ID: 921587755

View in Genome Browser
Species Human (GRCh38)
Location 1:216967447-216967469
Sequence ATGTCTTTCTAGAAAAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 515}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921587755 Original CRISPR ATGTCTTTCTAGAAAAGGCA GGG (reversed) Intronic
900835050 1:4996648-4996670 ATTTTTTTCAAGAAAATGCATGG - Intergenic
900851899 1:5150424-5150446 ATGTGTTTCTGCAAAAGACAAGG + Intergenic
901225136 1:7608930-7608952 ATGTCCTTCTAGAAAAGGCCAGG - Intronic
902588403 1:17455991-17456013 TTGTATTTCTAGTAAAGACAGGG - Intergenic
905000223 1:34662166-34662188 TTGTATTTCTAGTAGAGGCAGGG + Intergenic
905022500 1:34827540-34827562 AAGTCTTTGGAAAAAAGGCAGGG + Intronic
905435115 1:37950596-37950618 ATGTCTTCCTAGGCCAGGCATGG - Intergenic
906401272 1:45506657-45506679 TTGTATTTCTAGTACAGGCAGGG + Intronic
906553671 1:46689333-46689355 ATGTCTTTCAAGATAAGAAAAGG + Intronic
908028153 1:59972412-59972434 ATGTTGTTCTGGCAAAGGCACGG + Intergenic
908044280 1:60151489-60151511 ATGACTTTCTAAAAATGGAATGG + Intergenic
908196642 1:61751651-61751673 TTGTATTTTTAGTAAAGGCAGGG - Intronic
909950967 1:81719969-81719991 ATTTGTTTCTAAAAATGGCAGGG - Intronic
910634101 1:89387758-89387780 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
911103229 1:94110181-94110203 CTGTCTTCCTAGCAAAGTCAAGG - Intronic
911194614 1:94981163-94981185 CTTTCTTTCTAGAACAGTCAAGG + Exonic
911909390 1:103613503-103613525 ATGTCTTGCTATCAAAGGAAAGG + Intergenic
912198028 1:107423076-107423098 TTGACTTTCTAGATAAGGAAAGG - Intronic
912347409 1:108977324-108977346 TTGTATTTTTAGTAAAGGCAGGG + Intronic
912424355 1:109573588-109573610 ATGTCTATCAAGAAAATGTATGG - Intronic
912473279 1:109920489-109920511 TTGTCTTTTTAGTAAAGACAAGG + Intronic
913141729 1:115947941-115947963 TTGTCTTTTTAGTAGAGGCAGGG - Intergenic
913457298 1:119046528-119046550 TTGTCTTTTTAGGAAAGACAGGG + Intronic
914449210 1:147775757-147775779 ATGGCTTGCTAGAAAAGTCCAGG + Intergenic
914780277 1:150779601-150779623 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
915392627 1:155558294-155558316 ATGTATTTTTAGTAAAGACAGGG - Intronic
917407871 1:174727911-174727933 ATTTCTTTGTAGAAGAGGAAAGG + Intronic
917512357 1:175678933-175678955 ATTGCTCTCTAGAAATGGCAGGG - Intronic
918185037 1:182119583-182119605 TTGTATTTTTAGAAGAGGCAAGG - Intergenic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
919635438 1:199999020-199999042 TTGTCTTTTTAGAAGAGACAGGG - Intergenic
919813390 1:201422881-201422903 ATGTCGTTGTAGAGAGGGCAGGG - Intronic
921073141 1:211678620-211678642 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
921114033 1:212069716-212069738 TTGTATTTTTAGTAAAGGCAGGG + Intronic
921587755 1:216967447-216967469 ATGTCTTTCTAGAAAAGGCAGGG - Intronic
921661111 1:217803843-217803865 TTGTATTTTTAGTAAAGGCAGGG - Intronic
921928813 1:220736294-220736316 TTGTGTTTTTAGAAGAGGCAGGG - Intergenic
922121259 1:222671360-222671382 ATGAATTTCTAAAGAAGGCATGG + Intronic
922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG + Intergenic
923812953 1:237340955-237340977 TTGTCTTTCTAGAAACAGAAAGG - Intronic
923869123 1:237971884-237971906 ATTTTTTTCTATAAAAGGGAGGG - Intergenic
924053241 1:240098573-240098595 ATGTCTTATTATAAAAGGAAAGG + Intronic
924275565 1:242382673-242382695 ATGTCTTTCTGGCAACGGTAGGG + Intronic
924290132 1:242527306-242527328 ATTTATTTTTAGTAAAGGCAGGG + Intergenic
924302902 1:242657894-242657916 AAGCCTTTCTAGCAAAGGCAAGG + Intergenic
924533593 1:244914665-244914687 TTGTATTTCTAGTAGAGGCAGGG - Intergenic
1062777400 10:164339-164361 TTGACTTTCTAGGATAGGCAGGG + Intronic
1063398711 10:5719515-5719537 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1063567746 10:7186069-7186091 ATTTCTTTCTATAAAAGGTACGG + Intronic
1064840962 10:19591668-19591690 TTGTATTTTTAGAAAAGACAGGG + Intronic
1064871094 10:19937776-19937798 ATTTCTTTCTAGATGAGGAAGGG + Intronic
1065365036 10:24926971-24926993 ATGTATGTCAAGAAAATGCATGG + Intronic
1065522251 10:26584302-26584324 ACCTCTTCCTAGCAAAGGCATGG - Intergenic
1065704213 10:28456721-28456743 TTGTATTTCTAGTAGAGGCAGGG - Intergenic
1065923336 10:30412777-30412799 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1066235992 10:33485194-33485216 CAGTGTTTCTAGAAAATGCAAGG - Intergenic
1066285433 10:33961633-33961655 ATTTCTATCTAGAAAATGCCTGG + Intergenic
1066285818 10:33965016-33965038 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1067735589 10:48847705-48847727 ATGGCTTCCTTGAGAAGGCATGG + Intronic
1067773828 10:49146947-49146969 TTGTCTTTTTAGCAGAGGCAGGG + Intergenic
1067993714 10:51244969-51244991 CTGACTTTCTAGAGAAGGAAAGG - Intronic
1068427875 10:56890869-56890891 AAGTCTTTCTAAAAAATGTATGG - Intergenic
1068775395 10:60863115-60863137 ATTTCTTTCTAAAAAAGGCCAGG - Intergenic
1069400663 10:68042179-68042201 TTGTATTTTTAGAAAAGACAGGG + Intronic
1069418727 10:68226691-68226713 TTGTATTTTTAGAAGAGGCAGGG - Intergenic
