ID: 921578968

View in Genome Browser
Species Human (GRCh38)
Location 1:216873661-216873683
Sequence CATTTTTTCCACACAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 263}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921578965_921578968 -10 Left 921578965 1:216873648-216873670 CCACATATGCCCACATTTTTTCC 0: 1
1: 0
2: 0
3: 21
4: 306
Right 921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 263
921578962_921578968 30 Left 921578962 1:216873608-216873630 CCTCCAACTAGAAATCTGGGGCT 0: 1
1: 0
2: 2
3: 16
4: 121
Right 921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 263
921578963_921578968 27 Left 921578963 1:216873611-216873633 CCAACTAGAAATCTGGGGCTTTA 0: 1
1: 0
2: 2
3: 10
4: 135
Right 921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 263
921578964_921578968 -1 Left 921578964 1:216873639-216873661 CCTACTCAGCCACATATGCCCAC 0: 1
1: 0
2: 1
3: 22
4: 232
Right 921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG 0: 1
1: 0
2: 0
3: 24
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921578968 Original CRISPR CATTTTTTCCACACAGTGCA AGG Intronic
902098025 1:13962396-13962418 AACTTTGTCCACACAGTGGAGGG + Intergenic
903084277 1:20841002-20841024 CAGCTCTTCCACACACTGCATGG + Exonic
904676561 1:32202260-32202282 CCTTTTTGCCACACAGTTGAGGG - Intronic
904811565 1:33166341-33166363 CAATTTTTCCACAAACCGCAGGG - Intronic
905914876 1:41677892-41677914 CATCTTTTCAACACTGTGCAGGG - Intronic
907643958 1:56222057-56222079 CATTTTTTACACAAAATGCAGGG - Intergenic
908680308 1:66653241-66653263 AATTTTCTGCACACAGTCCATGG - Intronic
909294038 1:73922986-73923008 CATTTTATCCAGACAATGCATGG + Intergenic
909724804 1:78821699-78821721 CATTTCTGCAACACAGTGCCTGG + Intergenic
910028343 1:82686109-82686131 CATATTTTACAAAAAGTGCAAGG - Intergenic
911289505 1:96039730-96039752 CATTTTTTCCTCACAAATCAAGG - Intergenic
911891291 1:103375482-103375504 CATTTTGCCCACACATTTCATGG - Intergenic
916072474 1:161178490-161178512 CTTTTTTTCCCCACAGTGTGGGG - Intergenic
916666083 1:166968763-166968785 CATTTTGTTCTCACAGTGGAGGG - Intronic
917473962 1:175352327-175352349 CATTTTATCCCCAAAATGCATGG - Intronic
918565564 1:185926547-185926569 CATTAATTCCACACAGTTCCTGG + Intronic
918885381 1:190186495-190186517 CATCTTTTCACAACAGTGCATGG + Intronic
919133190 1:193476372-193476394 AATTTTTTCCACACAGCAAAGGG - Intergenic
921051715 1:211515820-211515842 GATCTTTTCCAGACAGTGCCGGG - Intergenic
921578968 1:216873661-216873683 CATTTTTTCCACACAGTGCAAGG + Intronic
921760026 1:218902385-218902407 CTTTCTTTCCACAAAGTGCTTGG + Intergenic
923119422 1:230977416-230977438 CATTCTTTCTCCACCGTGCAAGG + Intronic
924399475 1:243663096-243663118 CATCTTTTGCACATAGTCCATGG - Intronic
1063713396 10:8503335-8503357 CATTTTTTCCCCACAGAGGGAGG + Intergenic
1065292033 10:24240268-24240290 TGTTTCTTCCACACAGTGCATGG + Intronic
1067327212 10:45280986-45281008 CATTTTTTCCACTGGGGGCAGGG - Intergenic
1068401419 10:56532427-56532449 CATCTTTACCACACAGTCAAAGG - Intergenic
1068617606 10:59136945-59136967 CTTTTTGTCCACACAATGCAAGG - Intergenic
