ID: 921581759

View in Genome Browser
Species Human (GRCh38)
Location 1:216903778-216903800
Sequence CCAGAGCTGCAGAGGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921581759_921581765 9 Left 921581759 1:216903778-216903800 CCAACCACCCTCTGCAGCTCTGG 0: 1
1: 0
2: 2
3: 44
4: 432
Right 921581765 1:216903810-216903832 ACCAGGTATAGATCATTATTTGG 0: 1
1: 0
2: 0
3: 4
4: 88
921581759_921581767 25 Left 921581759 1:216903778-216903800 CCAACCACCCTCTGCAGCTCTGG 0: 1
1: 0
2: 2
3: 44
4: 432
Right 921581767 1:216903826-216903848 TATTTGGTTAAAAAGACAAGAGG 0: 1
1: 0
2: 2
3: 25
4: 396
921581759_921581764 -8 Left 921581759 1:216903778-216903800 CCAACCACCCTCTGCAGCTCTGG 0: 1
1: 0
2: 2
3: 44
4: 432
Right 921581764 1:216903793-216903815 AGCTCTGGCAGCATGCTACCAGG 0: 1
1: 0
2: 0
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921581759 Original CRISPR CCAGAGCTGCAGAGGGTGGT TGG (reversed) Intronic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900287431 1:1908441-1908463 CCATCACTGCAGAGGGTGGCAGG + Intergenic
900491691 1:2952466-2952488 CCTGTGCTGCTGAGGGTGCTGGG + Intergenic
900902044 1:5523798-5523820 CCAGAGATTCAGGGGGTGGCTGG - Intergenic
902241635 1:15094087-15094109 CCCGGGAGGCAGAGGGTGGTGGG - Intronic
902251463 1:15156342-15156364 CCAGGCCTGCAGAGGGAGGGAGG - Intronic
902405605 1:16181865-16181887 GGAGAGCTCCAGAGGTTGGTAGG - Intergenic
902782678 1:18714827-18714849 CCAGAGCTGCATGGCTTGGTGGG + Intronic
903046166 1:20565852-20565874 TCAGGGCTGCAGAGGTGGGTGGG + Intergenic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
904044312 1:27600976-27600998 CCACAGCGCCTGAGGGTGGTAGG + Intronic
904677649 1:32208155-32208177 CCAGAGCTGGTCAGGGAGGTAGG - Exonic
905002038 1:34680117-34680139 CTAGGGCTGCACAGGGTGGAGGG + Intergenic
905148647 1:35908453-35908475 CCAAAGCTGCAGAGGGTTCAAGG - Intronic
905904759 1:41610616-41610638 CCAGAGCTGAAGAAGGCTGTGGG - Intronic
906098358 1:43239436-43239458 ACAGGGCTGTAGAGGGTGGAGGG + Intronic
907411328 1:54285787-54285809 CCAGGGCTGCAGTGGGTGCATGG + Intronic
907823358 1:57991892-57991914 CTAGAGCTGCTGATGGTGGAAGG + Intronic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908331909 1:63079313-63079335 TCAGAGCTTCAGAAGGGGGTTGG - Intergenic
910028619 1:82688927-82688949 ACAGAGCTGCAGTGGGTGCATGG - Intergenic
910432687 1:87174673-87174695 ACAGAGCTGCGGAGGGTGGGTGG + Intergenic
912570718 1:110619107-110619129 AGGCAGCTGCAGAGGGTGGTTGG - Intronic
913175488 1:116269118-116269140 CCAGAGCCGCACAGTGTGGTAGG + Intergenic
915569778 1:156738261-156738283 TCAGAGCAGCACAGGGTGGCAGG - Intronic
915916004 1:159941429-159941451 CAAGAGCTCCAGACGGAGGTAGG + Intronic
917802993 1:178587238-178587260 CCAGAGCTGCAGAGAGAGGGGGG - Intergenic
918316059 1:183323606-183323628 CCAGAGTTGCAGAGGGTAGTGGG - Intronic
919856544 1:201709974-201709996 CCACATCAGCAGAGTGTGGTGGG - Intronic
919989622 1:202700210-202700232 CCAGAGCTGCACGGGGTGGAGGG - Intronic
920174006 1:204088947-204088969 CCAGTGGTCCAGAGGGTGGGAGG + Intronic
920502714 1:206495511-206495533 CCAGAGTTTCAGAGGGTCCTTGG + Intronic
920650163 1:207831683-207831705 CCAGAGAGACAGAGTGTGGTTGG + Intergenic
920683482 1:208090947-208090969 ACAGAGCTGCAGGGAGAGGTGGG - Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
921978428 1:221228021-221228043 CCAGAGCTGCAAAGTGTACTCGG - Intergenic
922120867 1:222666219-222666241 CCAGAACTGAAGATGGTGGCTGG + Exonic
922726794 1:227926519-227926541 ACAGAGCTGCAGAGCATGCTCGG - Intronic
923738711 1:236635922-236635944 CTAGAACTGCGAAGGGTGGTGGG + Intergenic
924939742 1:248804735-248804757 CCTGGGCTGCAGAGGCAGGTGGG + Intergenic
1063161727 10:3423464-3423486 GCAGAGCTGCAGAGGGGAGGCGG + Intergenic
1063442161 10:6081543-6081565 CATGAGCTGCAGAGAGTGGGAGG + Intergenic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1064346779 10:14540043-14540065 CCAGAGCTGCAGAGTGGAGCAGG - Intronic
1065355295 10:24834777-24834799 CCAGCCCTGATGAGGGTGGTAGG - Intergenic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1067074613 10:43169097-43169119 CTGGAGCTGGAGAGGCTGGTCGG + Intronic
1067479724 10:46587052-46587074 CCAGAGTGGCAGTGGGTGCTGGG - Intronic
1067615013 10:47754745-47754767 CCAGAGTGGCAGTGGGTGCTGGG + Intergenic