1070012332 10:72488542-72488564 ATGTCTTCCTAAAAAATCCAAGG + Intronic
1070373566 10:75808168-75808190 ATGTATTTCTCCAGAAGGCAGGG - Intronic
1070631343 10:78087015-78087037 GTTTATTTCTAAAAAAGGCAAGG + Intergenic
1071174531 10:82909082-82909104 AAGTCTTTCTACGCAAGGCATGG - Intronic
1071212111 10:83355430-83355452 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1071615214 10:87069340-87069362 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1072026311 10:91462391-91462413 AAGTCTTTCTAAAAAAGGATTGG - Intronic
1072647894 10:97273333-97273355 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1072679130 10:97493299-97493321 ATGTCTTTCTGGGCTAGGCATGG - Intronic
1074492360 10:113950005-113950027 ATGTCTTTCTAGAACTGTAAAGG + Intergenic
1074533038 10:114310097-114310119 TTGTATTTTTAGTAAAGGCACGG + Intronic
1074534405 10:114318564-114318586 TTGTATTTTTAGAAAAGACAGGG - Intronic
1075182700 10:120226094-120226116 AAGTCTTTCTAGGACAGGCCCGG + Intergenic
1075224041 10:120609298-120609320 ATGTCATTTTAGAAAATGTAGGG + Intergenic
1077084194 11:740099-740121 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078723177 11:13902760-13902782 ATGGCTTCCTAGCAAAGCCAAGG + Intergenic
1079264662 11:18919610-18919632 ATGTCTTTGTTAACAAGGCAAGG + Intergenic
1079266836 11:18941767-18941789 ATGTCTTTGTTAACAAGGCAAGG + Intergenic
1079619522 11:22536152-22536174 AAGGCTTTCTAGAAGAGGTAAGG - Intergenic
1079843837 11:25437943-25437965 ATTTATTTATAGAAAAGGCAGGG + Intergenic
1080197322 11:29627608-29627630 ATGTTTTACTACAAAAAGCAGGG - Intergenic
1081460512 11:43268508-43268530 ATTTCATTCTATAACAGGCATGG - Intergenic
1081562733 11:44233280-44233302 ATTTCATGCAAGAAAAGGCATGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083402674 11:62434753-62434775 ATTTCTTTTTAGTAGAGGCAGGG - Intronic
1084180865 11:67445192-67445214 ATCTCTTTCTGGGAAAGGGAGGG - Intergenic
1084539835 11:69779139-69779161 ATGTCTTTCTGCAAAAGTCCAGG + Intergenic
1084784380 11:71433738-71433760 ATGTCTGGGAAGAAAAGGCAGGG + Intronic
1085925744 11:81018424-81018446 ATATCTATGAAGAAAAGGCATGG + Intergenic
1086350326 11:85937490-85937512 TTGTCTTTTTAGTAAAGACAGGG - Intergenic
1086601176 11:88636048-88636070 TTGTCTTTCTAGAAAAGCAGTGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087360993 11:97159155-97159177 ATGTCTTTACAGAAAAGGAGCGG - Intergenic
1087645871 11:100807655-100807677 ATGTCTTCCCAGAGAAGACATGG - Intronic
1087662609 11:101004790-101004812 TTGTATTTTTAGAAGAGGCAGGG - Intergenic
1088261680 11:107949996-107950018 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1088266363 11:107991610-107991632 TTGTCTTTTTAGTAGAGGCAGGG + Intergenic
1089902255 11:121999384-121999406 ATGCCTTTCAAGAAAAGAGAAGG + Intergenic
1089936620 11:122370909-122370931 CTGTCTTTTTAGTAAAGACAGGG + Intergenic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091857014 12:3748303-3748325 AGGTGTTTCTAGAAGATGCATGG - Intronic
1092063488 12:5569749-5569771 GTGTCTTTCTTTAAAATGCAAGG - Intronic
1092620445 12:10259791-10259813 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1092738472 12:11606377-11606399 ATGTATTTTTAGTAGAGGCAGGG - Intergenic
1093152281 12:15636639-15636661 ATGTCTTTATAGGAAATGTAAGG + Intronic
1093469712 12:19487543-19487565 TTGTATTTTTAGAAAAGACAGGG - Intronic
1093917204 12:24817772-24817794 ATGTTTTTCTAGGTAAGGTAAGG + Exonic
1094360234 12:29622760-29622782 ATGCCTTTCTAGAGAATGAATGG + Intronic
1094429076 12:30346966-30346988 ATGGCTTCCTAGAAAACACAAGG - Intergenic
1095142821 12:38687552-38687574 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1095453387 12:42355562-42355584 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097492147 12:60283198-60283220 ATGTCTTACAAGAAAACGCTTGG + Intergenic
1097768101 12:63548459-63548481 ATTTCTATCTAGAAGAAGCAGGG - Intergenic
1097784462 12:63743525-63743547 ATTTCTATCTAGAAAAAGCAGGG - Intergenic
1097860544 12:64514357-64514379 ATGTATTTTTAGTAGAGGCAGGG + Intergenic
1098890235 12:76003087-76003109 ATGTTTTTCTAAAACAGTCATGG - Intergenic
1099164332 12:79284520-79284542 ATTTCTTTATAGTCAAGGCATGG - Intronic
1099728963 12:86473127-86473149 TTGTGTTTTTAGAAGAGGCAGGG + Intronic
1099943102 12:89213500-89213522 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1100070248 12:90707699-90707721 TTGTATTTTTAGAAAAGGCAGGG + Intergenic
1100321376 12:93496229-93496251 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1101014456 12:100485167-100485189 ATGTCTTTACAGTTAAGGCAAGG + Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101672210 12:106886104-106886126 ATGTGTTTCTAGCCAAAGCAAGG - Exonic
1102424147 12:112827680-112827702 ATTTTTTTTTAAAAAAGGCAGGG + Intronic
1103089265 12:118085983-118086005 TTGTATTTTTAGAAAAGACAGGG - Intronic
1104101203 12:125612299-125612321 TTGTATTTCTAGTAGAGGCAGGG - Intronic
1104584410 12:130036515-130036537 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1105561295 13:21494042-21494064 ATGTCTTCTGAGAAAGGGCAAGG + Intronic