1069147700 10:64916797-64916819 CAATTATTCCCCACACTGCAAGG + Intergenic
1069243389 10:66170494-66170516 CATTTTTTCAAAACATTGCTTGG - Intronic
1073001593 10:100289942-100289964 CATCTTTTCCACTCAGTGGGTGG - Intronic
1074960446 10:118440399-118440421 CATTTCTTCCCCATAGTGCCTGG + Intergenic
1077013222 11:388751-388773 GAGGGTTTCCACACAGTGCAGGG + Intergenic
1077013232 11:388789-388811 GAGGGTTTCCACACAGTGCAGGG + Intergenic
1077013242 11:388827-388849 GAGGGTTTCCACACAGTGCAGGG + Intergenic
1077762823 11:5122156-5122178 GACTTTTTCCACACATTGGAGGG + Intergenic
1077829749 11:5853721-5853743 TAATTTTTACACACAGTGAAAGG - Intronic
1079117691 11:17651013-17651035 TATTTTTTTCACACACAGCAAGG + Intergenic
1079594188 11:22221942-22221964 CCTTTTTTCCACCCACTGCCTGG + Intronic
1079732903 11:23958443-23958465 CATGCTTTCCACAATGTGCAAGG - Intergenic
1080900931 11:36490160-36490182 CTTTTTGTCCACACAATGCAAGG - Exonic
1082975965 11:59071996-59072018 CATTTTCTACACAGACTGCAGGG - Intergenic
1083042875 11:59705052-59705074 CATTTTTTTTCCACAGTGAAAGG + Intergenic
1084440686 11:69171074-69171096 TGTTTTTCCCACAAAGTGCAGGG - Intergenic
1086849293 11:91790616-91790638 CTTTTTTCCCAGACAGTGCCTGG - Intergenic
1087853229 11:103057879-103057901 AATTTTTTCCACATACTTCATGG - Intergenic
1088098689 11:106130151-106130173 ATTTTTTTCCACACAGTTCAGGG - Intergenic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1093446890 12:19269996-19270018 CATTTTTTCCTCAGAAAGCAAGG + Intronic
1093560900 12:20538611-20538633 CATTTTTGTCACACAAGGCATGG + Intronic
1093917108 12:24816737-24816759 CAATTTTTCCACAGACTGCAGGG + Intronic
1095205777 12:39439070-39439092 CTTTTTTTCCTCTGAGTGCATGG - Intronic
1095786480 12:46114902-46114924 CATTTCATCCAAGCAGTGCAGGG + Intergenic
1096252425 12:50041541-50041563 CAGTTTTTCTACCCAGTGCAGGG + Intergenic
1098766831 12:74501219-74501241 CATTTTTTTAAAACAGTTCATGG + Intergenic
1101875246 12:108593049-108593071 CACTTTGGCCACCCAGTGCATGG - Intronic
1102338585 12:112103756-112103778 CAATTTTTCCACAGATGGCAGGG + Intronic
1103749253 12:123148411-123148433 CATTTTTTCCAAAAACAGCAAGG + Intronic
1105617990 13:22038169-22038191 GATGCTTTCCACACATTGCAGGG - Intergenic
1106007045 13:25780658-25780680 CAGTTTTTCCACAGAGGGCATGG + Intronic
1107902688 13:45033220-45033242 CATTTTTTCCATGCAGTGATAGG + Intronic
1108465706 13:50713588-50713610 CACTTTTTCCATAGAGTGAAGGG - Intronic
1108611248 13:52085861-52085883 CATTTTTTCAACTCTCTGCAGGG - Intronic
1110301356 13:73931772-73931794 CATTTTCTATAAACAGTGCAGGG - Intronic
1110386193 13:74913713-74913735 CTTTGTTATCACACAGTGCATGG + Intergenic
1110896404 13:80758055-80758077 CATTTTATCCACAGAGAGAATGG + Intergenic
1111034064 13:82647545-82647567 CAATTTTTCCACAGACAGCAGGG + Intergenic
1111162589 13:84414940-84414962 CATATATTCCAGACATTGCATGG - Intergenic
1112547467 13:100385568-100385590 CATTTTTGCCAAAATGTGCATGG - Intronic
1112790718 13:102999798-102999820 AATTGTTTCCACACTGTTCAAGG + Intergenic
1113335678 13:109373737-109373759 CATTTTCTCTCCCCAGTGCAAGG + Intergenic