1067795566 10:49318954-49318976 CCAGAGCTCCAGGGGATGGATGG - Intronic
1068773443 10:60847259-60847281 GGGGAACTGCAGAGGGTGGTTGG + Intergenic
1069535937 10:69253208-69253230 CCAGAGCTCCAGTGGGTCATGGG + Intronic
1069651270 10:70051681-70051703 GTAGAGACGCAGAGGGTGGTAGG + Intergenic
1069670404 10:70197476-70197498 CAAGAGCTACAGAGGCAGGTAGG + Intergenic
1069680853 10:70284095-70284117 CCAGGGCTGCAGTGGGAGGAGGG - Intergenic
1069716497 10:70524370-70524392 CCAGAGCTGCAGAGAAGGGAGGG - Intronic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1070312124 10:75281556-75281578 CCCCAGCTGCAGATGGAGGTGGG + Intergenic
1070805586 10:79268900-79268922 GCAGGGCTGCAGAAGGTGATTGG + Intronic
1071202007 10:83229686-83229708 GCAGAGCTGGAGAGGCTGCTAGG + Intergenic
1071630417 10:87214709-87214731 CCAGAGTGGCAGTGGGTGCTGGG + Intergenic
1072234216 10:93439141-93439163 CCAGAGTTGCAGAGGTGGGAGGG - Intronic
1073063178 10:100744215-100744237 CCGGAGCTGCAGACGGGGGCTGG + Intronic
1073136601 10:101223858-101223880 CCAGAGCTGCGGCGGGGGGAAGG - Intergenic
1073217391 10:101843908-101843930 CCCGGGCTGCAAAGGGTGGGGGG - Intronic
1073854273 10:107656729-107656751 GCTGAACTGAAGAGGGTGGTTGG - Intergenic
1074088789 10:110227528-110227550 CCGGAGCGGGAGAGGGTGCTGGG + Intronic
1075480526 10:122777743-122777765 CCGGAGCTGCAGCTGGTGGGTGG + Intergenic
1075564929 10:123496316-123496338 CCAGATCTGCACAGAGTGGTGGG - Intergenic
1075737924 10:124675406-124675428 CCAGAGCAGCAGAGGGTGTGGGG + Intronic
1075825714 10:125355820-125355842 CCAGAGCTGCAGACTGAGGCAGG + Intergenic
1076581803 10:131517018-131517040 TCGGGGCTGAAGAGGGTGGTGGG - Intergenic
1076887334 10:133268734-133268756 CCTGAGCAGGTGAGGGTGGTGGG - Exonic
1077059906 11:613526-613548 ACGGTGCTGCAGAAGGTGGTGGG - Exonic
1077214231 11:1388728-1388750 CCCGTGCTGCAGAAGGTGGTGGG - Intergenic
1077383926 11:2260204-2260226 CCAAAGATGCAGAGGGATGTCGG + Intergenic
1078667671 11:13339900-13339922 GCAGTGCTGCAGATGGGGGTAGG - Intronic
1078897713 11:15612246-15612268 CTAGAGCTGTTGAGTGTGGTAGG + Intergenic
1080889667 11:36398455-36398477 CCAGAGCAGCACAGGGAGGAAGG - Intronic
1081737216 11:45412371-45412393 AGACAGCTCCAGAGGGTGGTGGG - Intergenic
1081862060 11:46338978-46339000 CCCGAGCCACAGATGGTGGTGGG + Intronic
1082255257 11:50027136-50027158 CTAGAGCTGGAGAGGCTGGGAGG - Intergenic
1082774559 11:57235451-57235473 CGGCAGCTGCAGAGAGTGGTGGG + Exonic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1084009366 11:66339048-66339070 CCAGTGCTGCAGAGTGAGATGGG - Intronic
1084369693 11:68732502-68732524 ACAGAGCTGTGCAGGGTGGTGGG - Intronic
1084682163 11:70672789-70672811 CCAAGGCTGCAGAGTGTGGTGGG - Intronic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085376983 11:76072889-76072911 CCAGACCTACTGAGGGTGTTGGG - Intronic
1086573004 11:88306523-88306545 ACAGAGCTGTGGAGAGTGGTGGG + Intronic
1086685426 11:89728504-89728526 CCAGAGCTGAGGAGGGAGCTGGG - Intergenic
1088753319 11:112864487-112864509 ACAGAGCTGCACTGGGTGTTAGG + Intergenic
1089363731 11:117908550-117908572 CGAGGGCTGCAGAGGGTGCTGGG + Intronic
1089363844 11:117909153-117909175 ACAGGGCTGCAGAAGGTGCTGGG + Intronic
1089574427 11:119431484-119431506 CCAGAGCTGAGGAGCGAGGTCGG + Intergenic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1091047876 11:132341121-132341143 TCAAAGCTGAAGAGGGTGGTTGG - Intergenic
1091969129 12:4771370-4771392 CCAGAGGAGGAAAGGGTGGTTGG + Intronic
1092180534 12:6443700-6443722 GAAGAGCTGCAGAGGGGGCTGGG + Intergenic
1093111197 12:15154291-15154313 CCAGAACTGAACCGGGTGGTTGG - Intronic
1094142745 12:27198037-27198059 CCAGGATTGCAGAGGGTGGGAGG - Intergenic
1095476428 12:42590731-42590753 CCGGAACTGGAGAGGGTGGGGGG - Intergenic
1095560490 12:43559200-43559222 ACAGAGCTTCAGAGAGTTGTGGG - Intergenic
1096231432 12:49898912-49898934 CCAGGGCTTCAGGGGGTGGGGGG + Intronic
1096478033 12:51920665-51920687 AGAGAGATGCAGAGGGAGGTGGG - Intronic
1096665374 12:53160712-53160734 GCAGAGCTCCAGAGAGAGGTGGG + Intronic
1096885675 12:54716826-54716848 CCAGTGCTGGAGAGGGGGGCTGG - Intergenic
1097277571 12:57823785-57823807 CCAGAGCCCTAGAGGGTGGCTGG + Intronic
1099386413 12:82018699-82018721 CCAAAGCTGCACAGGGCAGTGGG - Intergenic
