ID: 921583337

View in Genome Browser
Species Human (GRCh38)
Location 1:216921194-216921216
Sequence CTCCTGATGAAAGATGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921583337_921583341 2 Left 921583337 1:216921194-216921216 CCAGACACATCTTTCATCAGGAG 0: 1
1: 0
2: 2
3: 8
4: 166
Right 921583341 1:216921219-216921241 GGAGAGTAGTAGAAGCGTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 153
921583337_921583340 -1 Left 921583337 1:216921194-216921216 CCAGACACATCTTTCATCAGGAG 0: 1
1: 0
2: 2
3: 8
4: 166
Right 921583340 1:216921216-216921238 GGTGGAGAGTAGTAGAAGCGTGG 0: 1
1: 0
2: 0
3: 17
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921583337 Original CRISPR CTCCTGATGAAAGATGTGTC TGG (reversed) Intronic
900184501 1:1326680-1326702 ATCCTGATGAAGGGTGGGTCAGG + Intronic
901599455 1:10411505-10411527 CACCTGATGAAAGACGTGCTGGG + Exonic
901624554 1:10616588-10616610 CTCCTGATGACAGATCCTTCGGG + Intronic
910592310 1:88939419-88939441 CTGCTGATGTAAGAAGAGTCTGG + Intronic
914976210 1:152365463-152365485 ATCCTGTTAAAAGATGTGTGAGG - Intergenic
916343921 1:163766875-163766897 CTGATGATCAAAGATGTGTTGGG + Intergenic
916636614 1:166676466-166676488 CTCATCAGGAAAGAAGTGTCTGG - Intergenic
918023930 1:180723797-180723819 CTCCTGGTAAATGATGTATCTGG - Intronic
918060095 1:181053590-181053612 CTTGTGATGAAAGCTGTCTCTGG + Exonic
918108042 1:181429971-181429993 CTCCTGAAAAAGGCTGTGTCTGG - Intronic
918346363 1:183610645-183610667 ATCCTGAAGAGAGATGTGTTTGG + Intergenic
918711299 1:187734385-187734407 CTACTGATGAAAGAGGTGGTGGG + Intergenic
919511245 1:198467486-198467508 CTCATGCTGACAGCTGTGTCTGG + Intergenic
920197794 1:204241191-204241213 CTCCTGCAGGGAGATGTGTCAGG - Intronic
920779651 1:208976243-208976265 CTCTTAATGGAAGGTGTGTCAGG - Intergenic
921583337 1:216921194-216921216 CTCCTGATGAAAGATGTGTCTGG - Intronic
1064428766 10:15253822-15253844 CTCCTGGTGGAAGAGGTGTCAGG - Intronic
1068796028 10:61081266-61081288 CTCCTTATGAAAGATGTCAATGG + Intergenic
1072800144 10:98387089-98387111 TTCCTGATGAAAGCTGAGTATGG + Intronic
1073421478 10:103427180-103427202 CCACTGAAGACAGATGTGTCAGG - Intronic
1073568353 10:104554965-104554987 CTCCTGCTGAAAGAGTTTTCTGG + Intergenic
1074889125 10:117720588-117720610 ATCCTGCTGAAAGCTGTGGCAGG + Intergenic
1075772448 10:124951259-124951281 CTACTGTTGAAATATGTGCCTGG + Intronic
1076663179 10:132068953-132068975 CTCAGGATGAAGGATGTGACTGG + Intergenic
1078778335 11:14413965-14413987 CTTCTGAGGAATGATGTGTGAGG - Intergenic
1079193386 11:18301694-18301716 CTCCTGCTCAACGATGTGCCAGG + Intronic
1080463292 11:32474393-32474415 CTCATGATGAAACATGCTTCAGG - Intergenic
