ID: 921573922

View in Genome Browser
Species Human (GRCh38)
Location 1:216811823-216811845
Sequence TTCCATTTTAAGCCTAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921573919_921573922 24 Left 921573919 1:216811776-216811798 CCATTGATTTTTACAGGTGTTTA 0: 1
1: 0
2: 1
3: 29
4: 344
Right 921573922 1:216811823-216811845 TTCCATTTTAAGCCTAGTGATGG 0: 1
1: 0
2: 0
3: 11
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921573922 Original CRISPR TTCCATTTTAAGCCTAGTGA TGG Intronic
901831832 1:11897708-11897730 TTTTTTTTTAAGGCTAGTGAAGG - Intergenic
902184625 1:14715901-14715923 GTCCATTTTAAGTGTAGAGATGG - Intronic
902475630 1:16684221-16684243 TTCCTTTTGAAGCCATGTGAAGG + Intergenic
904192596 1:28758502-28758524 TTCCATTTTGAGACTTGTGATGG - Intronic
908676409 1:66609170-66609192 TTAGATTTTAAGCCAATTGAAGG - Intronic
911728204 1:101264695-101264717 ATCCATTTTGAGCCTAGAAAAGG + Intergenic
915953009 1:160202599-160202621 TTCAATTTAAGGCCTAGTAAAGG - Intergenic
916798604 1:168192196-168192218 TTCAATTTTCAGCCTGGTGGCGG + Intronic
916823646 1:168424271-168424293 TTCCTTTTGAAGCCAAGTCAGGG - Intergenic
917156152 1:172001121-172001143 TTCCATTTTAATCATAGGAAAGG + Intronic
921573922 1:216811823-216811845 TTCCATTTTAAGCCTAGTGATGG + Intronic
924643457 1:245855764-245855786 TTCCATTTTAATCCAAATTATGG - Intronic
1063281816 10:4637918-4637940 TTTCATTTGAAGCATAGTTATGG - Intergenic
1063515751 10:6693466-6693488 TTCAATTTTAATCCTAATGTTGG + Intergenic
1070345182 10:75534831-75534853 TCCCCTTTTAAGCCTAATTAGGG + Intronic
1073165587 10:101446731-101446753 TTCCATTATAAAGCTAGTCAGGG - Intronic
1073700423 10:105920509-105920531 TTCTATTTTCATCCTAGAGAAGG + Intergenic
1074093237 10:110283434-110283456 TTCTATTTTTAGCCTAGACACGG + Intronic
1074854807 10:117465697-117465719 TTCCATCTCAAGCCCTGTGATGG + Intergenic
1075160690 10:120022174-120022196 TCCCACTGTAAGCCTATTGATGG + Intergenic
1080270339 11:30444829-30444851 TTCCATATTAAACATGGTGATGG - Intronic
1081005392 11:37730378-37730400 GGCCATTTTAAGCCAAGTGAAGG + Intergenic
1081482574 11:43503382-43503404 TTCTATTTTAACCCTCCTGATGG - Intergenic
1088494556 11:110420136-110420158 TTCCTTTTTTAGCATAGTGCGGG - Intergenic
1088615774 11:111626410-111626432 TTCCAGTTTAAGCCAAGTAAGGG - Intronic
1088782048 11:113145049-113145071 TTCCATATTAAGCTAAGTGGAGG - Intronic
1091072229 11:132578407-132578429 TTCAATTTTTTGCTTAGTGACGG - Intronic
1091471113 12:728110-728132 TCCCATTTTCCTCCTAGTGAAGG + Intergenic
1092035280 12:5329215-5329237 TTCCTTTTTAAGGGCAGTGAAGG + Intergenic
1093861164 12:24169624-24169646 TTCTATCTTTAGCCTAGTGCTGG - Intergenic
1094060093 12:26304496-26304518 TTGCATTTAAAGCCTTGAGAAGG - Intergenic
1096728262 12:53583069-53583091 ATCCATTTTAAGTTTTGTGAAGG - Intronic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097675820 12:62602328-62602350 TTTCTTTTTAAGCCAAGTTAGGG - Exonic
1099560627 12:84169817-84169839 TTCAATATTTAGCCCAGTGATGG - Intergenic
1100182224 12:92098083-92098105 TTTCATTTTAAGCCTTTTGCTGG + Intronic
1109420798 13:62108989-62109011 TTCCATTTAAAACCTTCTGAAGG + Intergenic
1115137030 14:30122589-30122611 TTCCATTTTCAGAATAGTAAAGG + Intronic
1119432372 14:74576724-74576746 TTTAATTTTAAGCTTAGGGAAGG - Intronic