1100725830 12:97407587-97407609 CAGGAGCTGCAGAGTGAGGTTGG - Intergenic
1101248459 12:102908200-102908222 TCGGGGCTGCAGGGGGTGGTAGG - Intronic
1101874956 12:108591802-108591824 CCAGGGCTGCACTGGGCGGTGGG - Exonic
1101991503 12:109489391-109489413 TGAGAGCTGCAGAGGGAGCTAGG + Intronic
1102495589 12:113316809-113316831 CCTGAGCTGCAGTGAGAGGTGGG + Intronic
1102558809 12:113747641-113747663 CCAGAGGTGCAGGGGGTGAGGGG - Intergenic
1103415101 12:120738171-120738193 CCTGAGCTTCTGAGGGAGGTGGG + Intronic
1103516079 12:121509352-121509374 TAAGAGCTGCAGAGGGTGGGTGG - Intronic
1103705009 12:122866689-122866711 CCAGGGCTGCAGTGGCCGGTGGG + Exonic
1104896747 12:132168530-132168552 CCAGGGCTGCTGAGCGTGGGTGG + Intergenic
1104934962 12:132359677-132359699 CCAAAGCTGCAGAGGCCGCTAGG - Intergenic
1105061089 12:133151701-133151723 CCAGTCCTGCAGAGGGTTGGTGG + Intronic
1105295648 13:19086253-19086275 CCAGGGCTGCAGAGGTGGCTGGG - Intergenic
1106645169 13:31626123-31626145 CCAGCCCTGCAGAGGAGGGTGGG + Intergenic
1107857261 13:44628515-44628537 CCAGAACTCCAGAGGGTCTTAGG + Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108167662 13:47709955-47709977 CCACAGAGGCAGAGGGTGGGTGG - Intergenic
1109717369 13:66234246-66234268 CCAGAGCTGCATAGAGCAGTGGG - Intergenic
1111664098 13:91245498-91245520 CAAGAGCAGCAGAGTGTGGTTGG - Intergenic
1112196965 13:97235754-97235776 CCAGAGCTGCAGACGCTAGAGGG + Intronic
1113872266 13:113566498-113566520 ACAGGGCTGCAGAGTGGGGTGGG - Intergenic
1113892711 13:113744635-113744657 CCAGGCCTGCAGGGGGTGGTGGG - Intergenic
1114259073 14:21024850-21024872 CAAGAGCTGCAGGGCGTGTTTGG - Exonic
1114390262 14:22300457-22300479 GCAGAGGGTCAGAGGGTGGTTGG - Intergenic
1115518337 14:34207745-34207767 CCAGTGCTTAAGATGGTGGTTGG + Intronic
1115755453 14:36523166-36523188 CCAGCGAAGCAGAGCGTGGTCGG - Intergenic
1116957888 14:50943423-50943445 CCAGAGCTGCTGAGGAAGGCTGG - Intronic
1117474397 14:56079124-56079146 CCAGGACTGCAGAGCTTGGTGGG - Intergenic
1117562698 14:56958579-56958601 CCCTAGCTGCAGAGGGCTGTGGG - Intergenic
1118260592 14:64243182-64243204 CCAGAATTCCAGATGGTGGTGGG + Intronic
1118736454 14:68704814-68704836 CCTGAGATGCAGTGGCTGGTTGG - Intronic
1118850541 14:69579851-69579873 ACTGAGCTGAAGTGGGTGGTGGG - Intergenic
1122363917 14:101183267-101183289 CCAGAGATGCAGAGGAGGGAGGG - Intergenic
1122387389 14:101358406-101358428 CCAGAGGTGAGAAGGGTGGTAGG - Intergenic
1122848529 14:104513863-104513885 CCAGAGAAGCAGGGGCTGGTGGG + Intronic
1122865688 14:104603044-104603066 GGACAGCGGCAGAGGGTGGTGGG + Intronic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1124965377 15:34429340-34429362 TCAGAGCTGGAGATGGGGGTTGG - Intronic
1124981995 15:34575542-34575564 TCAGAGCTGGAGATGGGGGTTGG - Intronic
1125536071 15:40441633-40441655 CCCGAGCTGCGGAGGGCGGGAGG + Intronic
1125979112 15:43983778-43983800 CCAGAGGTGGAGACGGTGGATGG - Intronic
1126066605 15:44830619-44830641 CCAGGGCTGGAGAGGGTAGCAGG - Intergenic
1126093277 15:45070250-45070272 CCAGGGCTGGAGAGGGTAGCAGG + Intronic
1127700508 15:61495572-61495594 CCAGAACTGCACTGGGTGGTGGG - Intergenic
1127872971 15:63088628-63088650 ACAGAGCTGTGGAGGGTGGGGGG - Intergenic
1128111933 15:65081956-65081978 CCATCCCTGCTGAGGGTGGTGGG - Intergenic
1128345974 15:66852634-66852656 CCAGAGCTGCTGGGGGAGGCTGG - Intergenic
1129140333 15:73592173-73592195 CCAGGGCTACAGAGGATGGAAGG - Intronic
1129233394 15:74209133-74209155 CCTGAGCTGGAGATGGGGGTGGG - Intronic
1129610392 15:77050062-77050084 TTAGAGCTGGAGAGGATGGTTGG - Intronic
1129890165 15:79066588-79066610 TCAGAGCTGCATGGGGTGATGGG + Intronic
1130371593 15:83289048-83289070 CCAGATCTCAAGGGGGTGGTGGG + Intergenic
1131268787 15:90934322-90934344 CCAGAGCTGAAGAGAGAGGTGGG - Intronic
1131512836 15:93058878-93058900 CCAGGACTGCATAGGGAGGTTGG + Intronic
1131867807 15:96730710-96730732 CCAGAGAAGCAGAGGGTAGAGGG + Intergenic
1132114664 15:99126531-99126553 CCAGGTCTGCTGAGGCTGGTGGG + Intronic
1133512295 16:6471823-6471845 GCAGGGATGCAGAGTGTGGTTGG + Intronic
1135121734 16:19772008-19772030 CCAGAGCTGTGGAGGGTTGCTGG - Intronic
1135424440 16:22325349-22325371 CCGGACCTGGAGAGGGTGGAGGG + Intronic
1135920307 16:26643460-26643482 AAAGAGCAGCAGAGGGTGGAGGG - Intergenic