1080691757 11:34564438-34564460 CTCCTGATGGAAGCAGTATCTGG - Intergenic
1081284791 11:41254651-41254673 CTCCTGAGGAACAATGTGTAAGG + Intronic
1086771679 11:90774882-90774904 ACACTGAGGAAAGATGTGTCAGG + Intergenic
1092144419 12:6204723-6204745 CTACTGTTGGAAGATATGTCTGG - Intronic
1094111935 12:26871093-26871115 ATTCTGATGAAAGCTGTTTCAGG + Intergenic
1094130327 12:27068005-27068027 ATCCAGAAGAGAGATGTGTCTGG + Intergenic
1096557220 12:52410744-52410766 TTCCAGAAGAGAGATGTGTCTGG + Intergenic
1097789388 12:63798093-63798115 TTCCTGATGAAAGAGGAGGCAGG - Intronic
1098335932 12:69404477-69404499 CTCCTGATGAAAGATGAGTTTGG + Intergenic
1098851412 12:75600649-75600671 CACCTGATGAAACATGTGCTGGG + Intergenic
1102379648 12:112453394-112453416 CTCCAGTTGAAAAATGGGTCTGG + Intronic
1104726192 12:131077082-131077104 CTGCTGTTGCACGATGTGTCTGG + Intronic
1105940853 13:25146612-25146634 CTCCTGATACAAGGTGTGTGGGG - Intergenic
1107564449 13:41587615-41587637 CGCCTGGTGGTAGATGTGTCTGG - Exonic
1107871263 13:44748823-44748845 CTCCTGATCAAAGTTGCGTGGGG + Intergenic
1107919710 13:45191938-45191960 CTCCTGTAAAAAGATATGTCAGG + Intronic
1112539124 13:100289850-100289872 CAAATAATGAAAGATGTGTCTGG - Intronic
1113757669 13:112824851-112824873 GTCCTGATGATAAATATGTCAGG + Intronic
1116167047 14:41347924-41347946 CTCCTGATGAAATATGTCTTAGG - Intergenic
1117101015 14:52347793-52347815 TTCCTGATGACAGCTGTCTCTGG + Intergenic
1117428277 14:55623871-55623893 CTTCTAATGAAAGATGTTGCTGG + Intronic
1120035950 14:79698459-79698481 ATCCTGATTAATCATGTGTCAGG + Intronic
1120254748 14:82105034-82105056 GTCTTGATGAAACATGGGTCAGG + Intergenic
1122742610 14:103880892-103880914 CTCCTGAGGACAGCTCTGTCGGG + Intergenic
1125873567 15:43124308-43124330 ATCCTAAGGAAAGATGTGTGTGG - Intronic
1126705144 15:51399177-51399199 CACCTGATGAGAGTGGTGTCGGG - Intronic
1130968173 15:88712254-88712276 CTCCTGAGGAAGGCTGTGTCTGG - Intergenic
1140852771 16:78950424-78950446 CTCCTGATGAAAAAGATGTTGGG + Intronic
1143334288 17:6160610-6160632 CTCCTGAACAAAGATGGGTAGGG - Intergenic
1144211008 17:13015735-13015757 TTGCTTTTGAAAGATGTGTCAGG + Intronic
1144343256 17:14328390-14328412 CTCCTGCTGAAAGTTGATTCCGG + Intronic
1144465703 17:15495452-15495474 TTCTTGATGAAAGCTATGTCAGG + Intronic
1148606895 17:48936721-48936743 CCCCTGATGTCTGATGTGTCTGG - Intronic
1150592975 17:66579345-66579367 AGCCTGAAGAAAGATGTTTCCGG + Intronic
1151932050 17:77238647-77238669 ATTCTGATGAAAGATGAGACTGG + Intergenic
1153635887 18:7113232-7113254 ACCCAAATGAAAGATGTGTCCGG + Intronic
1153667374 18:7378387-7378409 CTCTTGTTGAGACATGTGTCTGG - Intergenic
