40649206 ATAGAGACCCAAGATGAGAAAGG - Intergenic
1183868831 22:40725226-40725248 AAGGAGAAGGAAGATGAGGGTGG - Intergenic
1183876638 22:40788372-40788394 AAATATAACCAAGATGAGGCTGG + Intronic
1184184575 22:42856528-42856550 AAAGAGAACCGAGGAGAGGGAGG + Intronic
1184681881 22:46076759-46076781 AAATAGAGCCCAGAAGAGGAAGG + Intronic
1185234770 22:49705352-49705374 CAGGAGAACCACGAGGAGGACGG + Intergenic
1203233819 22_KI270731v1_random:136535-136557 AAAGAGAACAACGAAGGGGAAGG - Intergenic
949823784 3:8142975-8142997 AAAGCTTACAAAGATGAGGATGG + Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
951024043 3:17811666-17811688 AGAAAGAAACAAGATCAGGAAGG + Intronic
951050305 3:18086256-18086278 AAAGAGAGCCATAAAGAGGATGG - Intronic
951437885 3:22686083-22686105 TAAGAGAACCAATATCTGGAGGG - Intergenic
952395125 3:32914399-32914421 GAAAAGAACCCAGATGAGTAAGG - Intergenic
952504120 3:33992175-33992197 AAAGAGGAACAACATCAGGAGGG - Intergenic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
953761632 3:45692100-45692122 AAAGAGAACAGAGAGGAAGAAGG - Intronic
956098863 3:65746591-65746613 ATAGATACCCAAGAAGAGGACGG - Intronic
956377815 3:68634548-68634570 AGAGAGGAACAAGATGAGGCTGG - Intergenic
956772484 3:72538187-72538209 AAAGAGAACAGTGAGGAGGAAGG + Intergenic
956918494 3:73900381-73900403 AAAGAAAACCTAGAACAGGAAGG - Intergenic
957162900 3:76633509-76633531 AAGGAGAAAGAAGATGAGAAAGG + Intronic
957564241 3:81864518-81864540 AAAAACAATCAAGATGCGGAAGG + Intergenic
957572236 3:81961772-81961794 AAAGAGACCCAAAATTAGAAAGG - Intergenic
958025535 3:88044380-88044402 AAAGTGAACAAAAATGAAGAGGG - Intergenic
958890601 3:99778246-99778268 AAAAATAACTAAGATGGGGAGGG + Intronic
959561947 3:107792189-107792211 AAAGAGAATCAACAGGAAGAAGG - Intronic
959948007 3:112148194-112148216 AATGAGATCCAAGATGAAGCTGG - Intronic
960427825 3:117530790-117530812 AAGGAGAAGAAAGATGAAGAGGG - Intergenic
960672106 3:120164362-120164384 AAAGAGAAAAAAGAGAAGGAAGG - Intergenic
961037871 3:123655302-123655324 GGAGAGAACCAAGAGGAGGCTGG - Intronic
961969704 3:130947967-130947989 AAAAATAACAAAGATGAGGGAGG - Intronic
962533122 3:136301959-136301981 AAAGAGAAAAAAAATGAAGATGG + Intronic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962849952 3:139300975-139300997 AAAGTGAACCAGGTTGGGGAGGG + Intronic
963587324 3:147208672-147208694 AAAAATAACCAAGATTAGGGTGG - Intergenic
964467804 3:157016967-157016989 AAAGAGAAAAAAGATGAGATGGG + Intronic
965741934 3:171884723-171884745 AAAGAGAAAAAAGCTGAAGATGG - Intronic
965988976 3:174792238-174792260 AAAGAAGACGAAGATGAGGAAGG + Intronic
966167577 3:177037804-177037826 AAACAGAACCAATAAGAAGATGG - Intronic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966473540 3:180319331-180319353 AAGGGGAAGTAAGATGAGGATGG - Intergenic
966627281 3:182031879-182031901 AAAGGGAAAAGAGATGAGGAGGG - Intergenic