1136136254 16:28258583-28258605 CCAGAGCTGGGGAGGCTGGCAGG - Intergenic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1137056245 16:35747931-35747953 CCAGAGAGTCAGGGGGTGGTTGG - Intergenic
1137056674 16:35749458-35749480 CCAGAGAGTCAGTGGGTGGTTGG - Intergenic
1137057779 16:35753728-35753750 CCAGAGAGTCAGGGGGTGGTTGG - Intergenic
1138278167 16:55751316-55751338 GCAGAGCTGCAGGGGAGGGTGGG + Intergenic
1138290509 16:55842629-55842651 GCAGAGCTGCAGGGGAGGGTGGG - Intergenic
1138645976 16:58425294-58425316 GCAGTTCTACAGAGGGTGGTCGG + Intergenic
1139272791 16:65699347-65699369 CCAGAGTTGGAGAGGCGGGTAGG + Intergenic
1139423222 16:66862108-66862130 CCAGAGCTGCAAAGTGGGGAGGG - Intronic
1139469507 16:67170665-67170687 CGAGCGCCGCAGCGGGTGGTGGG - Intronic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1139601496 16:67990189-67990211 CCAGGGATCCAGAGGGTGGCAGG - Intronic
1139662408 16:68430048-68430070 CCAAATCTGCAGAGTGGGGTTGG + Intronic
1139844660 16:69911577-69911599 CCAGAGCCAAAGAGGGTGGAAGG + Intronic
1139917595 16:70438232-70438254 CCAGAGCTGTAGCAGGGGGTGGG + Intronic
1140161160 16:72496678-72496700 CCAGAGCTCAAGTGGGTGGGGGG - Intergenic
1141205211 16:81928096-81928118 GCAGAGCTGGAAAGGGTGATGGG + Intronic
1142196025 16:88739686-88739708 CCAGGGCTGCAGGGGCTGCTGGG + Intronic
1142228061 16:88887008-88887030 CCAGAGCTGCCGCGGGAGGGCGG + Intronic
1142252296 16:88997553-88997575 CCAGGGCTGCGGGGGCTGGTGGG + Intergenic
1142617583 17:1145476-1145498 CCAGAGCTGCAGAAGGCGGGTGG + Intronic
1143104792 17:4523808-4523830 CAAGTGCTACAGAGGGTGGGAGG - Intronic
1143499147 17:7328987-7329009 ACAGAGATGTGGAGGGTGGTGGG - Intronic
1143517894 17:7429173-7429195 CCAGAGCTGAAGGGAGTGGGAGG - Intergenic
1143907962 17:10224963-10224985 GCAGATGTGCAGAGGGTGGGCGG - Intergenic
1144346307 17:14353060-14353082 CCAGAGCTGCTGAGGAAGGGAGG + Intergenic
1147430319 17:40366865-40366887 CCTGAGCTGGAGGGAGTGGTGGG - Intergenic
1148102270 17:45099515-45099537 CCAGTGCTGCCCCGGGTGGTGGG + Intronic
1148896833 17:50843773-50843795 TGAGAGCTGCCGAGGGTGGGAGG - Intergenic
1149023645 17:51999245-51999267 TCAGAGCAGCAGAGGATTGTGGG + Intronic
1149638621 17:58189455-58189477 CCAGAGCTGGAGAGGGTGGGTGG + Intergenic
1150182405 17:63138152-63138174 CCAGAGACGCAGGGGGTGGGAGG - Intronic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1151394326 17:73811655-73811677 CCAGGGCTGCTGAGGGGAGTGGG + Intergenic
1151403236 17:73869878-73869900 CCAGAGCAGCAGAGAAGGGTAGG - Intergenic
1151556052 17:74847276-74847298 CCATAGCTGCTGGGGGTGGGGGG - Intronic
1152169998 17:78739540-78739562 GCAGAGGTGAGGAGGGTGGTAGG + Intronic
1152403346 17:80082684-80082706 GCAGAGCTGAAGGGCGTGGTGGG + Intronic
1152604187 17:81280860-81280882 ACAGGGCGGCACAGGGTGGTGGG - Intronic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1156297333 18:35804542-35804564 CCAGTGAAGCAGAGGGTTGTGGG + Intergenic
1156462158 18:37327226-37327248 AGAGACCTGCAGAGGCTGGTGGG - Intronic
1157021208 18:43784407-43784429 GCACAGAGGCAGAGGGTGGTGGG + Intergenic
1160744322 19:703724-703746 CCAGATCTGCAAGGAGTGGTGGG + Intergenic
1161198500 19:3000773-3000795 CCCGGGCTGCAGGGGGAGGTCGG + Intronic
1161262612 19:3346139-3346161 CCAGGGCTGGGGAGGGTGGCTGG - Intergenic
1161474115 19:4474864-4474886 CCAAGGATGCAGAGGGTGGGGGG - Intronic
1161895034 19:7073886-7073908 ACAGAGCTGTAGAGGGTGGACGG - Intronic
1162927483 19:13937691-13937713 CCAGAGCTGAGGAGCGTGGTGGG - Intronic
1163334123 19:16660478-16660500 CCTGAGCTGCACAGGGTGCGGGG + Intergenic
1163786174 19:19275972-19275994 ACTGTGCTGCAGAGGGAGGTTGG - Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1165404737 19:35622705-35622727 CCTGAGCTGCAGGGGATCGTGGG + Exonic
1165923126 19:39310978-39311000 CCAGGGCAGCCGAGGGTGGCTGG - Intronic
1166239108 19:41477713-41477735 CCAGAGCTGGAGCTAGTGGTAGG - Intergenic
1166241390 19:41496918-41496940 CCAGAGCTGGAGCAAGTGGTAGG - Intergenic
1166364390 19:42271061-42271083 CCAGAGGGGCAGAGGGAGGGTGG + Intronic
1166558750 19:43718531-43718553 CCAGTGGTTCAGAGGGTGGCGGG - Exonic
1166563309 19:43747732-43747754 CAGGGGCTGCAGGGGGTGGTGGG + Exonic
1166831826 19:45643823-45643845 CTGGACCTGCAGAGGGAGGTGGG + Intronic