1105730156 13:23205756-23205778 ATATCTCACTAGAAAGGGCAGGG - Intronic
1105977208 13:25482559-25482581 ATGTCTTTCCAGAAAAGATGTGG + Intronic
1106366653 13:29087882-29087904 TTGTGTTTTTAGAAAAGACAGGG - Intronic
1106415357 13:29541831-29541853 ATGTCTTTCTAGACTATGTATGG + Intronic
1106527808 13:30558646-30558668 ATGTCTTTTTGGAAAAAGGAAGG - Intronic
1107399977 13:40060276-40060298 GTCTCATTCTGGAAAAGGCAGGG - Intergenic
1107476622 13:40743137-40743159 TTGTATTTTTAGAAGAGGCAGGG - Intronic
1108061663 13:46539128-46539150 ATGACATTCTAGAAAATGCATGG - Intergenic
1108804197 13:54133464-54133486 ATGTCTTTCTAAAGACGACATGG - Intergenic
1109790055 13:67234356-67234378 AGGTTTTTCTAGAAAAGAAAAGG - Intergenic
1109957793 13:69591033-69591055 CTGTATTTTTAGAAGAGGCAGGG + Intergenic
1110260603 13:73480752-73480774 ATGTCTTTCTGGTAAAGTCAGGG + Intergenic
1110608035 13:77456408-77456430 ATGTCTTTGTACAAAATGCTGGG + Intergenic
1111080324 13:83297824-83297846 ATGTATTTGTAGTAGAGGCAAGG + Intergenic
1111135665 13:84039312-84039334 TTGTATTTTTAGTAAAGGCAAGG - Intergenic
1111729139 13:92051372-92051394 TTGTATTTCTAGTAGAGGCAGGG + Intronic
1112418320 13:99224250-99224272 ATGTCTTTTAAGAAAAGGGAGGG - Intronic
1113368245 13:109698242-109698264 ATGTCATTCTATGAATGGCAAGG - Intergenic
1114763282 14:25342226-25342248 TTGTCTTTTTAGTAGAGGCAGGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1115549026 14:34488520-34488542 TTGTATTTTTAGAAAAGGCGAGG - Intergenic
1115656186 14:35445874-35445896 ATCTTTTTCTAAATAAGGCAGGG - Intergenic
1116234949 14:42268088-42268110 ATGCCCTTCTAGAAAAGTGAAGG + Intergenic
1116557865 14:46335839-46335861 GTGGTTATCTAGAAAAGGCAGGG - Intergenic
1116679307 14:47945556-47945578 ATGTCTTTCTAGAAGAGTGAAGG - Intergenic
1117130540 14:52682371-52682393 ATGTCATTCCAGAAAGGACACGG + Exonic
1117430183 14:55650179-55650201 ATGTCTTTGTAGAATGGCCAGGG - Intronic
1118391840 14:65302465-65302487 ATGTCCTTCTAGAAATGGCCAGG - Intergenic
1119884397 14:78128259-78128281 GTCTCTTTCTAGAAAAGCAAAGG - Intergenic
1120087744 14:80294069-80294091 TTGTATTTCTAGTAGAGGCAGGG + Intronic
1120235881 14:81890338-81890360 ATCTCTAATTAGAAAAGGCAGGG + Intergenic
1120410114 14:84143627-84143649 ATGTATTTTTAGTAGAGGCAGGG + Intergenic
1120803035 14:88714008-88714030 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1123045480 14:105511353-105511375 TTGTATTTTTAGAAGAGGCAGGG - Intergenic
1123045484 14:105511398-105511420 TTGTATTTTTAGAAGAGGCAGGG - Intergenic
1123478004 15:20605021-20605043 ATTACTTTCTAGATAAGGCCCGG + Intergenic
1123640010 15:22395362-22395384 ATTACTTTCTAGATAAGGCCCGG - Intergenic
1124816839 15:33002210-33002232 ATGCCTTTCTAGAATAAGAAGGG - Intronic
1125356182 15:38819318-38819340 ATGTCTTTCTGTGAAAGACAAGG + Intergenic
1126209834 15:46089336-46089358 ATGCCTTTCTTGAAATGGAAAGG + Intergenic
1126313500 15:47342883-47342905 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1127380708 15:58428474-58428496 ATGTCTTTCTAGTGATGGCAAGG + Intronic
1127555209 15:60081032-60081054 TTGTATTTTTAGAAAAGACAAGG + Intergenic
1127940582 15:63691291-63691313 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1128999108 15:72318659-72318681 GTATCTCTCTAGAAAGGGCAGGG + Intronic
1129429789 15:75491228-75491250 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1129622788 15:77164811-77164833 ATGCATTTCCTGAAAAGGCAAGG + Intronic
1130312770 15:82769671-82769693 ATGGGTTTCTAGACATGGCAGGG - Intronic
1130901516 15:88210205-88210227 ATGTTTTTCTTGAATAGGGAGGG + Intronic
1133061923 16:3180405-3180427 ATGGCTTTCTGGAATAAGCAGGG + Intergenic
1134237845 16:12481705-12481727 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1135326389 16:21528468-21528490 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1135423503 16:22320432-22320454 TTGTATTTTTAGAAGAGGCAGGG + Intronic
1136036289 16:27543093-27543115 GTGTCTTTCTTGACCAGGCATGG + Intronic
1136332417 16:29589016-29589038 ATGTCTTTAAAAAAAAGGCGGGG + Intergenic
1136447114 16:30329109-30329131 ATGTCTTTAAAAAAAAGGCGGGG + Intergenic
1137024733 16:35461172-35461194 TTGTATTTTTAGAAGAGGCAGGG + Intergenic
1137066037 16:35844371-35844393 ATGACTTTCTGGAAAAGAAATGG - Intergenic
1137255779 16:46774117-46774139 TTGTATTTCTAGTAAAGACAGGG + Intronic
1137643029 16:50049819-50049841 TTGTATTTTTAGAAAAGACAAGG + Intergenic
1137715617 16:50596603-50596625 TTTTCTTTCAAGAAAATGCAGGG + Intronic
1137905354 16:52316228-52316250 ATGACTTTCTAGATATGGCAAGG + Intergenic
1139037550 16:62965936-62965958 CTGACTTTCTAGAAAAGGGGCGG + Intergenic
1139217888 16:65147005-65147027 ATGTATTTCTAGAAATGGCTGGG + Intergenic
1139867964 16:70078809-70078831 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1140287951 16:73622382-73622404 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1140598976 16:76451649-76451671 ATGAGTTTCTAGAAACTGCAAGG + Intronic
1141858311 16:86700039-86700061 ATATCTTTCTTTAAAAGGCTGGG + Intergenic