1155957017 18:31962776-31962798 CACCTGATGAAAGACGTGCTGGG + Intergenic
1157938765 18:51902570-51902592 CTGCTGATGAAAGTTTTCTCTGG + Intergenic
1158679340 18:59552722-59552744 CAGCTGATGGAAGATGTGTCTGG + Intronic
1158775600 18:60575017-60575039 CTCCTGCTGAAAGCTGACTCAGG - Intergenic
1161836742 19:6652800-6652822 TTCCTGAGGAAAGATCTGTGGGG - Intergenic
1161940020 19:7396410-7396432 CTCCAGCTGTAAGAGGTGTCAGG + Intronic
1164403993 19:27925473-27925495 ACCATGATGAAAGATGTGTAAGG + Intergenic
1165338596 19:35193615-35193637 CTTCTGATGCCAGATGTGTGGGG + Intergenic
1165674476 19:37709775-37709797 CTCCTGATGAGAGAAGTCTATGG + Exonic
1168113421 19:54207796-54207818 CCCCTGATGACAGAAGTTTCTGG - Intronic
1168166779 19:54554138-54554160 TTCCTTATGAATGATGTGTGAGG + Intergenic
926336449 2:11866116-11866138 CACCTGAGGCAAGTTGTGTCTGG - Intergenic
926984027 2:18601594-18601616 CTACTGATGAAAGTTTGGTCAGG - Intergenic
928600974 2:32903370-32903392 CTCCTGAGGAAAAATTTCTCTGG + Intergenic
928865348 2:35911052-35911074 CTCCTGAGGTAAGTTGTGCCAGG - Intergenic
932202563 2:69844877-69844899 CTCCTGATGAGAGAAGTCTGTGG + Intronic
933038293 2:77428454-77428476 CTCCTGATGAAAGTTTTGCCAGG - Intronic
936652061 2:114439095-114439117 ATCATGAAGAAAGATGTGGCAGG + Intergenic
937611516 2:123867424-123867446 ATCTTTATGAAAGATGTGACAGG + Intergenic
939813119 2:146859482-146859504 CTCCCAGTGAGAGATGTGTCAGG - Intergenic
939851439 2:147311060-147311082 GTCCTGCTTAAAGAAGTGTCAGG + Intergenic
941508196 2:166374139-166374161 CTACAGAAGAAAGATGAGTCAGG - Intronic
941956869 2:171213952-171213974 CTCCTCAAGAAAGATATGGCTGG - Intronic
944263881 2:197703523-197703545 CTCATGATGAAATCTTTGTCAGG + Intronic
944535611 2:200706903-200706925 CTTCTGATGTCAGATGTGTGTGG + Intergenic
947574737 2:231264059-231264081 CCTCTGATGAAAGGTGTGTTGGG + Intronic
947801904 2:232933918-232933940 CTCCTGATGAAAGATGAGTGAGG - Intronic
1173461772 20:43248697-43248719 CTCCTGATGAAGCCTGGGTCCGG + Intergenic
1174285590 20:49470618-49470640 CTCTGGATGAAGAATGTGTCTGG - Intronic
1174787752 20:53448358-53448380 ATCATGATGAATGAGGTGTCTGG + Intronic
1179822300 21:43943912-43943934 CTCCAGGTGAAAGATGCGGCGGG - Intronic
1181080015 22:20407602-20407624 CTCCTGATTAAAGCCGTGTCAGG - Exonic
1183098254 22:35567629-35567651 CTGCTGATGATTGATGTGTGGGG - Intergenic
1183186912 22:36297097-36297119 CTCGTTATGAAACGTGTGTCAGG + Intronic
1183324735 22:37185108-37185130 CTCAGGATGAAAGAGGAGTCTGG + Intronic
1183785937 22:40029248-40029270 CTCCTGACCAAAGAGGGGTCGGG - Intronic
950838995 3:15948751-15948773 CTGGTTATGAAACATGTGTCTGG - Intergenic
956415084 3:69017185-69017207 TTCCTGATGTAAGATGTTGCAGG - Intergenic