1113947466 13:114052259-114052281 CATGCGTGCCACACAGTGCAGGG - Intronic
1114429225 14:22646019-22646041 CTTTTGTTTCACATAGTGCAAGG - Intergenic
1115016443 14:28621074-28621096 CATTTTTTCAAAACAGTATATGG + Intergenic
1115060263 14:29179585-29179607 CATTTTTTCCACACATTAGTTGG + Intergenic
1117192378 14:53305665-53305687 CATTTTTTCCAACCAGATCAAGG - Intergenic
1119136398 14:72224883-72224905 CATTTTTCCCACACAAACCATGG - Intronic
1122073966 14:99223920-99223942 CATTTTTTTCAAACAGAGAAAGG + Intronic
1202890639 14_KI270722v1_random:154016-154038 CAATTTTTCCACAGATGGCAGGG - Intergenic
1124720902 15:32110065-32110087 CATTATTACCACACAGGTCAGGG - Intronic
1124783741 15:32659716-32659738 CATCTTGTCCAAACCGTGCAGGG - Intronic
1124842512 15:33256876-33256898 CAATTTTTCCACGGGGTGCAAGG + Intergenic
1125277494 15:38008650-38008672 AATTCATTCCACACAGTGCCAGG + Intergenic
1126646918 15:50883848-50883870 CAATTTTTCCACAGACTGGAAGG - Intergenic
1126801004 15:52296206-52296228 CATTTTCTCCACAAAGGCCAAGG - Intergenic
1127346478 15:58105937-58105959 CATTATTTCCACAAAATGCATGG + Intronic
1130198745 15:81805987-81806009 CATTCACTCCAGACAGTGCAGGG + Intergenic
1130866281 15:87935807-87935829 CATCTCTGCCTCACAGTGCAGGG - Intronic
1131460520 15:92614469-92614491 CATTTTGTACACACAGGGCTGGG - Intergenic
1132229939 15:100174100-100174122 CCTTTTTCCCACAAAGTCCAGGG + Intronic
1132240369 15:100253238-100253260 CATTCTTTGCACACAGTGTTTGG - Intronic
1137736128 16:50725183-50725205 CAGTTTTTTCACCAAGTGCATGG + Intronic
1140057927 16:71542067-71542089 CATTTTTTCCACACACTTAATGG + Intronic
1142920948 17:3185109-3185131 CTTTCTTTCCAAACAGTACAAGG + Intergenic
1148879296 17:50713441-50713463 CATTTTTTCCTCACATGGCATGG + Intergenic
1151871251 17:76838379-76838401 CATCTTTAACTCACAGTGCAGGG + Intergenic
1153325608 18:3816651-3816673 CATTTGATCCACACAGCGGAGGG + Intronic
1153413033 18:4815247-4815269 CATTTTTTCTACACCCTGTAAGG + Intergenic
1154168561 18:12034528-12034550 CATTTGATCCACACAGTCCTGGG - Intergenic
1157473398 18:48006926-48006948 CATTCCTTCCACACAGTCCTTGG - Intergenic
1160691817 19:463815-463837 CCTGTTTCCCACACAGTGAACGG - Exonic
1163571221 19:18083527-18083549 CCTTCTCCCCACACAGTGCAAGG - Intronic
1164077562 19:21834394-21834416 TATTTTTTACAAACAGTGTAAGG + Intronic
1164427824 19:28158140-28158162 CATATTTTTGACACAGTGAATGG - Intergenic
1165002016 19:32772066-32772088 CCTTTATTCCACACTGTCCAGGG + Intronic
1165967129 19:39591773-39591795 GATTTTTTCTACATAATGCAAGG - Intergenic
1168409081 19:56127415-56127437 CCTTTATTCCCCACAGTGGAGGG - Intergenic
1202666061 1_KI270708v1_random:120854-120876 CAATTTTTCCACAGATGGCAGGG - Intergenic
925974098 2:9128898-9128920 CATTTTCCACACACAGTGCTTGG - Intergenic
931812244 2:65865810-65865832 CATGTTTTTCATGCAGTGCAGGG - Intergenic
932025111 2:68124691-68124713 CAGATTATCCTCACAGTGCATGG - Intronic
932094737 2:68837570-68837592 CATTGTTTCAAAACAGTCCAAGG + Intergenic
933006560 2:77002955-77002977 CATTTATGCTACACAGAGCAAGG + Intronic
937448474 2:121978804-121978826 CATTTTCTTCACAAGGTGCAGGG + Intergenic