1143995076 17:10999243-10999265 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1144162212 17:12570746-12570768 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1144644934 17:16966079-16966101 TTGTATTTCTAGTAAAGACAAGG - Intronic
1145890938 17:28415279-28415301 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1145892607 17:28427936-28427958 TTGTATTTTTAGAAGAGGCAGGG - Intergenic
1146614899 17:34348505-34348527 AGGTTCTTCTGGAAAAGGCATGG + Intergenic
1147056300 17:37837960-37837982 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1148776887 17:50101032-50101054 ATGTGCTTCCAGAAAATGCAGGG + Intronic
1149104897 17:52951085-52951107 ATGTCTCTCACTAAAAGGCAGGG + Intergenic
1149812095 17:59685720-59685742 ATGTCGTCCTAGAAACTGCATGG + Exonic
1149940849 17:60864130-60864152 ATGTTTTTCTTGGAAAGGGATGG + Intronic
1150353354 17:64462796-64462818 ATGTATTTTTAGTAAAGACAGGG + Intronic
1151300716 17:73223143-73223165 TTGTATTTTTAGTAAAGGCAAGG - Intronic
1152142263 17:78543595-78543617 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1153411447 18:4798317-4798339 CTGTGTGTCTAGAAAAGGAAGGG - Intergenic
1153757541 18:8299412-8299434 TTGTCTTTTTAGTAGAGGCAGGG - Intronic
1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG + Intergenic
1154038943 18:10834735-10834757 CAGGCTTCCTAGAAAAGGCAGGG + Intronic
1154142912 18:11841471-11841493 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1154208611 18:12359564-12359586 TTGTATTTCTAGTAGAGGCAGGG - Intronic
1155029481 18:21971790-21971812 ATGCTTTTTTAGAGAAGGCAGGG - Intergenic
1155799868 18:30088048-30088070 ATGTCTTGCTGGAAAACTCAAGG + Intergenic
1155878516 18:31115972-31115994 AAGTCATTTTACAAAAGGCATGG + Intergenic
1155898464 18:31358671-31358693 ATGTCTTTCCAAAATAGTCATGG - Intergenic
1156795018 18:41034246-41034268 ATGTTATTTTTGAAAAGGCAAGG - Intergenic
1156831567 18:41498173-41498195 ATGACATTCAGGAAAAGGCAAGG - Intergenic
1157756856 18:50226285-50226307 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1157866266 18:51187858-51187880 ATGTGTTTCTATAAAATGAAAGG - Intronic
1158188888 18:54803086-54803108 ATGTATATCTAGAAGAGGAAAGG + Intronic
1158762431 18:60405494-60405516 ATGTTCTTTTAGAAAAAGCAGGG + Intergenic
1159738716 18:72137508-72137530 ATCTCTTTGTAGAAAAGCAAGGG - Intergenic
1160098623 18:75900011-75900033 ATCTTTTTCTATAAAGGGCAAGG - Intergenic
1160262929 18:77312438-77312460 ATGCCTTTCTAGAAGAGTGAAGG + Intergenic
1160334929 18:78030345-78030367 TTGTCTTGTAAGAAAAGGCAGGG + Intergenic
1161198105 19:2998448-2998470 TTGTATTTTTAGAAGAGGCAGGG + Intronic
1161654986 19:5508681-5508703 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1162279373 19:9683110-9683132 ATTTCTTTTTAGTAAAGACAGGG + Intergenic
1162414076 19:10523925-10523947 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1162484109 19:10948178-10948200 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1162878982 19:13643268-13643290 GTGACTTTCTAGAGAAGGCAAGG - Intergenic
1163096089 19:15058137-15058159 ATGGCTTTCTGGAAAAAGTAGGG - Exonic
1163158386 19:15451025-15451047 ATGTCTGCCTAGAAAAGGCCTGG - Intergenic
1163294327 19:16402480-16402502 ATGTCTTTGTTGCACAGGCAAGG - Exonic
1163389670 19:17022669-17022691 TTGTCTTTTTAGTAGAGGCAGGG + Intronic
1164454866 19:28398577-28398599 ATGCCTTTCTAGGAAAAGCAGGG - Intergenic
1164637132 19:29799767-29799789 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1164779934 19:30884139-30884161 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1164818550 19:31225952-31225974 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1165741847 19:38209592-38209614 ATGTCTTTTTCCAAAAGGCGTGG + Intergenic
1166235637 19:41453868-41453890 ATGTCTTTAAAGAAAAGTCCAGG + Intergenic
1166374640 19:42320799-42320821 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1166793755 19:45413901-45413923 CAGGCTTTCTAAAAAAGGCAAGG + Intronic
1167157287 19:47746673-47746695 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1167870212 19:52362620-52362642 ATATCTTGATAGAAAAGGAAAGG - Intronic
1167983528 19:53296582-53296604 ATGATTTTCTGGAAAAGGAAAGG + Intergenic
1167992425 19:53371675-53371697 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1168335370 19:55594214-55594236 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1168415548 19:56165632-56165654 TTGTATTTCTAGTAAAGACAGGG - Intergenic
925295080 2:2770943-2770965 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
926241141 2:11086747-11086769 TTGTCTTTTTAGTAGAGGCAGGG + Intergenic
927108012 2:19844322-19844344 ATGGCTCTCCAGCAAAGGCATGG - Intergenic
928017713 2:27673640-27673662 ATTTATTTTTAGTAAAGGCAAGG + Intronic
928397841 2:30956677-30956699 ATGTATTTGTAGTAAAGACAAGG + Intronic
928984867 2:37171062-37171084 TTGTATTTTTAGTAAAGGCAGGG - Intronic
929077270 2:38088294-38088316 TTGTATTTTTAGTAAAGGCAGGG + Intronic
930000415 2:46857525-46857547 TTGTATTTTTAGAAGAGGCAGGG - Intronic
930129046 2:47829411-47829433 ATGTATTTCTAGTAGAGACAGGG + Intronic