1167217170 19:48172165-48172187 CCAGAGATGCAGAGGGGGAGAGG + Intronic
1167380168 19:49133865-49133887 CAAGAGCTGCAGCGGGTGAGGGG + Exonic
1168250396 19:55138170-55138192 CCAGTGCCGCAGAGGCTGCTGGG + Intronic
1168384888 19:55954891-55954913 CAAGAGCAGCAGAAGTTGGTCGG - Exonic
925406019 2:3605855-3605877 CCAGAGCTGCACAGCCTGGCAGG - Intronic
925575670 2:5357606-5357628 CCAGAGCTGCAGATGTTTGAAGG + Intergenic
925616505 2:5748870-5748892 CCACAGCTTCATAGGGTGGGTGG - Intergenic
926329242 2:11811107-11811129 CCACAGAAGCAGAGGGTGCTTGG - Intronic
926458490 2:13098859-13098881 CCATTGCTTCAGAGGGTGCTGGG - Intergenic
926715164 2:15918647-15918669 TCAGAGCTGGAGAGAGTGGTGGG - Intergenic
927560568 2:24069535-24069557 CCACAGTTGCACTGGGTGGTTGG - Intronic
927799848 2:26088495-26088517 ACAGAATTTCAGAGGGTGGTAGG + Intronic
928201039 2:29247589-29247611 GCAAAGCTGTAGAGGGTGGGAGG + Intronic
929388793 2:41443249-41443271 CCACAGCTGTTGAGGGTGGCGGG + Intergenic
929814497 2:45220305-45220327 CCCCGGCTGCAGGGGGTGGTTGG + Intergenic
929947462 2:46381773-46381795 CCAGGGCTGCTGAGAGGGGTGGG + Intronic
929947481 2:46381834-46381856 CCAGGGCTGCTGAGAGGGGTGGG + Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930853832 2:55990825-55990847 CCACAACTGCACAGGGAGGTGGG + Intergenic
932485436 2:72081685-72081707 TCAGAGCAGCAGAGGCTGGTAGG - Intergenic
932585519 2:73025675-73025697 GCAATGCTGCAGAGGGTGGAAGG + Intronic
933893245 2:86789754-86789776 CAAGAGCAACAGAGCGTGGTTGG + Intronic
936399500 2:112154757-112154779 TCAGAGCAGGGGAGGGTGGTGGG + Intronic
936438457 2:112529109-112529131 CTAGGGCTGCAGTGGGTGGGAGG - Exonic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937275572 2:120681855-120681877 CCTGAGCTGTAGAGTGGGGTTGG - Intergenic
937417542 2:121728728-121728750 ACAGAGCTGCAGAGGTTGAAGGG + Intronic
937515589 2:122651480-122651502 TGAGAGCTTCAGAGGGTGGCAGG - Intergenic
939429588 2:142085886-142085908 CCAGAGCTCCAGAGGAGAGTGGG - Intronic
943687744 2:190836937-190836959 CCACAGCTGCAGAGAGGGTTGGG - Intergenic
944114284 2:196171072-196171094 CCCGGGCTGAGGAGGGTGGTGGG + Intronic
944403458 2:199354779-199354801 CCAGAAGTTTAGAGGGTGGTTGG - Intronic
945169241 2:206978821-206978843 CTAGAGCTGCAGGGGATGGGCGG - Intergenic
946382255 2:219357011-219357033 CTAGGGCTGAGGAGGGTGGTTGG + Intergenic
946448148 2:219757437-219757459 AGAGAGATGCAGAGTGTGGTGGG + Intergenic
946464151 2:219896568-219896590 ACAGAGCTGGAGAGGGTCCTGGG + Intergenic
946990075 2:225318665-225318687 CCAAAGCTGCACAGGGCAGTTGG - Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
948569193 2:238906837-238906859 GCAGAGCGGCTGAGCGTGGTGGG - Intronic
948579471 2:238974614-238974636 GCAGAGCTGGAGAGAGGGGTTGG - Intergenic
948584927 2:239013343-239013365 CCAAAATTGCGGAGGGTGGTAGG + Intergenic
948839935 2:240643860-240643882 TCAGAGCTGCACACGGTGGGTGG + Intergenic
948942828 2:241204588-241204610 CCAGAGGTGGAGAGCCTGGTGGG + Intronic
949057279 2:241934930-241934952 ACAGGGCAGGAGAGGGTGGTTGG + Intergenic
1169381037 20:5107372-5107394 TCAGAGCTGCACTGGGTGGTAGG - Intronic
1169390373 20:5185897-5185919 CCAGAGCTGGAGAGTGTCTTTGG + Intronic
1170666886 20:18394282-18394304 GCAGTGCTGCCGAGGGTGATGGG - Exonic
1171283001 20:23917200-23917222 GCAGAGCAGCAGGTGGTGGTTGG - Intergenic
1171290922 20:23982420-23982442 CCAGGACTGCAGCGGGTGGGTGG - Intergenic
1172013098 20:31857845-31857867 CCTGAGCTGCAGAGGTTGATGGG + Intronic
1172205425 20:33159863-33159885 CAGGAGCTGCAGGAGGTGGTGGG + Intergenic
1172285057 20:33734400-33734422 CCAGAGTGGCAGTGGGGGGTCGG + Intronic
1172513325 20:35515458-35515480 CCAGAGCTGCAGAGGTTCTGTGG - Exonic
1172787093 20:37475591-37475613 CCAGAGCTGCAGAGTTGGGGTGG - Intergenic
1174111674 20:48201779-48201801 GCAGGGCTGCTGTGGGTGGTGGG + Intergenic
1174484992 20:50855512-50855534 CCAGAGATGCAGGTGGAGGTGGG - Intronic
1175269445 20:57723534-57723556 CAGGAGCTGCAGAGGCAGGTGGG + Intergenic
1175464298 20:59179524-59179546 CCAGAGCTTTAGAGGGAGGGTGG - Intergenic
1175878395 20:62242221-62242243 CAAGAGCTGCAGAGGTGGGCCGG - Intronic
1175950983 20:62582904-62582926 CCAGACATGCACAGGGGGGTGGG - Intergenic
1175960489 20:62634156-62634178 CCAGAGCTGCAGGGGAGGCTCGG - Intergenic
1176232513 20:64039454-64039476 CCAGTCCTGCAGAGGGGGCTGGG - Intronic