939714015 2:145560052-145560074 CATATTTTCCACCTAATGCATGG - Intergenic
940879352 2:158930949-158930971 TATGTTTTCCACACAGGGAAAGG - Intergenic
941221639 2:162788151-162788173 AATTATTGCCACACAGTTCATGG - Intronic
943066326 2:183090545-183090567 CATTTTTTCTACAAAGAACATGG - Intronic
943729187 2:191284045-191284067 GATTTTTTCCCCACTGTGGAAGG + Intronic
944068756 2:195646889-195646911 CACTTTTTCCACAGATGGCAGGG - Intronic
947005246 2:225504155-225504177 CATTTATTTCACACAGTTCTGGG + Intronic
947062139 2:226179195-226179217 CATATTTCCCACACATTCCATGG - Intergenic
948253818 2:236551698-236551720 CATTGTTTCCAAACAGTCCAAGG - Intergenic
948929654 2:241123891-241123913 GATATTTGCCACACAGTACAAGG + Intronic
1170127351 20:12979132-12979154 CATGAGTTACACACAGTGCAAGG - Intergenic
1170603520 20:17859505-17859527 CATTTTTTCCTCAGAGTGAGTGG + Intergenic
1170917889 20:20645897-20645919 CACATTTTCCACACAGGACAGGG + Intronic
1173261397 20:41439489-41439511 ACTTTTTTGCACACAGTCCATGG + Intronic
1174302513 20:49592751-49592773 CATTTTGTCCATACAGAGAAGGG - Intergenic
1175634029 20:60565761-60565783 CATCTGTTCCTCACAGTGCAGGG + Intergenic
1175714990 20:61249462-61249484 CCTTTGGTCCACCCAGTGCAGGG - Intergenic
1176012335 20:62905459-62905481 CAGTTTTTCCACATTGTCCACGG - Intronic
1176691317 21:9913976-9913998 CATTTTATGGACACAGTGTAGGG - Intergenic
1178355207 21:31905636-31905658 CATTATTCCCAGCCAGTGCAGGG + Intronic
1179167630 21:38947131-38947153 CATTTCTGCCACACTTTGCAGGG - Intergenic
1179303814 21:40136692-40136714 CTTTTTTTCCCAAGAGTGCAGGG + Intronic
1182798289 22:33007605-33007627 CTTTGCTTTCACACAGTGCAGGG - Intronic
949276525 3:2289558-2289580 CATTTATTGAACACAGTTCAGGG + Intronic
949933538 3:9099213-9099235 CCTTGTTGCCACACAGTGAATGG + Intronic
950709414 3:14804120-14804142 CATCTGGACCACACAGTGCAAGG - Intergenic
951815753 3:26752450-26752472 CATTTTTGCCAAACAGTGGGAGG - Intergenic
952407222 3:33015427-33015449 TATTTGTTCCACACAGGCCAGGG + Intronic
953512905 3:43561148-43561170 CATTTGTTGAACTCAGTGCATGG + Intronic
953686517 3:45082319-45082341 CATCTGCTTCACACAGTGCACGG + Exonic
954857462 3:53658385-53658407 CTGTGTTCCCACACAGTGCAGGG - Intronic
954946456 3:54429177-54429199 CATTTTTTTCCCCCAGAGCATGG + Intronic
955965253 3:64382556-64382578 CTTTTTTTCCACACTCTGTAGGG - Intronic
956501287 3:69888289-69888311 CATTTTTTCTGAACACTGCATGG + Intronic
956639132 3:71398322-71398344 CATTTTTTTAAAACAGTGCTGGG + Intronic
956656203 3:71554526-71554548 GATTTTTTCCATCCAGTACACGG - Intronic
956669737 3:71675551-71675573 CATTTTTTCCACATAATATATGG + Exonic
957089836 3:75718608-75718630 CAATTTTTCCACAGATGGCAGGG + Intronic
958411496 3:93822253-93822275 CAATTTTTCCACAGATTGCTTGG + Intergenic
963691993 3:148516421-148516443 CTTTTTTTCCTCTCAGTCCACGG + Intergenic
963926983 3:150961133-150961155 CATTTCTTCCACACAGTTGGGGG - Intronic
964471296 3:157059282-157059304 CATTGTTTTCACACAGTTGATGG - Intergenic
964827199 3:160841607-160841629 CTTTTCTTCCACAGACTGCAGGG + Intronic