930643158 2:53875272-53875294 AGGTCTCTCTAGAAAAGACCAGG + Intronic
931865939 2:66411933-66411955 ATCTCTATGTAGAAAAAGCAAGG - Intergenic
932544605 2:72694806-72694828 ATGTCTTGCTACAAATGGAAGGG - Intronic
933302108 2:80553042-80553064 TTGTCTTTTTAGTAAAGACAGGG - Intronic
933904341 2:86875038-86875060 CTTTATTTTTAGAAAAGGCATGG + Intergenic
935254305 2:101295485-101295507 TTGTATTTTTAGTAAAGGCAGGG - Intronic
935625304 2:105167649-105167671 ATGACATTCTAGAAAGAGCAGGG + Intergenic
936023758 2:109015583-109015605 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
936046538 2:109192569-109192591 ATTTCTGTCTTGAAACGGCATGG + Intronic
936367897 2:111877108-111877130 CTTTATTTTTAGAAAAGGCATGG - Intronic
936853242 2:116927207-116927229 ATGACATTCTGTAAAAGGCAAGG + Intergenic
937309763 2:120894869-120894891 TTGTATTTTTAGTAAAGGCAGGG + Intronic
938499705 2:131824460-131824482 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
939404769 2:141742424-141742446 TTGTCTTTTTAGTAGAGGCAGGG + Intronic
939459358 2:142479393-142479415 TTGTATTTTTAGGAAAGGCAAGG + Intergenic
940384566 2:153055597-153055619 ATGTCTTACTTTAAAAAGCAAGG - Intergenic
942207244 2:173631387-173631409 ATGTTTTCCCAGAAAAGGAAGGG - Intergenic
942236415 2:173911988-173912010 TTGTCTTTCTAGGAGAGACACGG + Intronic
942480536 2:176383237-176383259 ATGTCTTTCTACTTTAGGCAAGG + Intergenic
942974349 2:181997053-181997075 TTGTATTTCTAGTAAAGACAGGG - Intronic
943027378 2:182646273-182646295 ATGTATTTTTAGTAAAGACAGGG - Intergenic
944052198 2:195482968-195482990 ATGACTTTATATAAAAGGCCTGG + Intergenic
944238015 2:197457792-197457814 TTGTATTTTTAGTAAAGGCAGGG + Intronic
944427524 2:199598881-199598903 TTGTATTTCTAGTAGAGGCAGGG - Intergenic
944767966 2:202883983-202884005 TTGTATTTTTAGTAAAGGCAGGG + Intronic
944986897 2:205187661-205187683 ATGGCTTTGCAGAAAAGGGAAGG - Intronic
945104810 2:206299933-206299955 TTGTATTTTTAGTAAAGGCAGGG - Intronic
945459044 2:210083121-210083143 ATGTCTTACAAGGAAAGTCAAGG + Intronic
945845901 2:214944237-214944259 TTGTATTTTTAGTAAAGGCAGGG - Intronic
945877050 2:215288961-215288983 TTGTGTTTTTAGTAAAGGCAGGG - Intergenic
946573250 2:221047304-221047326 TACTCTTTCTAGAAAAGGGAAGG - Intergenic
946891816 2:224284439-224284461 ATGTCTTTGCAGACAAGCCAAGG - Intergenic
947072526 2:226306460-226306482 TTGTATTTCTAGCAAAGACAGGG - Intergenic
947221191 2:227794255-227794277 ATGTCTTTCTTGGCCAGGCACGG + Intergenic
947830791 2:233140091-233140113 ATGGCTTCCTGGAAAGGGCAGGG - Intronic
948876210 2:240830766-240830788 TTGTATTTCTAGTAAAGACAGGG - Intergenic
948952963 2:241266700-241266722 AGGTACTTCTAGAAAGGGCATGG + Intronic
1168826452 20:817672-817694 TTGTCTTTTTAGTAGAGGCAGGG - Intergenic
1169781795 20:9317924-9317946 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1170677801 20:18498521-18498543 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1171115681 20:22523030-22523052 CTTTCTTTCTAGAAAAGCCTTGG + Intergenic
1171340902 20:24427982-24428004 ATGACATTCTGGAAAAGGCTAGG + Intergenic
1172437179 20:34937682-34937704 ATGTATTTCTTAAAGAGGCAGGG + Intronic
1172701676 20:36857040-36857062 CTCTCTTTGTAGAAGAGGCAGGG + Intronic
1172797270 20:37549415-37549437 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1173329761 20:42065354-42065376 GTGTATTTCTAGTAAAGTCATGG - Intergenic
1173454334 20:43190692-43190714 CTGTCTCCCTAGAAAAGGAAAGG - Intergenic
1173491805 20:43488732-43488754 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1174305251 20:49610418-49610440 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1176067168 20:63204069-63204091 ATGCCTCTCTAGAACTGGCAAGG + Intronic
1179381601 21:40904196-40904218 AGGTCCTGCTAGAAAAGGGAGGG - Intergenic
1181304631 22:21908317-21908339 TTGTCTTTCTCAACAAGGCAGGG - Intergenic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1183685083 22:39357083-39357105 GTGTATTTTTAGTAAAGGCAGGG - Intronic
1183928481 22:41222745-41222767 TTGTATTTCTAGTAAAGACAGGG - Intronic
1184182013 22:42835645-42835667 TTGTATTTTTAGTAAAGGCAAGG - Intronic
949595426 3:5539266-5539288 TTGTATTTCTAGTAAAGACAAGG - Intergenic
950179712 3:10902556-10902578 ATGTCTTTCTTTCACAGGCAAGG + Intronic
950924602 3:16727938-16727960 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951647268 3:24906668-24906690 TTGTATTTTTAGAAAAGACAGGG - Intergenic
952990939 3:38830103-38830125 ATGTCTTCCTGACAAAGGCATGG + Intergenic
953262878 3:41357307-41357329 ATATCTTTCTTGAGGAGGCAAGG - Intronic
953489298 3:43334764-43334786 TTGTATTTTTAGTAAAGGCAAGG + Intronic
954062775 3:48082627-48082649 TTGTATTTTTAGTAAAGGCAGGG - Intronic
955002318 3:54938821-54938843 ATATGATTCTAGAAAAGTCAGGG + Intronic
957271829 3:78040242-78040264 TTTTTTTTCTATAAAAGGCAAGG - Intergenic
957709202 3:83832996-83833018 ATCAGTTTCTAGAAAATGCAAGG + Intergenic
957724799 3:84050001-84050023 ATGTCATTTTAGAAAAGCGAAGG - Intergenic
958580342 3:96010558-96010580 ATGTATATCCAGAAAATGCATGG + Intergenic
959576679 3:107941780-107941802 GTTTCTTTTTAGCAAAGGCAGGG - Intergenic