967114210 3:186322007-186322029 AGAGAGAAACAAGCCGAGGAAGG - Intronic
967376986 3:188815363-188815385 ATAGAGAACCAAGATGTTCAAGG + Intronic
967414956 3:189206141-189206163 AAAGAGAAGAAAGATAAAGAAGG - Intronic
967515207 3:190360658-190360680 AAAGAGAACAAAGAATAGAATGG - Intronic
967948179 3:194820558-194820580 AAGGAGAACCATGGAGAGGAGGG + Intergenic
969820474 4:9716370-9716392 AGAGGGAACAAAGATGAGGGAGG - Intergenic
970136432 4:12929678-12929700 AAAGAGAACTGAGATGAGAGAGG - Intergenic
970783677 4:19770300-19770322 AAAGAGATCAAAGTAGAGGATGG - Intergenic
971077212 4:23164142-23164164 AAACAGAATGAAGATGAGTAAGG - Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971428882 4:26542736-26542758 CAAGAGAATAGAGATGAGGAGGG + Intergenic
971514355 4:27467954-27467976 AAAGAAAAAGAGGATGAGGAAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972279606 4:37589591-37589613 GAAGAGAGCCAAAAGGAGGAAGG - Intronic
972322282 4:37983022-37983044 AATGAGGACCAGGATGAGCATGG + Intronic
972771123 4:42197904-42197926 AGAGAGAAGGAAGAGGAGGAAGG + Intergenic
973623403 4:52749361-52749383 ACAGAGTTGCAAGATGAGGAGGG - Intronic
973858658 4:55039034-55039056 AAAGAGAGGCTATATGAGGAAGG - Intergenic
973987915 4:56373505-56373527 AAAGAGAAGCAAGAGAAAGAAGG + Intronic
974574957 4:63706743-63706765 AAAGAGAATCAAAATGGGAAAGG + Intergenic
974811784 4:66955308-66955330 AACGAGGAACAAGAAGAGGAAGG + Intergenic
975351831 4:73355884-73355906 AGAGAGAACAAAGATGACTAAGG - Intergenic
975679972 4:76866957-76866979 ACAGACAATCCAGATGAGGAAGG + Intergenic
975871245 4:78781093-78781115 AGAGAGATCCAAGATGATGTTGG + Intronic
975921965 4:79401915-79401937 AAAGAGAAACAAGGTGAGGAAGG - Intergenic
976022540 4:80646750-80646772 AAAGAGAAGCAACAGGAGAAGGG - Intronic
976081450 4:81359590-81359612 AAAGAGAACCCAGAAGAAGGAGG + Intergenic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976379057 4:84378882-84378904 AATGAGAAGGAAGATGAGGCTGG + Intergenic
976387682 4:84480270-84480292 AGAGATAGCCAAGATGAGGAAGG + Intergenic
977374558 4:96185165-96185187 AGAGAGGACAAAGAAGAGGAGGG - Intergenic
977474031 4:97481901-97481923 AATGAGAAGCAAGACAAGGATGG - Intronic
977537590 4:98273094-98273116 GACGAGAGCCTAGATGAGGAGGG - Intronic
977761850 4:100747017-100747039 AATGAGATCCAAGATAAGGTTGG + Intronic
981585955 4:146302601-146302623 AATGAGAAACAAGTTGAGGTGGG + Intronic
981602320 4:146504222-146504244 AAAGATAACCAAAATGGGCAGGG + Intronic
981632599 4:146837731-146837753 AAACAGAGCCAGGATCAGGATGG + Intronic
981901460 4:149869953-149869975 AAATAGAACCAATATGAATAGGG - Intergenic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
982296641 4:153835793-153835815 AAAGGCAACCAAGGGGAGGAAGG - Intergenic
983168769 4:164512206-164512228 AAAGAGGTGCAAGAGGAGGAAGG - Intergenic
983307935 4:166017678-166017700 AAAGAGAAAGAACAAGAGGAAGG - Intronic
983311699 4:166072383-166072405 AAAGAAAAGAAAGAAGAGGAAGG - Intronic