964954590 3:162336845-162336867 CATAGCTTCCACACAGTGGAAGG + Intergenic
965361305 3:167742235-167742257 AAATTTTTCCTCACATTGCATGG + Intronic
969426945 4:7130033-7130055 CTCTGTTTCCACACGGTGCAAGG + Intergenic
970032990 4:11698838-11698860 CATATTTAACACACAATGCATGG - Intergenic
970932089 4:21524016-21524038 CATTTTTTCCATCCTGTGAAGGG + Intronic
970934128 4:21548876-21548898 TATTTTTTCCATACAGAGCAGGG + Intronic
971121760 4:23712348-23712370 CAATTTTTCCACAGATTGGAGGG - Intergenic
971389440 4:26172274-26172296 AATTTTTTTCACACAGCCCACGG - Intronic
971999602 4:34014027-34014049 TATTTTTTTCCCACAGTGTATGG - Intergenic
972440194 4:39081001-39081023 TATTTGTTACTCACAGTGCATGG - Intronic
972663440 4:41141036-41141058 CAGTTTTTCCAAACAGTGAGTGG - Intronic
973270614 4:48258947-48258969 CATTCATTCCACAAAGTCCAAGG + Intronic
976515751 4:85964280-85964302 CATTTTTTTTTCACAGTGGATGG - Intronic
976942409 4:90719468-90719490 CAATTTTTCCACAAAGTGGGAGG - Intronic
977485921 4:97646226-97646248 TTTTATTTGCACACAGTGCAAGG + Intronic
978012026 4:103699270-103699292 AATATTTTCTACAGAGTGCAAGG + Intronic
978452634 4:108852190-108852212 CATTTATCACATACAGTGCAGGG - Intronic
979306567 4:119151495-119151517 CATTTATTCCACATTGTGTAGGG + Intronic
980363905 4:131774163-131774185 CATTTTATGGACACAGTGTAGGG - Intergenic
982648909 4:158061969-158061991 CATGTTCTTCACACAGTTCAGGG - Intergenic
982858223 4:160412721-160412743 CAATTTTTCCACAGACTGCGTGG - Intergenic
983131126 4:164021346-164021368 CATTTTATCCACAGAGTTGATGG - Intronic
983228355 4:165106188-165106210 CATTCTATCCACTCAGTGCTGGG + Intronic
985488322 5:164209-164231 CAATTTTTCCACAGACCGCAGGG + Intronic
986364691 5:7018826-7018848 CTTTTTCTCCACAAGGTGCATGG + Intergenic
986518856 5:8592402-8592424 CCTTGTTTTCACGCAGTGCAGGG + Intergenic
986653374 5:9987212-9987234 CTTTTTTTCCACACCTTACAGGG + Intergenic
986957759 5:13175571-13175593 CAGTTCTTACACACAGTCCAGGG - Intergenic
988667408 5:33344414-33344436 AATTTTTTCCTCACAGTCAAAGG - Intergenic
989255361 5:39360673-39360695 CATTTTTTTCATACATTGAAAGG - Intronic
989463732 5:41730277-41730299 CATTTTTTCCCCCCAGTACTGGG + Exonic
989494830 5:42100453-42100475 TTTTTTTTGCACACAGTGAAAGG + Intergenic
989627459 5:43444029-43444051 CAATTTTTCCACAGATGGCAGGG - Intergenic
989994772 5:50816328-50816350 CTGTTTTTGCACACAGTGTAAGG - Intronic
991365563 5:65864546-65864568 CAGTTTTTCCACAGAGGTCAGGG + Intronic
991902039 5:71470455-71470477 AACTTTTTCCTCACAGAGCAAGG + Exonic
993267779 5:85749708-85749730 CATTTTTTCCACCAAGAGCATGG - Intergenic
997634459 5:135394708-135394730 CATTCTTAGCACTCAGTGCATGG + Intronic
998813133 5:145986350-145986372 CATTTTTTTCTCACTCTGCATGG + Intronic
998840260 5:146245858-146245880 CAATTTTTCCACAAATGGCAGGG - Intronic
999941199 5:156545247-156545269 CTTTTTTTCAATACAGTGAAAGG + Intronic
1001107362 5:168866280-168866302 CTTTTTCTCCAAACAGTGGAGGG - Intronic
1004992443 6:21153894-21153916 GACTTTTTTCACACAGGGCAAGG + Intronic
1005588937 6:27304850-27304872 TACTTTTTCCAAACAGTGCTAGG - Intronic
1006254035 6:32815043-32815065 CCTTTTCTCCCCACAGTGAAGGG + Exonic