960772154 3:121206635-121206657 GTGTATTTCTAGCAGAGGCAGGG - Intronic
962485169 3:135835398-135835420 ATGACTTTCTGGAAAAGGAAAGG - Intergenic
962568391 3:136687697-136687719 TTGTCTTTCTAGAAAAATGAAGG + Intronic
963576623 3:147068406-147068428 ATGTCCTTTTAGAAGAGGGAAGG - Intergenic
964733873 3:159895866-159895888 TTGTATTTTTAGTAAAGGCAGGG + Intronic
964789818 3:160443110-160443132 TTTTTTTTCTAAAAAAGGCAGGG - Intronic
964819340 3:160754330-160754352 TTGTATTTTTAGAAAAGGAATGG + Intergenic
965536112 3:169825178-169825200 ATGTATTTTTAGTAGAGGCAGGG + Intronic
965738934 3:171852371-171852393 TTGTATTTCTAGTAAAGACAGGG + Intronic
966282137 3:178244148-178244170 ATTTCATTCTAGAAATGGCAAGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967219524 3:187236914-187236936 CTGCCTTTCTAGAGAAGGAAGGG - Intronic
967783838 3:193468573-193468595 TTGTATTTTTAGAAAAGACAGGG - Intronic
968242943 3:197108526-197108548 ATGTCTTTCTAGAAATGTATTGG + Intronic
968869134 4:3232581-3232603 GAGTCTTTCTAGAAAAGCCTGGG - Intronic
970630251 4:17934915-17934937 AAGTCTTTCTAAAAAACGGAGGG + Intronic
970980627 4:22092518-22092540 TTGTTTTTACAGAAAAGGCACGG + Intergenic
971157119 4:24095287-24095309 TTGTATTTTTAGCAAAGGCAGGG + Intergenic
971945503 4:33271045-33271067 ATGAATTTCTAGAAATGTCATGG + Intergenic
972261716 4:37415528-37415550 TTGTATTTTTAGTAAAGGCAGGG - Intronic
972522223 4:39869932-39869954 TTGTGTTTTTAGAAGAGGCAGGG - Intronic
973555950 4:52083217-52083239 AACTCTTTCTAGGAAAGGCAGGG - Intronic
974248012 4:59347353-59347375 ATGACTTGTTAGAAACGGCAAGG - Intergenic
974355305 4:60805103-60805125 ATGTCTTTGTAGGTAAAGCATGG + Intergenic
974585894 4:63876587-63876609 CAGTGATTCTAGAAAAGGCAAGG + Intergenic
974969061 4:68802932-68802954 TAGTCTTTCTAGAAAAGCCGAGG - Intergenic
976244722 4:82995667-82995689 TTGTATTTTTAGTAAAGGCAGGG + Intronic
976732390 4:88277180-88277202 ATCTATTTCTAGAAAAGCCAAGG + Exonic
976787759 4:88841319-88841341 TTGTATTTCTAGTAAAGACAGGG - Intronic
977601289 4:98936435-98936457 ATGTATTTTTAGTAAAGACAGGG - Intergenic
978093143 4:104742389-104742411 ATGTTTTTAGAGAAAAAGCAAGG - Intergenic
978137551 4:105281049-105281071 ATGTCTTTCCAGGAGAGGCAAGG - Intergenic
978804051 4:112782218-112782240 ATGTGTTTCTGGAAAGGGGATGG + Intergenic
979877288 4:125909307-125909329 ATGACTTTATAGAAAAGAAAAGG - Intergenic
979900646 4:126212949-126212971 ATGTTCATCTAGACAAGGCAAGG - Intergenic
979965720 4:127074591-127074613 AATTCTTTCAGGAAAAGGCAAGG - Intergenic
981847161 4:149182626-149182648 ATATCTTCCTAGACATGGCAGGG - Intergenic
982664107 4:158240057-158240079 TTGTATTTTTAGTAAAGGCAGGG + Intronic
983976503 4:173940893-173940915 AAATCTTTCTAGAAAACTCATGG + Intergenic
984115399 4:175674347-175674369 TTGTCTTTTTAGAAGAGGCAGGG + Intronic
985049706 4:185976869-185976891 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
985313885 4:188633358-188633380 ATGACTTTTAAGAAAAGGAAAGG + Intergenic
985473115 5:58677-58699 ATGACTTTCCAGAAATGGCCAGG + Intergenic
986071060 5:4283749-4283771 TTGTCCTTCTAAAGAAGGCAAGG + Intergenic
986726666 5:10603137-10603159 AACTCTTTCTAGAAAAGGATGGG + Intronic
988475352 5:31580099-31580121 ATGACATTCCAGAAAAGGCAGGG + Intergenic
988475866 5:31585089-31585111 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990374785 5:55158654-55158676 ATGTGTTTCCAGAAAGTGCAGGG - Intronic
990502437 5:56409994-56410016 ATGTCATTCCAGTAAGGGCACGG - Intergenic
991218137 5:64180326-64180348 ATTTGTTTGTAGATAAGGCAGGG + Intronic
991580577 5:68151004-68151026 TTGTATTTCTAGAAGAGACAGGG + Intergenic
993747994 5:91625657-91625679 ATGTCTTTATAAAAGAGGCCAGG + Intergenic
994639662 5:102391310-102391332 AAGTCTTTCCAGCAAAGGAATGG - Intronic
995035699 5:107531741-107531763 ATGTCTTTATTGAAAAGGCAAGG - Intronic
995397868 5:111707271-111707293 ATTTCTTTATAGGAAAGGTAAGG + Intronic
996075509 5:119187833-119187855 TTGTATTTTTAGTAAAGGCAGGG + Intronic
996159287 5:120143256-120143278 ATTCCATTCTAAAAAAGGCAGGG + Intergenic
997478476 5:134163922-134163944 CTGCCTTTTTAGGAAAGGCAAGG - Intronic
998690081 5:144578152-144578174 CAGTTTTTGTAGAAAAGGCAGGG + Intergenic
999172668 5:149608543-149608565 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1000067816 5:157711577-157711599 AATACTTTTTAGAAAAGGCAAGG - Intergenic
1000403303 5:160856411-160856433 TTGTCTTTGTAGAAAATCCAAGG - Intergenic
1000426617 5:161098485-161098507 ATATGTTTCAACAAAAGGCACGG - Intergenic
1000583206 5:163059407-163059429 ATGACTTTGTTCAAAAGGCAGGG - Intergenic
1000911276 5:167025667-167025689 ATGTCTGTCTATAAAACTCAAGG - Intergenic
1000941706 5:167370037-167370059 ATTTCTCTCTAAAAAAGGCATGG + Intronic
1001061094 5:168489352-168489374 ATGTTTTTTTAAAAAAGGCATGG - Intronic
1001169186 5:169402367-169402389 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1001269602 5:170301467-170301489 TTGTATTTCTCGTAAAGGCAAGG - Intergenic
1001538608 5:172520400-172520422 ATGACATTCTGGAAAAGACAAGG + Intergenic