983313738 4:166099245-166099267 AAAGAAAAATAAGATGAGTAAGG - Intronic
983501433 4:168504104-168504126 AAGGAGGACAAAGATGAGGCAGG - Intronic
983531820 4:168817655-168817677 GAAGAGAACAAAGATTTGGAAGG + Intronic
984094027 4:175411846-175411868 AAAAAAAAACAATATGAGGAGGG - Intergenic
984361874 4:178744240-178744262 CAAGAGCACCAAGAGGATGAAGG + Intergenic
984615152 4:181888877-181888899 AAATAGAACAAAAATGTGGAGGG - Intergenic
984791527 4:183619398-183619420 AAAGAGAACCCAAATGAGTGGGG - Intergenic
985085061 4:186304902-186304924 AATGAGACCCAAAATGAGAAAGG - Intergenic
985431403 4:189884605-189884627 AAAAAGACACAAGAGGAGGAAGG - Intergenic
985505530 5:278081-278103 AAAGAGGACAAAGGTGGGGAAGG - Intronic
985530396 5:430597-430619 AAAGAGGTCAAAGGTGAGGATGG - Intronic
986778242 5:11039374-11039396 AAAAAGCATCAAGATGAGAAAGG - Intronic
987246457 5:16054093-16054115 ACTGAGAGCCAAGATGGGGATGG + Intergenic
987435717 5:17891593-17891615 AACGAAAACAAAGAAGAGGAAGG + Intergenic
987517997 5:18939685-18939707 AAAGAGAACAAAATTGTGGATGG + Intergenic
988215707 5:28269508-28269530 AAAGAGAACCAATACAAGAATGG + Intergenic
989654266 5:43728374-43728396 AAAGGGAACCATGTTGAGTATGG - Intergenic
991395478 5:66199861-66199883 AAACAGAACTAAGTTGGGGATGG - Intergenic
992507375 5:77400511-77400533 AAAGAAAAACAAGATGGGGAGGG - Intronic
992779595 5:80116040-80116062 TGAGAGAACCATGATGGGGAAGG + Intronic
993061202 5:83041217-83041239 AATGAGAAACAACATGTGGATGG - Intergenic
993331258 5:86603177-86603199 AAAGAGACCCTAGAAGATGATGG + Intergenic
993517336 5:88854675-88854697 AGAGAAAACAAAGATGAGTAAGG + Intronic
994507020 5:100656478-100656500 GAAGAGAACTAAGAGGAGAAAGG - Intergenic
994930466 5:106176480-106176502 AAAGAGAAGCAAGATTGGCACGG - Intergenic
995097312 5:108253516-108253538 AAAGAGAACAAAGAAGAGAGAGG - Intronic
995854718 5:116578929-116578951 AAAGACAGCATAGATGAGGAAGG - Intergenic
995899835 5:117052701-117052723 AAAGAGGACCAAAGTGAGGTGGG - Intergenic
996946325 5:129073742-129073764 AAAGACAACCATGATAAGGTGGG - Intergenic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997922773 5:137998811-137998833 GAAGAGGACCATGATGGGGATGG - Intronic
999595938 5:153204765-153204787 GCAGAGAACCAATTTGAGGAAGG - Intergenic
999644896 5:153707896-153707918 AGAGAGAACCAAGCAGGGGAAGG + Intronic
999685249 5:154097037-154097059 AGAGAGAGCCAAGATGAATATGG + Intronic
1000111991 5:158117054-158117076 AAAGAGAAAGAGGAAGAGGAAGG - Intergenic
1000137723 5:158368908-158368930 AAAGAGGACCAAGGGGAGGGAGG - Intergenic
1000639641 5:163686313-163686335 CCGGAGAACCAAGCTGAGGAAGG + Intergenic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001744959 5:174085393-174085415 AAAGAGAACCAGTGTGAGGTGGG - Intronic
1002531070 5:179845790-179845812 AAAAAGAACCAAAAAGAGGCCGG - Intronic
1003106879 6:3224067-3224089 AAAGATAACCGTGATTAGGATGG + Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003409409 6:5849913-5849935 AAGGTGAACGAGGATGAGGAAGG - Intergenic