1007103780 6:39269314-39269336 CCTGTTTCCTACACAGTGCAGGG - Intergenic
1007109711 6:39305952-39305974 AATCTTTCTCACACAGTGCAAGG - Intronic
1008388913 6:50926205-50926227 CATTCTTACCACACAGTCCAGGG + Intergenic
1010805718 6:80233935-80233957 CAATTTTTCCACAGACTGGAGGG + Intronic
1011885284 6:92086305-92086327 CATATGTTCCTCACAGTGCCTGG - Intergenic
1012393356 6:98768381-98768403 CATTTATTCCACACAAGGGAAGG + Intergenic
1013179271 6:107704688-107704710 CAAGTTTTCCAGACAGTGCAAGG + Intronic
1013938234 6:115626495-115626517 CATTTTTTATACACAATGCCAGG - Intergenic
1014665079 6:124227911-124227933 CATTTATTTCACACAGTTCTGGG + Intronic
1014775846 6:125508945-125508967 CATCTTTTCAACTCAGTTCATGG - Intergenic
1015364683 6:132384648-132384670 TACTTTCTCCACACATTGCATGG - Intronic
1015799865 6:137049361-137049383 CATTTGCTCCTCACATTGCAAGG - Intergenic
1016590514 6:145738527-145738549 TATTTTATCCACATAGTTCAGGG + Intergenic
1016864356 6:148750467-148750489 CATTTTTTCCATACAGAAAATGG - Intronic
1018514149 6:164560850-164560872 CATTTATGCCACACAGAGGATGG + Intergenic
1021038401 7:15829921-15829943 CATCTTTTCGACACAGAACATGG - Intergenic
1021752572 7:23818225-23818247 CATTTTTTTCACATAATACATGG - Intronic
1021865077 7:24947904-24947926 CATCTTTGGCACACAGTGAATGG - Intronic
1023029796 7:36081936-36081958 CATTCTTACAACACAGGGCAGGG + Intronic
1023118869 7:36889395-36889417 TTTCTTTTCCACTCAGTGCAGGG - Intronic
1023729109 7:43173495-43173517 CAATTTTTCCACAGAGTCCAGGG + Intronic
1023887401 7:44368831-44368853 CATTTTTTCCCCACAGTGGGGGG - Intergenic
1025622052 7:63182319-63182341 TATTTTTTACACACAGATCAGGG + Intergenic
1026278958 7:68904791-68904813 CATTTTATTCACTCAGGGCAAGG - Intergenic
1028137066 7:87232973-87232995 CATTTATTCCTCACAGTTCTGGG - Intergenic
1028981497 7:96972149-96972171 CATTCATTACACACAGTACATGG + Intergenic
1030139916 7:106293749-106293771 CAATTTTTCCACAGTGGGCAGGG - Intergenic
1030530311 7:110704223-110704245 CGATTTTTCCCCACTGTGCATGG - Intronic
1030547030 7:110908857-110908879 CATTTTTGCATCCCAGTGCATGG - Intronic
1031385385 7:121143696-121143718 CATTTTTTTCATACATTGCTGGG + Intronic
1032662928 7:134005629-134005651 CATTTTTTCCAAATTGTGAAGGG - Intronic
1033925392 7:146452978-146453000 CATTCTTTCCACACAGTAGCTGG - Intronic
1034842006 7:154407087-154407109 AATTTTCTCCACACACTCCAGGG + Intronic
1036023929 8:4881774-4881796 CATTTTATTCACAAACTGCATGG + Intronic
1036464716 8:8985922-8985944 CATTTGTACCTCACATTGCAGGG - Intergenic
1038059779 8:23900129-23900151 CTTTTTTTCCCCACACTGCATGG + Intergenic
1038866939 8:31449315-31449337 CAATTTTTCCACACACTGGTGGG + Intergenic
1039913119 8:41840492-41840514 CCTTTATTCCTCACAGTTCAGGG + Intronic
1040486919 8:47882268-47882290 TAGTTTTTCCACAAAGTACAGGG + Intronic
1041024281 8:53667937-53667959 CATTCTTTCCAAACAGTTCATGG + Intergenic
1041515011 8:58690757-58690779 CATTCTGTCCACAGAGTGTATGG + Intergenic
1043058546 8:75471140-75471162 ATTATTTTTCACACAGTGCAAGG + Intronic
1043095483 8:75965038-75965060 CATTTTTTCCAGGCAGTCCAGGG - Intergenic