956870984 3:73417784-73417806 CTACTGATAAAAGTTGTCTCTGG - Intronic
958978621 3:100695366-100695388 CTCCTGATGAACAGTGTGTGGGG + Exonic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
964012888 3:151912185-151912207 CTAATGATGACAGATGAGTCTGG + Intergenic
966507983 3:180728098-180728120 TTCCAGATGAGAGATGTGACTGG - Intronic
967045107 3:185729202-185729224 ATCCTGAAGTAAGATGTCTCAGG + Intronic
968980140 4:3843209-3843231 CTTCTGATGCCAGATGTGTGGGG - Intergenic
976621787 4:87135767-87135789 GTCCTGATGAAACAAATGTCTGG - Exonic
977242039 4:94584586-94584608 CTCCTAAAGAAAGCTGTGTGTGG - Intronic
978083952 4:104626826-104626848 CTGCTGAAGAAGGATGTGTATGG + Intergenic
980210497 4:129781544-129781566 CTTCTGATGCCAGATGTGGCAGG + Intergenic
980392919 4:132169616-132169638 CCACTGAGGAAAGATGGGTCAGG + Intergenic
980658988 4:135831565-135831587 CTCCTTATAAAACATGTATCAGG - Intergenic
985569304 5:635871-635893 TTCCTGATAAAGGATGAGTCTGG - Intronic
985569322 5:635950-635972 TTCCTGATAAAGGATGAGTCTGG - Intronic
985663054 5:1166847-1166869 CTCCTGATGGCAGACGTCTCAGG - Intergenic
987336213 5:16900063-16900085 CTCTTGATGAAAGATATCACAGG - Intronic
987678047 5:21100716-21100738 CTACTGAAAAAAGATGTATCTGG - Intergenic
995051768 5:107715053-107715075 CTCATGAAGGAAGATTTGTCAGG + Intergenic
996016965 5:118550179-118550201 CACCTAATTAAAGATGAGTCAGG + Intergenic
1001525631 5:172426644-172426666 CTGCTGATGAATGATGGCTCAGG + Intronic
1004938913 6:20535347-20535369 GTCCTCTTGAAAGATGAGTCTGG - Exonic
1006474246 6:34244714-34244736 CTCCTGAAGAGGGATGAGTCAGG - Intronic
1007554690 6:42755973-42755995 ATCCTGAAGAAAGAGGTGACTGG - Intronic
1007608069 6:43130505-43130527 CTCCAGATGAAAGCTTTGCCAGG + Exonic
1009479306 6:64136647-64136669 CTGCTCATGACAAATGTGTCTGG - Intronic
1010375539 6:75164785-75164807 TGGCTGGTGAAAGATGTGTCAGG - Intronic
1014157876 6:118133042-118133064 ATCTTGATGTGAGATGTGTCTGG + Intronic
1014971110 6:127816577-127816599 GTCCTGATGTAAGATATTTCAGG - Intronic
1015864958 6:137718615-137718637 TTCCTGATAAAAGGTGTGTTAGG - Intergenic
1017086071 6:150714105-150714127 CTCCTGGAGAAAAATGTGTCTGG + Intronic
1017826249 6:158084179-158084201 CTCCTGAGAAAAGAAGGGTCAGG - Intronic
1018446401 6:163862897-163862919 GTCCTAATGAATGATGTGGCGGG + Intergenic
1019424863 7:969752-969774 GTCCTGCTAAAAGATGTATCTGG + Intronic
1020633781 7:10672130-10672152 CCACTGACGAAGGATGTGTCAGG + Intergenic
1021436655 7:20625050-20625072 CTCTTGATAAAAGTTGTTTCAGG - Intronic
1021840673 7:24719342-24719364 CTCATGATGAAAGGGGTGGCAGG + Intronic
1022479036 7:30731088-30731110 CAGCTGATGAGAGATGTGGCTGG + Intronic