1004526014 6:16408492-16408514 AATGAGGAACATGATGAGGATGG + Intronic
1004951753 6:20681028-20681050 AATGAAAACACAGATGAGGAAGG + Intronic
1006119261 6:31794412-31794434 AAAGAGAAATGAAATGAGGAAGG - Intronic
1006573664 6:35026829-35026851 GAAAAAAACCAAGATGAGAAAGG - Intronic
1006677648 6:35775964-35775986 ACAGAGAATCAACATCAGGAAGG + Intergenic
1007095971 6:39213443-39213465 ATACAAAATCAAGATGAGGAGGG - Intronic
1007413775 6:41680221-41680243 AAAGAAAAAAAAGATGAGGCTGG + Intergenic
1008256034 6:49301168-49301190 AAAGATAAACAACATGAGGAAGG - Intergenic
1008276844 6:49551856-49551878 AAAGAGAAACAAGAGGGGGGCGG - Exonic
1008528040 6:52427304-52427326 AAAAGGACCCAAGATGAGGCTGG - Intronic
1008581209 6:52908982-52909004 AAAGAGAACAAAGAGAAGGAGGG + Intronic
1009371226 6:62905649-62905671 AAAGGGAAGGAAGAAGAGGAAGG + Intergenic
1009827668 6:68887966-68887988 AAGGAGCACCAATATGAGAAGGG - Intronic
1010388929 6:75313990-75314012 AAAGAGAAATAACAAGAGGAAGG - Exonic
1011002660 6:82608284-82608306 AAGGACAACAAAGTTGAGGAGGG + Intergenic
1012106013 6:95159293-95159315 AAAAAAAAAAAAGATGAGGAGGG + Intergenic
1012463546 6:99491400-99491422 AAATAGAACCTAGAATAGGATGG + Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013498875 6:110727639-110727661 GAAGAGAACTAAGATGGAGAGGG - Intronic
1013949905 6:115767255-115767277 AAAGAGACCTAAGTTCAGGAAGG + Intergenic
1014075264 6:117228183-117228205 ACAGAGAAACAAAGTGAGGAGGG - Intergenic
1014207583 6:118672890-118672912 GAAGAGAAAGAAGAGGAGGAGGG + Intronic
1014634105 6:123823756-123823778 CAAGAGACTCAAGAAGAGGAAGG + Intronic
1014808239 6:125856278-125856300 AATGAGGACCAAGTTGAGGGTGG - Intronic
1015136260 6:129874754-129874776 AAATATAACCCAGATGAGGCTGG - Intergenic
1015431859 6:133141168-133141190 AAAGAGAACCATGAAGAACAAGG + Intergenic
1015861803 6:137689264-137689286 AGAGAGAATCAAGATGGAGAAGG - Intergenic
1016192845 6:141292089-141292111 AAAGAAAATCAAGATGAGTTTGG - Intergenic
1017297216 6:152811983-152812005 AAAGAGAAAGAAGAGGAGGAAGG - Intergenic
1017683059 6:156883477-156883499 AAAGAAAAGCAAGGAGAGGAAGG - Intronic
1018654924 6:166025831-166025853 ACAGAGAACTAGGATGAGGATGG - Intergenic
1018925719 6:168205658-168205680 AAAAAGAAAAAAGATGAAGAAGG - Intergenic
1019131890 6:169883032-169883054 AGAGAGAACCAGGGTGGGGAAGG - Intergenic
1019560992 7:1657174-1657196 ACAGAGAAACAAGATGAAGCGGG + Intergenic
1019702650 7:2481445-2481467 GTAAAGAACCAAGATGGGGATGG + Intergenic
1019816012 7:3201387-3201409 AAAGGGAACCCAGAGGAGAAAGG + Intergenic
1019971382 7:4543723-4543745 TAAGAGAGAGAAGATGAGGAAGG - Intergenic
1020031896 7:4939214-4939236 AAAAAAAACAAAGTTGAGGAGGG + Intronic
1020734436 7:11929525-11929547 AAAGATAAGCAAAATGAAGAAGG + Intergenic
1020923396 7:14293887-14293909 AAAGCAAACAAAAATGAGGAGGG - Intronic