1176511439 21:7751505-7751527 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1178645553 21:34382034-34382056 AGAGAGCTGCAGAAGGTGGAAGG + Intronic
1179532909 21:42032308-42032330 CCAGAACTCCAGAGAGTTGTGGG - Intergenic
1179661511 21:42879018-42879040 CCAGTTCTGCAGAGCGTGTTCGG + Intronic
1180014191 21:45072305-45072327 CCAGAGCAGCAGAGAGCGGATGG - Intergenic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180708878 22:17826328-17826350 CCAGGGCGGCAGAGGCGGGTGGG - Intronic
1180735519 22:18013603-18013625 ACAGAGCTGTTGAGGGTGGATGG + Intronic
1180779822 22:18513732-18513754 CCAGGACTGCAGCGGGTGGGTGG - Intergenic
1180931718 22:19596757-19596779 CCCCAGCAGCAGAGGGTGGTGGG - Intergenic
1181198694 22:21205300-21205322 CCAGGACTGCAGCGGGTGGGTGG - Intergenic
1181500669 22:23313951-23313973 AAAGAGCTGCAGAAGGCGGTGGG - Exonic
1181537932 22:23556346-23556368 CCAGATCAGCAGAGGGGAGTGGG - Intergenic
1181634095 22:24166422-24166444 CCAGAGGTGCAGAGGAGGGAAGG + Intronic
1181648477 22:24246383-24246405 CCAGGACTGCAGCGGGTGGGTGG - Intergenic
1181703015 22:24631579-24631601 CCAGGACTGCAGCGGGTGGGTGG + Intergenic
1181970215 22:26684179-26684201 CCAGAGCATAAGAGGCTGGTGGG + Intergenic
1182130001 22:27843832-27843854 GCAGAGATGGAGAGGGTGGCTGG + Intergenic
1182307632 22:29381776-29381798 ACAGAGCTGCAGAAGGTGGGGGG + Intronic
1182622306 22:31624858-31624880 CCAGAGCCGCAGAGGCTGGACGG + Intronic
1183094236 22:35542539-35542561 CCTGAGCTGCCAAGGGTGGTGGG + Intronic
1183471115 22:38007261-38007283 CCAGGACTGCCCAGGGTGGTGGG + Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1184058956 22:42070551-42070573 CCAGCACTGCAGAGGGTGTGAGG - Exonic
1184268226 22:43361833-43361855 CCAGTGCTGGAGAGGCTGTTGGG + Intergenic
1184582512 22:45426998-45427020 CCAGAGATGGGGAAGGTGGTGGG + Intronic
1184741607 22:46431862-46431884 ACAGAGGTGCAGGGGCTGGTGGG - Intronic
1184774959 22:46618526-46618548 CCAGAGCTGATGAGGGTGTCGGG + Intronic
1185324478 22:50218975-50218997 CCAGAGCAGCAGGGGGCTGTGGG + Intronic
1203228111 22_KI270731v1_random:89537-89559 CCAGGACTGCAGCGGGTGGGTGG + Intergenic
949311308 3:2701561-2701583 CCAGAGCTATACAGGGAGGTGGG + Intronic
949619716 3:5796737-5796759 CCAGTGCTGCAGAGTGTGAGAGG - Intergenic
950458159 3:13104810-13104832 CCAGGTCTGCAGGGGTTGGTCGG + Intergenic
952325170 3:32314282-32314304 TCAGGGCTGCAGGGGCTGGTTGG + Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954577145 3:51682829-51682851 CCAGAGCTGCAGACAGTTGAGGG + Intronic
955201856 3:56858789-56858811 CAAGAGATGGAGAGGGTGGAGGG + Intronic
956311239 3:67882914-67882936 CCAGGGCTGCAGCTGTTGGTAGG + Intergenic
957016469 3:75069879-75069901 CCAGAGGAGCAGGGGGTGGCGGG - Intergenic
958177614 3:90016650-90016672 AGAGAGCTGGAGAGGCTGGTTGG - Intergenic
958962259 3:100521732-100521754 CCAGAGCTGCTGTGGCAGGTGGG + Intronic
961320328 3:126068698-126068720 GCAGAGCTGGAGAGGGTAGTGGG - Intronic
963261961 3:143201963-143201985 CCAGCACAGCAGAGGCTGGTGGG - Intergenic
964851079 3:161096889-161096911 TCAGAGTTTCAGAGGGTGGCAGG + Intronic
965605742 3:170496290-170496312 GCAGAGCTGCAGACGCTGGCTGG + Intronic
965808387 3:172566398-172566420 CCAGAGGCTCAGAGGGTAGTTGG - Intergenic
966177166 3:177151347-177151369 CCACAGCTGCAGCCGGGGGTTGG - Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967702370 3:192608137-192608159 CCAGAGTTGGGAAGGGTGGTGGG + Intronic
968064902 3:195753225-195753247 CCAGAGCTGCAGAGTGAGTAGGG + Exonic
968543341 4:1179670-1179692 ACAGAGCTGGAGGGGGTGGGTGG - Intronic
968602758 4:1518106-1518128 CCAGAGCTGCAGAGTACGGCAGG - Intergenic
968960209 4:3739585-3739607 CCAGAACTGCAGCTGTTGGTGGG - Intergenic
969220607 4:5756171-5756193 CCTGAGATGCAGGGGATGGTTGG + Intronic
969331067 4:6473589-6473611 CCAGAGCTGCAGGGGCTCTTGGG + Intronic
969402420 4:6964345-6964367 CAGGAGCTGCAGAGGGTGTAAGG - Intronic
969564326 4:7968774-7968796 CCGGAGCTGGAGAGTGGGGTTGG + Intronic
969660266 4:8523285-8523307 TCAGGGCTGCTGAGGGTGGCTGG + Intergenic
970328635 4:14955690-14955712 CCAGAGCTGAAGATGGAGGCAGG + Intergenic
970394662 4:15654710-15654732 CGAGAGGTGCAGAGGATGGGTGG + Intronic
971181122 4:24329398-24329420 CCGGAGCTGGAGAGGCAGGTAGG - Intergenic