1024614652 7:51100991-51101013 CACCTGTTGAAAGATGGTTCTGG + Intronic
1026966737 7:74444890-74444912 CTCATGATGTAAGATGTAGCAGG - Intergenic
1027630523 7:80599266-80599288 CTCCTAATGAAGGATGTGTTTGG + Intronic
1028044731 7:86103913-86103935 CTACTGAGGAAAGATGATTCTGG + Intergenic
1031167397 7:118245748-118245770 CTCCTTAGGAAAGAAATGTCAGG - Intergenic
1032877994 7:136058224-136058246 CTCCTGATCCAAGAGGTGACAGG + Intergenic
1033552033 7:142456055-142456077 CTTCTGAAGAAAGATGTTCCTGG - Intergenic
1035286909 7:157812453-157812475 CTCTTGATGAAAGAAGTCCCTGG - Intronic
1036507952 8:9372883-9372905 ATCCTGATGAATGAAGGGTCAGG - Intergenic
1038090998 8:24252830-24252852 TTCCTGATGCAAGATGAGTTTGG - Intergenic
1039878311 8:41606400-41606422 CTCCTGATACCAGATGTGTGAGG - Intronic
1042020401 8:64368373-64368395 CTGCTGATGGATGAGGTGTCAGG - Intergenic
1044055573 8:87565968-87565990 CTGCTGAGGAAAGATGAATCTGG - Intronic
1046417234 8:113933798-113933820 CTGCTTATGAAAGATTTGGCTGG + Intergenic
1047435355 8:124831306-124831328 CTCCTTATCAAAGATTTTTCTGG - Intergenic
1047834474 8:128673387-128673409 ATCCTGAGAAAAGAAGTGTCTGG - Intergenic
1048224129 8:132568330-132568352 CTCTTGATGGAAGGAGTGTCCGG + Intergenic
1048311706 8:133327682-133327704 CTCCTGACGAAAGGTGAGCCAGG + Intergenic
1048474451 8:134730618-134730640 CCCCTGTTTAAAGATGTGTGCGG + Intergenic
1048645843 8:136418165-136418187 CTCCTTAAGAAAGATGTTACTGG + Intergenic
1050272953 9:3965619-3965641 CTCCTGACGAAACATGTGCATGG + Intronic
1052066906 9:24033495-24033517 CTCATGATGAGAGAAATGTCAGG - Intergenic
1053459536 9:38257823-38257845 CTCCTGGTGACAGAGGTCTCTGG + Intergenic
1056067137 9:82948118-82948140 TTACTGATGAAAGCTGTCTCAGG - Intergenic
1057723925 9:97554982-97555004 CTCCTGAGGAAAGGGCTGTCTGG - Intronic
1058783784 9:108365629-108365651 CTCCTGCTGGAAGGGGTGTCCGG - Intergenic
1060290328 9:122296610-122296632 CTCCTGATAGAAGATTTATCTGG + Intronic
1060545679 9:124457808-124457830 CTCCCGAGGGAAGATGTGTGTGG - Intronic
1061009504 9:127946639-127946661 CCCCAGAAGAGAGATGTGTCTGG - Intronic
1061633591 9:131890445-131890467 CTCCTGATGAGAGATTAGCCCGG - Intronic
1185831599 X:3308382-3308404 CTTCTGATGACAGATTTGGCAGG - Intergenic
1185958113 X:4514542-4514564 CTCCTGATAAAAAATCTGTAGGG - Intergenic
1189182954 X:39020371-39020393 CTCCTGATGGAAGTTGAGTTGGG - Intergenic
1193150523 X:78119502-78119524 CTCCTGATGAAAATTGACTCTGG + Intronic
1201244995 Y:11994615-11994637 CTTCTGATGACAGATTTGGCAGG + Intergenic
1201517607 Y:14835081-14835103 CTCCTGATGACAAATGTTTGTGG + Intronic
1202092536 Y:21208943-21208965 CCAGTGAAGAAAGATGTGTCAGG - Intergenic