ID: 921589326

View in Genome Browser
Species Human (GRCh38)
Location 1:216985317-216985339
Sequence CCACCTCCACGCACTGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921589319_921589326 0 Left 921589319 1:216985294-216985316 CCAGAAGATGTGCCTTTCCCAAC 0: 1
1: 0
2: 2
3: 12
4: 133
Right 921589326 1:216985317-216985339 CCACCTCCACGCACTGGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 146
921589318_921589326 23 Left 921589318 1:216985271-216985293 CCTCTGGTAAAGGAATTCTTTAG 0: 1
1: 0
2: 2
3: 10
4: 130
Right 921589326 1:216985317-216985339 CCACCTCCACGCACTGGAAGAGG 0: 1
1: 0
2: 0
3: 8
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921589326 Original CRISPR CCACCTCCACGCACTGGAAG AGG Intronic
900183158 1:1321234-1321256 CCACCCCTACTCACAGGAAGGGG + Intronic
901057559 1:6455768-6455790 CCAGCACCACGCGGTGGAAGAGG - Intronic
901631220 1:10649119-10649141 CCTCCACCACGCAGTGGAAGTGG + Exonic
902076502 1:13790852-13790874 CCACCACCACTCAGAGGAAGCGG - Intronic
902476802 1:16692710-16692732 CCAGCACCACGCGGTGGAAGAGG + Intergenic
903641461 1:24863050-24863072 CCACCTCGAGGGACTGGAAGTGG - Intergenic
907048056 1:51312051-51312073 CCAGCTCCAGGCCCAGGAAGGGG - Intronic
910037048 1:82801165-82801187 CCTTCTCCACCCACTGAAAGAGG - Intergenic
910776910 1:90886188-90886210 ACACCTCCACACCCTGGCAGTGG + Intergenic
912309553 1:108606551-108606573 CCACCTCCCCCAACTGTAAGAGG + Intronic
914203764 1:145509099-145509121 CCACCTTCAAGAGCTGGAAGAGG + Intergenic
914482887 1:148082253-148082275 CCACCTTCAAGAGCTGGAAGAGG + Intergenic
915691973 1:157698803-157698825 CCACCTCCAGGAAATGGATGAGG - Intronic
917212315 1:172643583-172643605 CCTGCTCCACACACAGGAAGGGG - Intergenic
920123413 1:203675454-203675476 CCCCCTCCAGGCCCTGGATGAGG + Intronic
921589326 1:216985317-216985339 CCACCTCCACGCACTGGAAGAGG + Intronic
922423678 1:225475442-225475464 CCACCTCCAAGGACTCGATGGGG + Intergenic
1063355232 10:5392953-5392975 CCACCTCCAGGAAAGGGAAGTGG + Intergenic
1063665996 10:8061002-8061024 CCACCTCCACCCCCTGCAAAAGG - Intronic
1063960440 10:11301554-11301576 CCACCTCCCCTCACTGGAACGGG - Intronic
1067063357 10:43089518-43089540 CCACCTGCACGCCTTGGGAGAGG - Intronic
1069137863 10:64786175-64786197 CAAACTCCACTCACTGGAACTGG - Intergenic
1069828862 10:71270689-71270711 CCAGCAGCACGGACTGGAAGTGG + Intronic
1074055903 10:109923035-109923057 CCACCTCCCCGGACACGAAGAGG + Intronic
1075727189 10:124616673-124616695 CCCCCTCCACATGCTGGAAGTGG - Intronic
1076131052 10:128014192-128014214 TCCCCTCCAGGCACTGGCAGAGG + Intronic
1076256603 10:129031576-129031598 CTACCTCCCAGCACTTGAAGTGG + Intergenic
1078354497 11:10624030-10624052 GCACCTTCACGGACTGGGAGAGG - Intronic