1119750625 14:77075081-77075103 TTTCAACTCAAGCCTAGTGATGG + Intergenic
1120062930 14:80005712-80005734 TTCCATTTTAATCAGGGTGATGG - Intergenic
1121745698 14:96289248-96289270 TTCCACGTTCAGCATAGTGAAGG + Intronic
1125197368 15:37062666-37062688 TTCTAATTTTATCCTAGTGAGGG + Intronic
1125513443 15:40305119-40305141 CCCCACCTTAAGCCTAGTGAGGG + Intronic
1126933376 15:53679287-53679309 TACCATTTTAAGCTTTTTGAAGG - Intronic
1134769238 16:16791853-16791875 TTACATTTTCAACCTCGTGAGGG + Intergenic
1141053148 16:80791428-80791450 TTACATTGTAAGCTTTGTGAGGG - Intronic
1141091647 16:81134417-81134439 TTTCATTTTAAGGCCAGTCATGG + Intergenic
1144256744 17:13475899-13475921 TGCCTTTGTAAGACTAGTGAAGG + Intergenic
1145098875 17:20056619-20056641 TTCCATTTTAAGCTTAGGTGAGG - Intronic
1145111869 17:20170759-20170781 TTCCAAATTAAGCCTAATTATGG + Intronic
1150206324 17:63411375-63411397 TTCCATTTTAAGACTGATGCTGG - Intronic
1155127394 18:22891862-22891884 CTCCATTTTAAAGCTAGTAATGG - Intronic
1155810990 18:30234965-30234987 TGCCACTTTATGCCTAGTCATGG - Intergenic
1156918776 18:42493340-42493362 TTCCATTTTACACATAGGGAAGG + Intergenic
1158761606 18:60395730-60395752 TTTTTTTTTAAGTCTAGTGAGGG + Intergenic
1163856045 19:19702960-19702982 TTCCATTTTTAGGCCAGTCATGG - Intergenic
926852687 2:17217385-17217407 TTTCATTTTAACCATTGTGATGG - Intergenic
927668670 2:25050732-25050754 TTCCATTTTGAGCTTACTGTAGG + Intronic
928761505 2:34588464-34588486 TTACATTTTAAGCTCTGTGAAGG + Intergenic
929533971 2:42769007-42769029 TTGCATTTTAAAGCTAGTGTAGG - Intronic
937698605 2:124837759-124837781 TTCAAATTTCTGCCTAGTGAAGG - Intronic
938652007 2:133392673-133392695 TTCAATTTTAAGCTTATTAAGGG - Intronic
943805616 2:192121398-192121420 GTCCATTGTGAGCCTAGAGAAGG + Intronic
947496620 2:230642495-230642517 TACCATCTCAAGCCAAGTGAGGG + Intergenic
1170269091 20:14503705-14503727 GTGGATTTTTAGCCTAGTGAGGG - Intronic
1173760932 20:45559879-45559901 TTCCTTTTTAAGGCTAGACATGG + Intronic
1174714152 20:52738876-52738898 TGGCATTTTCAGCCTTGTGAGGG - Intergenic
1181993143 22:26853253-26853275 GTTGAATTTAAGCCTAGTGAGGG + Intergenic
1184937801 22:47737765-47737787 TGCCAACTTAAGCCAAGTGATGG - Intergenic
949260910 3:2101590-2101612 CTATGTTTTAAGCCTAGTGAAGG + Intronic
949908834 3:8882995-8883017 TTGCACTTAAAGCCTATTGAAGG - Intronic
949950677 3:9226225-9226247 TTCCATTTTGAGCCTCTTCAGGG + Intronic
952576180 3:34776563-34776585 TTCCTCTTTATGCTTAGTGAGGG + Intergenic
957419935 3:79954539-79954561 TACCATTGTAAGCCTAGAGAAGG + Intergenic
966030298 3:175338275-175338297 ATCCATTTTAAGCATTGTGATGG + Intronic
967521962 3:190442178-190442200 TGCCATGTTAGGCATAGTGAGGG - Intronic
968877155 4:3277447-3277469 TTCGATGTGAAGCCTAATGAGGG - Intergenic
970239916 4:13998204-13998226 TGCCATTTCAAACCTAGTCAAGG - Intergenic
973165462 4:47071492-47071514 TGCCATTTTATACCTTGTGAAGG - Intronic
974311863 4:60222719-60222741 TTCCATCTTAAGCTTTGGGATGG - Intergenic
977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG + Intronic
983067791 4:163231224-163231246 CTCCATTTTAAGACTAATGTTGG + Intergenic
985610976 5:888407-888429 TTCTATTTTATGCTTACTGAAGG - Intronic
985980702 5:3460632-3460654 TTCCACTTGAAGGCTTGTGATGG - Intergenic
987263822 5:16230368-16230390 TTCCATTTGATGCCTAGAAATGG - Intergenic