971246928 4:24937843-24937865 CTAGAACTGAAGAGGGAGGTTGG + Intronic
971271389 4:25149937-25149959 CCAGAGGTGGAGTGGGTTGTAGG - Intronic
971978113 4:33717257-33717279 CCAAAGCTCCAGAGAGTGATGGG + Intergenic
974278000 4:59751584-59751606 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
977654410 4:99504686-99504708 CCAGCTCTGAAAAGGGTGGTGGG + Intergenic
978503878 4:109435981-109436003 CAAGAGGTGCAGAGGGTGCTGGG + Intronic
981030122 4:140116624-140116646 CCAGAGCTGTGGAGGATGGAGGG - Intronic
981076255 4:140595371-140595393 CCAGCCCTGCTGAGGGTGGCTGG + Intergenic
981585989 4:146302961-146302983 CCACAGCTGCAGGGAGTGTTAGG + Intronic
984320230 4:178186428-178186450 CCACATCTGGAGAGAGTGGTGGG - Intergenic
984417535 4:179480034-179480056 CCAGAGGCGCAGAGGTGGGTTGG - Intergenic
985571337 5:647160-647182 CCAGAGGTGGGGAAGGTGGTGGG - Intronic
985692056 5:1319024-1319046 CCAGACCTGCAAACGGTGTTTGG - Intronic
986687092 5:10284135-10284157 CGTGAGCTGCAGAGCGTGGCCGG - Intronic
986865074 5:11976679-11976701 CCAGACCTGCAGAAGGTGAGGGG + Intergenic
986991355 5:13556810-13556832 TCAGAGCTGCTGAGGATGCTGGG - Intergenic
990528366 5:56650628-56650650 GCCGTGCTGCAGAGGGTGGGAGG - Intergenic
992169932 5:74091611-74091633 CCAGAGCTTGGGAGGGTAGTAGG - Intergenic
993862511 5:93153427-93153449 CCAGTGTTGCAGAGGATGCTAGG + Intergenic
995495536 5:112738070-112738092 CCAGTGCTGCAGTGGGGGGCGGG - Intronic
996441139 5:123492069-123492091 TCAGAGCAGCAGATGGAGGTGGG + Intergenic
997476796 5:134147253-134147275 CCAGAGCTTCTTAGGCTGGTGGG - Exonic
997647608 5:135491549-135491571 CCAGAGCTGCGGGTGGGGGTGGG - Intergenic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1001587846 5:172845317-172845339 CCACAGATGCACAGGCTGGTAGG - Intronic
1002159285 5:177305536-177305558 CCAGAGCTGCAGCTGGTGGAAGG + Intronic
1002187857 5:177462946-177462968 GCAGAGCAGCAAAGGCTGGTGGG - Intronic
1002382238 5:178839205-178839227 ACAGATCTGGAGGGGGTGGTGGG + Intergenic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002918536 6:1548482-1548504 CTGGAACGGCAGAGGGTGGTGGG - Intergenic
1002923451 6:1590307-1590329 CCAGGGATGCAGAAGGTGTTTGG + Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005497818 6:26404118-26404140 CAAGATCTGCAGAGGGAGGTGGG - Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1007736139 6:43983368-43983390 TCGGAGCTGCACAGGGTGGTGGG + Intergenic
1008888349 6:56456140-56456162 CCAAAGTTGCAGAGTTTGGTAGG + Intergenic
1010284942 6:74065891-74065913 CAAAAGCTGCAGAAAGTGGTCGG - Intergenic
1013142541 6:107352563-107352585 ACAAAGCTGGAGAGGGTAGTTGG + Intronic
1015327593 6:131941079-131941101 CCAGATGTGGAGCGGGTGGTGGG + Intergenic
1017756486 6:157533564-157533586 CCAGAGCTGCAGGGGTCGGCAGG + Intronic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1017809985 6:157977609-157977631 CCAGACCTGCACATGGTGGAAGG - Intergenic
1018205927 6:161436879-161436901 ACAGAGCTGCAGAGGGTGACCGG - Intronic
1018480701 6:164186584-164186606 ACAGAGCTTCAGAGTTTGGTGGG + Intergenic
1019060694 6:169255323-169255345 CCAGCGCTGCAGAGGTCGGCAGG + Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019494570 7:1331781-1331803 CCACAGCTGCAGATGGGTGTGGG - Intergenic
1019650958 7:2158189-2158211 GCAGAGCAGCAGAGGGCTGTGGG + Intronic
1019815608 7:3197598-3197620 CCAGCACTGCAGAAGGTGGGGGG + Intergenic
1019894215 7:3971182-3971204 CCACACCTGCATGGGGTGGTCGG + Intronic
1020149783 7:5673095-5673117 CCGGAGGTCCAGAGAGTGGTGGG - Intronic
1020936597 7:14473290-14473312 CCATAGCTTCAGAGGGTGCAAGG + Intronic
1020949497 7:14657704-14657726 CCAGAAATGCAGAGTCTGGTGGG - Intronic
1020972388 7:14961527-14961549 CCAGATCTGAAAAGTGTGGTTGG + Intronic
1021868617 7:24981482-24981504 CGAGCGCTGCAGGTGGTGGTTGG - Intronic
1023372883 7:39529707-39529729 ACCCAGCAGCAGAGGGTGGTGGG + Intergenic
1023506453 7:40904036-40904058 CCAGAGAGGCTGAGGGTGGTTGG - Intergenic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1023991997 7:45134013-45134035 GCAGGGCTGCAGAGGATGCTGGG + Intergenic
1024232893 7:47376212-47376234 CAAGAGATGGAAAGGGTGGTGGG + Intronic
1024323114 7:48089089-48089111 CCAGAGGGGCAGAGGAAGGTGGG + Intronic
1024532791 7:50407194-50407216 CCAGTGCTGCAGAGGCAGGATGG + Intergenic
1029692577 7:102192016-102192038 CCAGATGTGCACATGGTGGTGGG - Intronic