1021474760 7:21048493-21048515 AAAGAGAATAAAGTTGAGGGTGG + Intergenic
1021480116 7:21106454-21106476 AAAGAGAACCCGGGGGAGGAAGG - Intergenic
1021806478 7:24361884-24361906 GAAGAGAAACTGGATGAGGATGG - Intergenic
1022465962 7:30653395-30653417 ACAGAGAACCCAGAGGAAGAAGG + Exonic
1023027378 7:36062934-36062956 AAAGACAACTCAGATGAGGTTGG - Intergenic
1023762966 7:43483875-43483897 AATGAAAGCCAAGAAGAGGAAGG + Intronic
1023784208 7:43689998-43690020 ATAGAAAACAAAGATGAAGATGG + Intronic
1023978998 7:45055125-45055147 AAAGAAAAGCAAGATAATGATGG + Intronic
1024823333 7:53360118-53360140 AAAGAGAAATAATCTGAGGAGGG - Intergenic
1025298621 7:57798054-57798076 AAAGATAACCAAGGAGAGGATGG - Intergenic
1025754954 7:64329974-64329996 AAAGAGAAAAAAGAGTAGGAAGG - Intronic
1026598430 7:71753294-71753316 AAAGAGAAAGAAGCTGGGGATGG - Intergenic
1027002871 7:74666492-74666514 AAAGAAAACGAACAGGAGGAAGG - Intronic
1027206872 7:76107324-76107346 ACAGAGAACTAAGAATAGGATGG - Intergenic
1027234202 7:76288111-76288133 AAAGAAAAGAAAGAAGAGGAAGG + Intergenic
1027545948 7:79527864-79527886 AGAGAGAAGGAAGAAGAGGAGGG - Intergenic
1028225180 7:88242193-88242215 GAATAGAACACAGATGAGGAAGG - Intergenic
1028696374 7:93717712-93717734 AAAGAGAAAGAAAAGGAGGAAGG + Intronic
1028746099 7:94328396-94328418 AAAAAGAATGGAGATGAGGAAGG + Intergenic
1030162849 7:106526198-106526220 AAAGAGTACCCAGATAAGAAAGG + Intergenic
1030253575 7:107480514-107480536 TAAAAGAACCCAGATGAGGCTGG + Intronic
1031044600 7:116873943-116873965 AAAGAGAACAAAGGGAAGGAGGG - Intronic
1032140394 7:129324421-129324443 AACGAGAACAAAGAAGAGGTGGG - Intronic
1032230745 7:130071318-130071340 AAAGAGAACCTAGAGGATTAGGG + Intronic
1032837821 7:135690205-135690227 AAAGAGAACCAAGTTTAGCATGG + Intronic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034093427 7:148384706-148384728 AAAGAGGAAGAAGATGAGGCAGG + Intronic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035031747 7:155865465-155865487 GAAGGGAACAATGATGAGGAGGG - Intergenic
1037549701 8:19958339-19958361 AAATAGAACCATGATGATGGAGG - Intronic
1037755981 8:21710309-21710331 GCAGAGAAGGAAGATGAGGATGG - Intronic
1037779360 8:21857087-21857109 AAAGATAACAAAGAAGTGGATGG + Intergenic
1037968392 8:23152123-23152145 TAAGAGAGCCAAGATGGAGAAGG + Intronic
1039164345 8:34660408-34660430 AAAGAAAATGAAGATGAAGATGG + Intergenic
1039780920 8:40784572-40784594 AAAGAGATCTAAGAATAGGAAGG + Intronic
1039992255 8:42498412-42498434 AAAGGGAAACAAGATGAGTGGGG - Intronic
1040551404 8:48440281-48440303 AGAAAGAACCAACATGAGGTGGG + Intergenic
1040718388 8:50287132-50287154 AAAGAAAGCCAGGATAAGGATGG - Intronic
1040854889 8:51938429-51938451 AAAGGGAACCATGCTGAGCAGGG - Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1041043785 8:53872580-53872602 AAACAGAAACCAGACGAGGAAGG - Intronic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041162248 8:55057555-55057577 CAAGATAACAGAGATGAGGATGG - Intergenic
