ID: 921580869

View in Genome Browser
Species Human (GRCh38)
Location 1:216894724-216894746
Sequence GAGAACACGGTCAAGTGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921580864_921580869 -1 Left 921580864 1:216894702-216894724 CCAAACCAGCACATGTTCACCAG 0: 1
1: 0
2: 1
3: 6
4: 141
Right 921580869 1:216894724-216894746 GAGAACACGGTCAAGTGGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 51
921580865_921580869 -6 Left 921580865 1:216894707-216894729 CCAGCACATGTTCACCAGAGAAC 0: 1
1: 0
2: 1
3: 13
4: 283
Right 921580869 1:216894724-216894746 GAGAACACGGTCAAGTGGTCAGG 0: 1
1: 0
2: 0
3: 1
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921580869 Original CRISPR GAGAACACGGTCAAGTGGTC AGG Intronic
915785244 1:158604225-158604247 GATAACACAGTCAATTGGTGAGG - Intergenic
916694689 1:167222171-167222193 GAGAATACGATCAACTTGTCAGG - Intronic
920950619 1:210568826-210568848 GAGAACAGGGTCTGGAGGTCAGG - Intronic
921580869 1:216894724-216894746 GAGAACACGGTCAAGTGGTCAGG + Intronic
923622454 1:235589617-235589639 GAGGACAAGGTCACGTTGTCAGG - Intronic
1077895966 11:6453813-6453835 GAGAAAACGGTCATGTCGTGAGG + Intronic
1096031089 12:48415759-48415781 TAGAAAATGGTCAAATGGTCAGG - Intergenic
1096797848 12:54089794-54089816 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1118029597 14:61807532-61807554 GAGGACAGGCTCAGGTGGTCTGG - Intergenic
1118768434 14:68925682-68925704 GACAAGAAGGGCAAGTGGTCAGG + Intronic
1126693639 15:51307791-51307813 AAGAACAATGTCAAGTGGTTGGG - Intronic
1129118775 15:73382190-73382212 GAGCACACAGTGCAGTGGTCAGG - Intergenic
1132067788 15:98746638-98746660 GAGAACAAGTTCATGTTGTCTGG - Intronic
1132549631 16:548965-548987 GAGACCACGGCCATGTGCTCAGG - Intronic
1139429427 16:66903314-66903336 GATGACAGGGTCCAGTGGTCAGG - Intergenic
1141777695 16:86135221-86135243 GAGCACACGGTCCAGGGATCTGG - Intergenic
1145837560 17:27966064-27966086 GTGAACATGGACAAGTGGACAGG - Intergenic
1159282539 18:66305281-66305303 GAGAACATGGCAAAGTGTTCTGG - Intergenic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1166231572 19:41427995-41428017 GAGAAGACGGGCAAGTGGGAAGG + Intronic
925038110 2:707319-707341 TAGAACACGGCCAAGTGATCAGG - Intergenic
936105761 2:109623279-109623301 GAGGACACTGACAAGTGGCCGGG - Intergenic
939683425 2:145167956-145167978 GAGGACAGGGTGAAGTTGTCCGG - Intergenic
944720026 2:202414648-202414670 GAGAAAAAGTTTAAGTGGTCTGG + Intronic
1170047009 20:12096195-12096217 GAGAACACTGCAAAGTTGTCTGG - Intergenic
1171849689 20:30299622-30299644 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1179876063 21:44268135-44268157 GTGAACACGGTCAGATAGTCAGG + Intergenic
966144905 3:176799945-176799967 GAGAACACATTCAACTGGTTAGG - Intergenic
966554250 3:181241376-181241398 GAGAACATAGTTTAGTGGTCAGG + Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967544321 3:190706470-190706492 GAGAACATGCTCATGGGGTCAGG + Intergenic
977225754 4:94389725-94389747 GAGAAAAAGTTCGAGTGGTCTGG - Intergenic
977285069 4:95094148-95094170 GAGGACACCGTCAAGTACTCTGG + Intronic
978426905 4:108592809-108592831 GATGTCACTGTCAAGTGGTCTGG - Intergenic
980137518 4:128873029-128873051 AAGAAGAAGGTCAAGTGGACTGG - Exonic
986432232 5:7692682-7692704 GAGGACAAGGCCAAGGGGTCAGG - Intronic
990452616 5:55950239-55950261 GAAAACAGGGTCAAGAGGCCGGG + Intronic
996794226 5:127326681-127326703 GATAACACGATGGAGTGGTCAGG + Intronic
997780832 5:136656535-136656557 GAGCACACATTCAAGTGTTCAGG - Intergenic
1017229081 6:152052798-152052820 GACAGCACGGGCAAGTGTTCTGG + Intronic
1017817032 6:158023310-158023332 GAGAACACAGTCAGGCAGTCAGG + Intronic
1019107408 6:169679612-169679634 GAAAACAGGAACAAGTGGTCAGG - Intronic
1035179917 7:157081878-157081900 GAGTCCACAGTCAAGTCGTCTGG - Intergenic
1035735193 8:1882539-1882561 AAGAATACTGTCAAGTAGTCTGG - Intronic
1041180303 8:55240515-55240537 GAGAACATGATCAAGTGGAATGG + Intronic
1053787464 9:41662914-41662936 GAGAACATGGTCAAGGAGTTGGG + Intergenic
1054157662 9:61651853-61651875 GAGAACATGGTCAAGGAGTTGGG - Intergenic
1054477436 9:65582858-65582880 GAGAACATGGTCAAGGAGTTGGG - Intergenic
1061448663 9:130656610-130656632 GAGAGCCCGTTCAAGTGGGCAGG - Intergenic
1189516011 X:41714101-41714123 GAGAAAATGGTAAAATGGTCTGG + Intronic
1196645802 X:118116649-118116671 CAGGACAGGGTGAAGTGGTCGGG - Intronic
1200267279 X:154653164-154653186 GACAACAGGGTCAAGAGGTGGGG - Intronic
1201222833 Y:11788649-11788671 AAGTCCAAGGTCAAGTGGTCTGG - Intergenic