1001559671 5:172660810-172660832 TTGTATTTTTAGCAAAGGCAGGG + Intronic
1001625765 5:173131903-173131925 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1002569758 5:180133461-180133483 GTGTCTTTCTGTAAAAGGGAGGG - Intronic
1002625404 5:180523957-180523979 ATGTCTTTCTAATAAATACAAGG + Intronic
1003453383 6:6258530-6258552 AGGTGTTTCTAGAAAGAGCATGG - Intronic
1004506543 6:16251396-16251418 TTGTATTTCTAGTAAAGACAGGG - Intronic
1004651218 6:17611277-17611299 AAGTATTTCTAGCAAAGGAAGGG + Exonic
1005295427 6:24421102-24421124 ATGTATTTAGAGAAAAGACAGGG - Intronic
1005917093 6:30362378-30362400 ATGTATTTTTATAAAAGACAAGG + Intergenic
1006819790 6:36883716-36883738 ATGTCTTTCTAGAAGAGTGAAGG - Intronic
1007580874 6:42959236-42959258 TTGTATTTTTAGAAGAGGCAGGG - Intergenic
1008122214 6:47631751-47631773 ATGTCTCTTTAGATAAGGAAAGG - Intergenic
1008290977 6:49715770-49715792 ATGCCCTTCTAGAAAAGCAAAGG - Intergenic
1008334651 6:50287270-50287292 TTGTATTTCTAGTAAAGTCAGGG + Intergenic
1008698523 6:54070496-54070518 TTTTGTTTCTGGAAAAGGCAAGG + Intronic
1008755041 6:54784881-54784903 TTGTCTTTGTAGAAAACCCATGG + Intergenic
1009444131 6:63719968-63719990 ATGTCTTACTATAAAAGATAAGG + Exonic
1010048454 6:71474892-71474914 ATGTTTTAGTAGAAATGGCATGG - Intergenic
1010539380 6:77071914-77071936 ATGTATATATAGAAAAAGCAAGG - Intergenic
1010828837 6:80506233-80506255 ATGTGTTTCTTAAAAAGTCACGG + Intergenic
1011467961 6:87678323-87678345 ATGTATTTTTAGTAGAGGCAGGG - Intronic
1011694522 6:89900010-89900032 ATGACATTCTGGAAAAGGCAAGG - Intergenic
1012065894 6:94552041-94552063 AAGTCATTCTGGAAAAGCCAAGG + Intergenic
1012768701 6:103401320-103401342 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1013245656 6:108284651-108284673 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1015493198 6:133852477-133852499 TTGTATTTTTAGAAAAGACAGGG - Intergenic
1016025231 6:139280078-139280100 TTGTATTTTTAGAAGAGGCAGGG - Intronic
1016806272 6:148215397-148215419 CAGTCATTCTAGAAAAGGAAAGG + Intergenic
1017574934 6:155791689-155791711 ATTTCTTCCTAGATAAGGAATGG - Intergenic
1018097760 6:160407024-160407046 CTGTCTTTCTCAAAAAGGTATGG + Exonic
1018166811 6:161105564-161105586 ATGGCTTCCTAGAAGAGGCGTGG + Intronic
1018623252 6:165751767-165751789 ATAACTTTCTAGGAAAGGGATGG - Intronic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020163760 7:5792670-5792692 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1021230453 7:18081406-18081428 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1022601230 7:31762180-31762202 TTGTATTTCTACAAAAGGAAAGG - Intronic
1022708306 7:32827478-32827500 ATTACATTCTAGAAAAGTCATGG + Intergenic
1022781690 7:33591499-33591521 AAGTCCTTCTGGAAAAGGAAGGG - Intronic
1022876415 7:34536561-34536583 ATGGCTTTCTATAATTGGCAAGG + Intergenic
1022950708 7:35335407-35335429 CTTTCATTCTAGAAAAGCCAGGG + Intergenic
1023930986 7:44706491-44706513 TTGTATTTCTAGTAAAGACAGGG + Intronic
1024177120 7:46851893-46851915 ATGTATATCTAGTAAAGACAGGG + Intergenic
1024802735 7:53099780-53099802 ATGACTTTCTGGAAAAGGAAGGG - Intergenic
1024951491 7:54865533-54865555 TTGTATTTTTAGTAAAGGCAAGG + Intergenic
1024963395 7:55001912-55001934 ATGTCTGCCTAGGAAAGACATGG + Intergenic
1025058594 7:55785208-55785230 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1025192821 7:56909238-56909260 TTGTATTTCTAGTAGAGGCAGGG - Intergenic
1025953518 7:66164852-66164874 ATGGCTTTCCAGAAAAAGCAGGG - Intergenic
1027126382 7:75559604-75559626 CTGTCTTTCTAGAAACAGCTAGG - Intronic
1027389926 7:77694766-77694788 ATGTATTTTTAGTAGAGGCAGGG + Intergenic
1027439207 7:78199724-78199746 ATGTATTTCTACAAAAGCTAGGG - Intronic
1027763688 7:82311756-82311778 ATGTCTTTCTAGTCAAAGCCTGG - Intronic
1027803263 7:82782353-82782375 ATTTTTTTCTGGAAAAGGAAGGG - Intronic
1027962968 7:84970318-84970340 ATGTCTACCTAGCAAGGGCATGG + Intergenic
1028051975 7:86199601-86199623 ATGTCTTTATAGAGAGTGCATGG + Intergenic
1028101462 7:86826001-86826023 ATGCCTTTTTAAAAAAGTCATGG + Intronic
1028110527 7:86935218-86935240 AGCTATTGCTAGAAAAGGCATGG - Intronic
1028297329 7:89150439-89150461 TTGTCTTGTTAGAAAAAGCATGG + Intronic
1028364365 7:90010469-90010491 ATGTCAGTTTAGGAAAGGCATGG + Intergenic
1028835069 7:95365764-95365786 ATGCCTTGCTGGAAGAGGCAAGG - Intronic
1029354461 7:100041359-100041381 AAGTCTTTCTAGAAATGTTAAGG - Exonic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030020602 7:105271646-105271668 ATGACTTATTAGAAAAGGCTTGG + Intronic
1030137868 7:106274961-106274983 ATGTCTTTAATGAAAAGGGATGG - Exonic
1030922231 7:115405892-115405914 ATGGCGTTCTGGAAAAAGCATGG - Intergenic
1031797403 7:126193528-126193550 TTTTATTTCTAGAAAGGGCAAGG - Intergenic
1032216528 7:129961679-129961701 ATGGCTTGGTAGAGAAGGCAAGG - Intergenic
1032512494 7:132482863-132482885 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1032686280 7:134237225-134237247 TTGTATTTTTAGTAAAGGCAGGG + Intronic
1032778565 7:135142555-135142577 CTGTCTTTGTAGAAAATGCAAGG + Intronic