1042397797 8:68311806-68311828 AGAGAGAAGGAAGAAGAGGAGGG - Intronic
1042546020 8:69952330-69952352 AAAGCAAACTAAGATGAAGAAGG - Intergenic
1043332683 8:79137153-79137175 AAATAGAACAAAGAGGAGGAAGG + Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043754870 8:83990522-83990544 AGAGAAAACCAAGCCGAGGAAGG - Intergenic
1044185019 8:89240418-89240440 AAGGAGGACCCAGATGAAGAAGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046332272 8:112734225-112734247 AAAGAGAAAGAAGAGGAGGAAGG + Intronic
1047612738 8:126537060-126537082 AAAGAGCACCAAGAAGATGAAGG - Intergenic
1047692971 8:127375218-127375240 AAAGAGAAGGAAGATGTGAAGGG - Intergenic
1048586698 8:135780658-135780680 AAAGACAAGAAAGGTGAGGAAGG - Intergenic
1048601354 8:135922020-135922042 ACAGAGAAATAGGATGAGGAGGG + Intergenic
1048603800 8:135946834-135946856 AGAGAGAAGCAAGATAGGGAAGG + Intergenic
1048889422 8:138934437-138934459 AAAAAGAAGGAAGAGGAGGAAGG + Intergenic
1050340537 9:4633349-4633371 AATGATAACCAAGTTGAGAATGG - Intronic
1050767815 9:9157584-9157606 AAAGAGACCAAAAATGAGGAAGG + Intronic
1051324888 9:15955282-15955304 AAAGAGAAAGATGAAGAGGAGGG + Intronic
1051376849 9:16410656-16410678 AATTAAAACCAAGATGAGGGAGG + Exonic
1051859661 9:21609956-21609978 ACAGATAAGGAAGATGAGGAAGG + Intergenic
1051993455 9:23182703-23182725 AAAAAGTCCCAAGTTGAGGATGG - Intergenic
1052109216 9:24559864-24559886 AAAGAGGACCAGGTTTAGGAAGG + Intergenic
1052200948 9:25779166-25779188 ACTGAGAACTAACATGAGGAGGG - Intergenic
1052251888 9:26408337-26408359 CAATAGAACCATGACGAGGATGG - Intergenic
1052369937 9:27652526-27652548 AAAAAAAACAAAGATGCGGATGG + Intergenic
1052494617 9:29212041-29212063 ACAGAGAACCAAGAGGCGAAAGG + Intergenic
1052801123 9:32969320-32969342 AAAGAGACCCAAGATGTGGGAGG - Intergenic
1052817858 9:33115466-33115488 AAAGAGCCCCAGGATGTGGATGG + Intronic
1053416930 9:37952722-37952744 AAAAGGAATCAAGATGATGACGG + Intronic
1053794970 9:41717965-41717987 AAAGAGAACCAAGGAGAGGATGG + Intergenic
1053798417 9:41746968-41746990 GTAGAGTACCAAGATGAGGCAGG - Intergenic
1054146781 9:61567989-61568011 GTAGAGTACCAAGATGAGGCAGG + Intergenic
1054150204 9:61596859-61596881 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1054183378 9:61930028-61930050 AAAGAGAACCAAGGAGAGGATGG + Intergenic
1054186832 9:61959019-61959041 GTAGAGTACCAAGATGAGGCAGG - Intergenic
1054466517 9:65499042-65499064 GTAGAGTACCAAGATGAGGCAGG + Intergenic
1054469974 9:65527963-65527985 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1054651675 9:67629501-67629523 GTAGAGTACCAAGATGAGGCAGG + Intergenic
1054655128 9:67658446-67658468 AAAGAGAACCAAGGAGAGGATGG - Intergenic
1055146995 9:72947971-72947993 AAAGAGAATCAAGGAGAGAAAGG + Intronic
1055212941 9:73820250-73820272 AAAAACAACAAATATGAGGATGG - Intergenic
1055652025 9:78415499-78415521 AAATAGAATCATGAGGAGGATGG + Intergenic