1032353201 7:131185053-131185075 CGAGAGGAGGAGAGGGTGGTGGG + Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034832181 7:154318964-154318986 CCAGAACCGCAGAGGAGGGTAGG - Intronic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1036145205 8:6248577-6248599 TCAGAGGTGGAGGGGGTGGTGGG - Intergenic
1036411501 8:8506173-8506195 ACAGAGCAGCAGAGAGCGGTGGG + Intergenic
1036470483 8:9048441-9048463 CCAGAGCTGCAGAAGGAGTTTGG - Intronic
1036552695 8:9828976-9828998 CCAGGTGTGCACAGGGTGGTGGG + Intergenic
1038058640 8:23886948-23886970 CCAGAGCTACAGGGGGAGGAAGG + Intergenic
1040500450 8:48000484-48000506 CCCCAGCAGCAGAGAGTGGTTGG - Intergenic
1041566110 8:59280731-59280753 CCACACCTGGAGAGGGTGGTTGG - Intergenic
1041571824 8:59345808-59345830 CAAAAGCAGCAGAGGCTGGTAGG + Intergenic
1042216646 8:66434828-66434850 GCAGCCCTGCACAGGGTGGTGGG + Intronic
1043222659 8:77686819-77686841 CCAAGGCTGCACAGGGTAGTGGG - Intergenic
1043598875 8:81915829-81915851 CCAGAGTTCCAGAGGCTGCTAGG - Intergenic
1045364195 8:101460708-101460730 CTAGAGGTGGAGAGGGTGGGGGG - Intergenic
1045649407 8:104328388-104328410 CCAGAGCTGGGGAGGCTGGGTGG - Intergenic
1048387380 8:133924857-133924879 ACAGAAGTGCATAGGGTGGTGGG - Intergenic
1049251085 8:141589315-141589337 CCAGACTTGCAGAAGCTGGTGGG + Intergenic
1049406512 8:142453954-142453976 CCAGAGCTGGAGAGGAAGGTGGG + Intronic
1049724699 8:144140313-144140335 CCACAGGGGCAGAGGGTGGCTGG - Exonic
1049822704 8:144645819-144645841 CCAGGGCTGCAGGGGGAGCTGGG + Intergenic
1050987557 9:12102281-12102303 CCAGAGCTGCAGAGACTAGCAGG + Intergenic
1053413230 9:37929030-37929052 GCAGGGCTGGAGAGGGGGGTGGG + Intronic
1054456652 9:65434658-65434680 GCAGAGCTCCTGGGGGTGGTGGG + Intergenic
1056666734 9:88587391-88587413 CCAGGGCTGCAGGGTGTGTTTGG + Intergenic
1056924957 9:90826602-90826624 CCAGAGCTGTAGAAGCTGGAAGG - Intronic
1057840403 9:98481455-98481477 GCAGGGCAGCAGAGTGTGGTTGG - Intronic
1058622202 9:106895457-106895479 CTAGAGGTGAAGAGGATGGTGGG - Intronic
1058894918 9:109391274-109391296 GCAGAGCTGCAGATGGGGCTGGG - Intronic
1059344226 9:113617131-113617153 CTACAGCTGCCAAGGGTGGTTGG + Intergenic
1059408389 9:114116560-114116582 ACAGAGCTGCAGAGGATGGATGG - Intergenic
1059495990 9:114709895-114709917 GCAGAGCTTCAGAGGGCTGTGGG - Intergenic
1060719360 9:125964926-125964948 GCATGGCGGCAGAGGGTGGTTGG + Intronic
1060812413 9:126617231-126617253 CCAGGGGTGCAGGGCGTGGTGGG - Intronic
1060945543 9:127568036-127568058 CCGGAGCTGCAGAGGGGGCCTGG - Intronic
1060971342 9:127739932-127739954 CCAGGACTGCAGTGGATGGTGGG - Intronic
1061381869 9:130263747-130263769 CGAGAGCAGCAGCGGGGGGTGGG - Intergenic
1062000080 9:134211478-134211500 CCAAGGCTGCAGGGGGTGGGGGG + Intergenic
1062167409 9:135114809-135114831 CCAGAGCTGCAGAGGCCAGGAGG + Intronic
1062318159 9:135978254-135978276 CCAGGGCTGCTGAGGAGGGTGGG - Intergenic
1062318266 9:135978551-135978573 CCAGGGCTGCTGAGGAGGGTAGG - Intergenic
1062568493 9:137173727-137173749 CCAGAGCTGGAGAGGTGGGAGGG + Intergenic
1062568513 9:137173810-137173832 CCAGAGCTGGAGAGGTGGGAGGG + Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1185595090 X:1301489-1301511 CCAGTGGAGCAGAGGGAGGTGGG - Intronic
1188005734 X:25014508-25014530 CCACAGCGGGAGAGGGTGGGGGG + Intronic
1191978172 X:66896403-66896425 CCAGACCTGCTGATGGGGGTAGG - Intergenic
1194053842 X:89105335-89105357 CTAGAGCTGCAGTGGCTGGGAGG + Intergenic
1194548921 X:95272655-95272677 CCAGAGCTGCACAGAGCAGTGGG + Intergenic
1194754542 X:97722983-97723005 GCAGGGCTGCAGTGGGAGGTAGG - Intergenic
1196032000 X:111101658-111101680 CCAAAGCTCCAGAGAGGGGTGGG - Intronic
1196623979 X:117856681-117856703 GCAGAGCATCAGAGGCTGGTTGG + Intergenic
1196868171 X:120087895-120087917 CCAGAGCAGCTGGGGGTGGCAGG - Intergenic
1197680432 X:129377128-129377150 CCACAGCTGGAGAAGGTGGGAGG - Intergenic
1197703951 X:129620408-129620430 TCAGAGCTGCAGAACGTGGGTGG - Intergenic
1197709123 X:129653714-129653736 CCTGAGCTGCAGGGAGGGGTCGG + Intronic
1199166976 X:144688293-144688315 CCATACTTGCAGAGGGTGATAGG + Intergenic
1199927780 X:152486849-152486871 CCAGATCTGCAAAAGGTGGTTGG - Intergenic
1201426452 Y:13856772-13856794 CCACAGCTGTAGAGACTGGTGGG - Intergenic