988442039 5:31244415-31244437 TCCCATCTTAAGCCTAATTAAGG + Intronic
991190722 5:63869986-63870008 TGTCATTTTAAGTCTAGAGATGG + Intergenic
994382879 5:99092446-99092468 CTCCCTTTTAAGCCTACAGAAGG + Intergenic
996547329 5:124694291-124694313 TTTCATTTTAAGATTAATGAGGG - Intronic
998121035 5:139578007-139578029 TTTCCTTTGAAGCCTAGTGAGGG + Intronic
998657325 5:144195987-144196009 TTGGATTATAAGCTTAGTGAAGG + Intronic
1000046744 5:157528140-157528162 TTCCATTTGAACCCTGGAGAAGG - Intronic
1008657451 6:53630267-53630289 TTCCATTTTAAGACAAGAGGGGG + Intergenic
1009163175 6:60307981-60308003 TTCCATCTTTATCCGAGTGATGG + Intergenic
1009955080 6:70444012-70444034 TTCCATTTTAAGAGTTGTGGTGG - Intronic
1012848410 6:104418595-104418617 TTCTATTTTAAGCCTGGAGCAGG + Intergenic
1014623349 6:123696651-123696673 CTTCATTTTAAGCCCATTGAGGG + Intergenic
1016577770 6:145589591-145589613 TTTCATTTAAAAACTAGTGAAGG + Intronic
1016616370 6:146053088-146053110 TTCCATCTGAAGGCTAATGATGG - Intronic
1017600357 6:156073784-156073806 TTCCATTTTCTACCTAGTGTAGG - Intergenic
1020341337 7:7114265-7114287 TTCCAGCTTAAGCGTAATGAAGG - Intergenic
1022389522 7:29931128-29931150 TTCCCTCTAAAGCCTTGTGAGGG + Intronic
1023326276 7:39060939-39060961 TTTTTTTTTAAGCTTAGTGATGG - Intronic
1026641443 7:72129684-72129706 TTCAAGTTAAAGCTTAGTGATGG + Intronic
1029022478 7:97379335-97379357 TTACATTTTAAGCAAATTGAAGG + Intergenic
1031821283 7:126505126-126505148 ATCCATTTTAGTCCTAGTGAAGG - Intronic
1033513057 7:142079600-142079622 TTGCATTTAAAGACTAGGGATGG + Intronic
1033918847 7:146362668-146362690 TTCTATTCTAAGTCTAGTGGAGG + Intronic
1035787409 8:2272488-2272510 TTCCATTTTAAAGTTAGTTAAGG - Intergenic
1035805398 8:2449228-2449250 TTCCATTTTAAAGTTAGTTAAGG + Intergenic
1037139634 8:15504545-15504567 TTCTATTTTAATCCTATTAAAGG + Intronic
1038112330 8:24513424-24513446 TTCCCTTTTATGCACAGTGATGG - Intronic
1038438769 8:27557353-27557375 CTACATTTTGAGCCTAGTGTTGG - Intergenic
1039481650 8:37878224-37878246 TTACATTTTTACCCTACTGAAGG - Intronic
1040100361 8:43495568-43495590 TTTCATTTTAAAGCTAATGAGGG + Intergenic
1043083962 8:75803834-75803856 TTCCATTTTATGGGTAGAGAAGG - Intergenic
1052675567 9:31618082-31618104 TTACATTTTAAGACTAATAAAGG + Intergenic
1056226776 9:84503650-84503672 TTACATTAGAAGTCTAGTGAGGG + Intergenic
1062421621 9:136485094-136485116 TTGCATTTTATGCCTAGGGCAGG - Exonic
1187534485 X:20126912-20126934 TTCCTTTTGAAGCCATGTGAAGG + Exonic
1187733927 X:22285007-22285029 TTCCATTTGGAGCCTGGTGAGGG - Intergenic
1188457805 X:30387230-30387252 TTCCATTTTAAGCCTTTGGATGG - Intergenic
1188468405 X:30509029-30509051 TTCCATTTTGAGCATGTTGAGGG - Intergenic
1191587794 X:62847972-62847994 TTACATTTCAAGCCTAATGAAGG - Intergenic
1193216443 X:78869914-78869936 CTCCATTATAGGCCTAGAGAAGG - Intergenic
1194301586 X:92193253-92193275 ATCCATTTTAACCCTAGGGTGGG + Intronic
1194793209 X:98177096-98177118 TTCCATTTTGCACCTACTGAAGG - Intergenic
1197488988 X:127092804-127092826 TTCCATGTTAAGCTTCTTGAGGG + Intergenic
1198207533 X:134481944-134481966 TTCCATTTTATGCCTGGTTTGGG - Intronic
1199236211 X:145497342-145497364 TTCCATTTCAAGCCTACTGGAGG + Intergenic
1199506661 X:148570211-148570233 TTTCATCTTAAGCATACTGAGGG - Intronic
1200861822 Y:8000556-8000578 TTCCATTTTACTCCTCGAGATGG - Intergenic