1056236653 9:84601253-84601275 AAAGATCTCCAAGATGAGGGCGG + Intergenic
1056287041 9:85098986-85099008 ACAGAAAACCAAGATTAAGATGG - Intergenic
1056486529 9:87063640-87063662 AAAAAAAAAAAAGATGAGGAAGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057530590 9:95842220-95842242 AAAGAGCTCCAGGATGAGGGGGG - Intergenic
1057765673 9:97916044-97916066 AAACAAAACAAAGATGAGGGTGG + Intronic
1057962219 9:99467775-99467797 AAACAGAAACAAGAAGAGGAGGG + Intergenic
1058006199 9:99917992-99918014 AGGTAGAACCAAGTTGAGGATGG - Intronic
1058261706 9:102841370-102841392 AAAGAAAACCTAGATAAGGGAGG + Intergenic
1058379946 9:104366597-104366619 AAAGAGCAGCAAGGGGAGGAGGG + Intergenic
1058875873 9:109244397-109244419 AAAGAGAAAGAAGAGAAGGAAGG + Intronic
1058976344 9:110128371-110128393 AAAGAGAGGCAGGATGAGAAGGG + Intronic
1060932888 9:127499993-127500015 AAAGTGAACCGTGATCAGGAAGG + Intronic
1185755769 X:2651917-2651939 AGAGAGAAAGAAGATGAGGGAGG - Intergenic
1186507393 X:10104013-10104035 AAACAGAACCAACAAGAGTAGGG + Intronic
1187026030 X:15436333-15436355 GAAGAGAATAAAGATGATGACGG + Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187261547 X:17689197-17689219 GAAGGGAAAAAAGATGAGGAGGG - Intronic
1187261551 X:17689215-17689237 AAAGGAAAAAAAGATGAGGAAGG - Intronic
1187272184 X:17789230-17789252 AAATAGACGCTAGATGAGGATGG - Intergenic
1188344396 X:29045995-29046017 AAAAAGAAGCAAGAAGAAGAAGG - Intronic
1189040036 X:37532620-37532642 AAAGCACACCAAAATGAGGAAGG - Intronic
1189124099 X:38427146-38427168 AAAGAGGAAAAAGATTAGGAAGG + Intronic
1189776995 X:44478954-44478976 AAATAAAACCAAAATGAAGATGG - Intergenic
1189907582 X:45777375-45777397 AAAGAGAAACAGGATAAGGAAGG + Intergenic
1190128432 X:47725294-47725316 AAAGAGATCCAACAGAAGGAGGG - Intergenic
1190828510 X:54040520-54040542 AATGGGAACCAAGAGGAAGAAGG + Intronic
1190929328 X:54934687-54934709 ACAGAGCACCAAGCTGTGGAAGG - Intronic
1191937686 X:66442799-66442821 GAAGGGAACAAAGAAGAGGAGGG - Intergenic
1191961728 X:66710837-66710859 AGAGAGAACCAAAATGGGGTTGG + Intergenic
1192828233 X:74721764-74721786 AAAGAAAACCCAGATGTGGGTGG + Intergenic
1193284393 X:79695038-79695060 AAAGATAAAAAAGATGAAGAAGG - Intergenic
1194391952 X:93329894-93329916 AAAGAGAAACAAGGAGAGAATGG - Intergenic
1194658992 X:96607865-96607887 AAAGGGAAACAAGATGATGGAGG - Intergenic
1196028345 X:111067223-111067245 AATGAGAAACAAGATAAAGATGG - Intronic
1196537612 X:116866302-116866324 AAAAATAACCAAGATCAGAATGG - Intergenic
1196756428 X:119161330-119161352 AAAGAGAGGCCAAATGAGGAAGG + Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1197696206 X:129553149-129553171 AGAGAGAAACTAGATGAGTATGG + Intronic
1198196500 X:134368172-134368194 AAAGTCAACCAGGAAGAGGAAGG - Intergenic
1198741504 X:139847979-139848001 ATAGATGACCATGATGAGGATGG - Intronic
1199059713 X:143340553-143340575 AAAGAGAAAGAAGAGGAGGAGGG + Intergenic