1032938331 7:136759957-136759979 GTGCCTTTCTAGAAAAGGGAGGG + Intergenic
1033641786 7:143268691-143268713 AAGTCTTTCTAGAAAACCCCTGG + Intronic
1033822237 7:145148490-145148512 ATGTGGTTCTAGAAAAGTAAGGG - Intergenic
1034924999 7:155114111-155114133 ATGTCTGTCTAGACTGGGCACGG + Intergenic
1036135294 8:6154640-6154662 ATGTCTCCCTAGAGAAGACAGGG - Intergenic
1038054663 8:23847067-23847089 AGCTCTTTCTAGAAATGGAAGGG - Intronic
1038371385 8:26995376-26995398 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1038609109 8:29043022-29043044 TTGTCTTTCTAGAAAACAGATGG + Intronic
1038811138 8:30845690-30845712 ATGCCTTTCTAGGAAAAGTATGG - Exonic
1039488535 8:37930156-37930178 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1040036390 8:42874567-42874589 TTGTATTTTTAGTAAAGGCAGGG - Intronic
1040905590 8:52466823-52466845 ATGTATTTATAGAATAGCCACGG - Intergenic
1042843138 8:73144836-73144858 ATGAAATTCTAGAACAGGCAAGG - Intergenic
1042893545 8:73640742-73640764 ATGTATTTCTAGATGAGGCAGGG - Intronic
1043005053 8:74808575-74808597 ATGTCTTTATGTAACAGGCAAGG + Intronic
1043174929 8:77013283-77013305 AGCTCTGTCTAGAAAATGCATGG - Intergenic
1043736724 8:83757338-83757360 ATATCTTTATAGAAAATGCCAGG - Intergenic
1043844141 8:85144634-85144656 TTGTATTTTTAGCAAAGGCAGGG + Intronic
1044208748 8:89523622-89523644 CTGTGTTTTTAGTAAAGGCAGGG + Intergenic
1044883570 8:96750020-96750042 ATATATTTATAGAAAAGGAAAGG + Intronic
1044991013 8:97795885-97795907 ATCTCTTCCTAGACAATGCAAGG + Intronic
1045554096 8:103198476-103198498 TTGTCTTTGGGGAAAAGGCAGGG - Intronic
1045987024 8:108260836-108260858 ATGTTTTTCCAGAAGAGACAAGG + Intronic
1046296834 8:112230614-112230636 ATGTATTTCTAGTAGAGACAGGG - Intronic
1047792119 8:128214256-128214278 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1048056614 8:130872927-130872949 ATGTCTTTCAAGATAATTCAGGG - Intronic
1048708254 8:137178867-137178889 GTGTTTTTCTTCAAAAGGCAGGG + Intergenic
1049135340 8:140892980-140893002 ATGTCTACCTAGAAATGGAATGG - Intronic
1050595527 9:7200764-7200786 AATTCGTTTTAGAAAAGGCATGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051846029 9:21452145-21452167 TTGTATTTCTAGTAAAGACAGGG - Intergenic
1055871262 9:80882777-80882799 ATGTCTTTCTGTTAAAGGAAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056313550 9:85367221-85367243 AAATCATTCTAGAGAAGGCAAGG + Intergenic
1056445053 9:86657406-86657428 ATGACATTCTGGAAAAGGTAAGG - Intergenic
1057041596 9:91852244-91852266 TTGTCTATTTAGAAAATGCAAGG - Intronic
1057615366 9:96584826-96584848 TTGTCTTTTTAGTAGAGGCAGGG + Intronic
1058218064 9:102259719-102259741 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1058895368 9:109396285-109396307 ATGTCTTTCTGGAAGGGTCAGGG + Intronic
1058913043 9:109538743-109538765 CTGTTTTTCTAGAACTGGCAAGG - Intergenic
1059018522 9:110547824-110547846 ATGTCTTTCCAGTAAAAACAGGG + Intronic
1059876335 9:118639479-118639501 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1060229476 9:121815984-121816006 ATGTCTGTCGAGAAAAGGAAGGG - Intergenic
1060938351 9:127528780-127528802 TGCTCTTTCTAGAAAAGACAGGG - Intronic
1185512115 X:671402-671424 TTGTATTTTTAGAAAAGACAGGG + Intergenic
1185514133 X:686180-686202 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1186296365 X:8153525-8153547 TTGTGTTTTTAGTAAAGGCAGGG + Intergenic
1186844084 X:13513609-13513631 TTGTATTTTTAGTAAAGGCAGGG + Intergenic
1188043339 X:25396472-25396494 ATGTTTTACTTGAGAAGGCAGGG + Intergenic
1188653103 X:32655962-32655984 ATGTTTTTCAAAAAAAGGCAGGG - Intronic
1188803077 X:34555539-34555561 ATGCCTTTCTAGAAAAGTCAAGG - Intergenic
1189387688 X:40550792-40550814 TTGTTTTTAAAGAAAAGGCATGG + Intergenic
1190192559 X:48289861-48289883 AATTCATTCTAGAACAGGCATGG + Intergenic
1192399784 X:70823634-70823656 ATGTCTTTTTTGGAATGGCAGGG - Intronic
1193253727 X:79323033-79323055 TTGTGTTTTTAGTAAAGGCAGGG + Intergenic
1193766850 X:85540110-85540132 ATGTTTTACTAGAAAAGCCAGGG - Intergenic
1195350774 X:103994782-103994804 ATGCCTTTCTAGCAAAGCCTTGG - Intergenic
1195393404 X:104386393-104386415 TTGTATTTTTAGTAAAGGCAGGG - Intergenic
1196075386 X:111569848-111569870 ATGTCTGTATAGGAAGGGCATGG + Intergenic
1196464109 X:115956018-115956040 ATGCCTTTCTAGAAGAGTGAAGG - Intergenic
1196595195 X:117537777-117537799 ATTTTTTTTTAGAAAAGGGAGGG - Intergenic
1197193528 X:123675466-123675488 TTGTCTTTATAGTAAAGACAGGG - Intronic
1197412525 X:126137168-126137190 CTGTCTTGCTAGAAAGGTCAAGG - Intergenic
1197570925 X:128149376-128149398 AGGTCTTTCTGGGAAAGGGAAGG + Intergenic
1198448423 X:136741717-136741739 AAATCATTCTAGAGAAGGCAAGG + Intronic
1198460186 X:136855925-136855947 TTGTATTTCTAGTAAAGGCGGGG - Intronic
1198999334 X:142615652-142615674 AGGACTTTCTAGAAAAAGCTGGG - Intergenic
1202033940 Y:20611920-20611942 AAGTGTTTCTAGCAAAGGAAGGG + Intergenic
1202333728 Y:23782707-23782729 TTGTATTTCTAGTATAGGCAGGG + Intergenic
1202537042 Y:25887356-25887378 TTGTATTTCTAGTATAGGCAGGG - Intergenic