1044770612 8:95627418-95627440 CATTTTTCCCCCTCACTGCAGGG - Intergenic
1046238151 8:111454349-111454371 CAGTTTTTCCACAGAAGGCAAGG - Intergenic
1046380061 8:113438243-113438265 CATTATTTGTGCACAGTGCAGGG - Intergenic
1046424385 8:114027540-114027562 CATTTTCCCCTCACAGTGGATGG - Intergenic
1047175193 8:122534189-122534211 CAATTTTTCCACAGATTGCGGGG - Intergenic
1048366873 8:133745930-133745952 CATTTATTCAACACAGTGAGGGG + Intergenic
1048755603 8:137734222-137734244 CATTTATTTCTCACAGTGCTGGG - Intergenic
1050205236 9:3189222-3189244 CTGTGTTTCCACACAGTGGAAGG - Intergenic
1050762519 9:9089870-9089892 CATTTTTCAAACACAGTGAAAGG - Intronic
1050898342 9:10911723-10911745 CAAAGTTTCCACACAGTGGAAGG - Intergenic
1053628249 9:39900047-39900069 CATTTTATGGACACAGTGTAGGG - Intergenic
1054215638 9:62350654-62350676 CATTTTATGGACACAGTGTAGGG + Intergenic
1054364243 9:64316143-64316165 CATTTTATGGACACAGTGTAGGG - Intergenic
1054671843 9:67804696-67804718 CATTTTATGGACACAGTGTAGGG - Intergenic
1054799700 9:69335141-69335163 CATTTATTCCACAAAGTGGGAGG - Intronic
1055153942 9:73038149-73038171 CAGTTTTTCTACATAATGCAAGG - Intronic
1055674421 9:78640873-78640895 CACTTTGTCAACACTGTGCAGGG - Intergenic
1056566584 9:87777948-87777970 CATTTTTTCCACAGACTGGGGGG + Intergenic
1057817086 9:98303746-98303768 TATTTTTTCCACAAGGAGCAAGG - Intronic
1058541445 9:106016447-106016469 CCTATTTTCTACTCAGTGCATGG + Intergenic
1059743434 9:117177898-117177920 CATTTGTTCCACACTCTACAAGG + Intronic
1060092805 9:120759126-120759148 CATTTTATCCAACCAATGCAGGG - Exonic
1203487736 Un_GL000224v1:73121-73143 CAATTTTTCCACAGATGGCAGGG - Intergenic
1203500357 Un_KI270741v1:15016-15038 CAATTTTTCCACAGATGGCAGGG - Intergenic
1186208707 X:7227685-7227707 CATTTTTTAAACATATTGCATGG - Intronic
1188271211 X:28143472-28143494 TATTTCCTTCACACAGTGCAAGG + Intergenic
1188650319 X:32624135-32624157 CATTTTTTCCTATCTGTGCATGG - Intronic
1190437610 X:50441526-50441548 CTTTTTTTCCATACAGTAAAAGG - Intronic
1191450851 X:60936695-60936717 CACTTTTTCTACAATGTGCAAGG + Intergenic
1191476572 X:61281414-61281436 CACTTTTTCTACAATGTGCAAGG + Intergenic
1191476883 X:61285530-61285552 CACTTTTTCTACAATGTGCAAGG + Intergenic
1191486654 X:61416353-61416375 CACTTTTTCTACAATGTGCAAGG + Intergenic
1191486797 X:61418239-61418261 CACTTTTTCTACAATGTGCAAGG + Intergenic
1191544150 X:62185145-62185167 CACTTTTTCTACAATGTGCAAGG + Intergenic
1191549972 X:62263139-62263161 CACTTTTTCTACAATGTGCAAGG + Intergenic
1192680191 X:73244933-73244955 CATTTTTTTTACACAGCACATGG + Intergenic
1194892306 X:99395251-99395273 CATTTTTTCTTCTCAGTACAAGG - Intergenic
1195064328 X:101226407-101226429 CATATTTTTAACACAGTGCTAGG - Intronic
1196989299 X:121310468-121310490 GAACTTTTCCACACATTGCATGG + Intergenic
1197865462 X:131012034-131012056 CATTCGTTCAACACCGTGCAGGG - Intergenic
1198831489 X:140755540-140755562 CCTATTTTCCACACTTTGCACGG + Intergenic
1199347177 X:146755299-146755321 TATTTTTTCTGTACAGTGCAAGG - Intergenic
1201502331 Y:14658854-14658876 CATTTATTTCACACAGTCCTAGG + Intronic