1079444506 11:20546737-20546759 CCACCTCCACCCACTTCAAGTGG - Intergenic
1084096319 11:66913843-66913865 CCAGCCCCAGGCACTGGAGGAGG + Intronic
1086742094 11:90380427-90380449 CCACCTCCAGCCAAGGGAAGTGG - Intergenic
1089210323 11:116796149-116796171 CCACATCCAGCCACTGGAAAGGG + Intergenic
1091565660 12:1646144-1646166 CCACCTGCACGCTCTTGAACTGG - Exonic
1091625061 12:2115401-2115423 TCAGCTCCACGCAGCGGAAGCGG + Exonic
1091656696 12:2351454-2351476 CCACCTCCAGGGCCAGGAAGTGG - Intronic
1091696178 12:2629874-2629896 GCACCTCCACTCACTGATAGGGG - Intronic
1096464510 12:51840966-51840988 CCACCCCCATGCACGGGAAGGGG - Intergenic
1098191975 12:67958998-67959020 GCAACTCCACACTCTGGAAGAGG - Intergenic
1098346979 12:69515890-69515912 CCACCCCCACACACTGCAAAAGG + Intronic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1103451998 12:121035778-121035800 GCACCTCCACCCCCTGGGAGAGG + Intronic
1106183218 13:27385831-27385853 CCAGCTCCCCGAACTGTAAGAGG - Intergenic
1107119031 13:36778127-36778149 CCACCTCCAGCCAAGGGAAGCGG + Intergenic
1107508985 13:41062052-41062074 CCTCCCCCGCCCACTGGAAGCGG + Intronic
1109332271 13:60944431-60944453 CCACCGCCCCACACTGCAAGTGG + Intergenic
1110848001 13:80211698-80211720 CCACATCCACTCAATTGAAGTGG + Intergenic
1111021880 13:82460546-82460568 CCCCCTCCAAGCAGTGGGAGGGG + Intergenic
1111908456 13:94283176-94283198 CCACCTCCAGGTACTGTAAGGGG - Intronic
1113038205 13:106074524-106074546 CCACCTCCACGCAGTGGCTGGGG + Intergenic
1118699394 14:68418361-68418383 CCACCTACATGCTCTGTAAGAGG - Intronic
1120402937 14:84055359-84055381 CCACCTCCAGGAACAGGAAAGGG - Intergenic
1122527150 14:102395171-102395193 CCACCTCAACTCACTGTAGGCGG + Intronic
1124923232 15:34046850-34046872 CCACCTCCAGCCAAGGGAAGCGG + Exonic
1125353697 15:38794008-38794030 CCACCTCTATGAACTAGAAGTGG + Intergenic
1125356134 15:38818876-38818898 CCACCCCCACTCCCTGGCAGAGG + Intergenic
1130959778 15:88652160-88652182 CGACTTCCAGGCACTGAAAGAGG + Exonic
1131175763 15:90208658-90208680 CAAGCTTCACGGACTGGAAGGGG - Intronic
1131259428 15:90880908-90880930 CCTCCTCCCCGCTCTGGAACAGG + Exonic
1132537504 16:489983-490005 ACACCACCACGCGCTGGGAGAGG - Intronic
1133229245 16:4358718-4358740 CCACCTCCACTCCCTGAATGTGG + Intronic
1136049485 16:27640343-27640365 CCACCTCCACGCCCTTGCAAGGG - Intronic
1137619723 16:49868357-49868379 CCACCTCCCAGCGCTAGAAGCGG + Intergenic
1140871937 16:79114536-79114558 CCACCACCAGGAGCTGGAAGTGG + Intronic
1141064308 16:80901515-80901537 CCACCACCAGACACTGGGAGAGG + Intergenic
1146282618 17:31554791-31554813 CCCCCACCACTCACTGGATGTGG + Intergenic
1147635094 17:41959179-41959201 CCACCTGGATGCACTGGGAGTGG - Intronic
1150179322 17:63099228-63099250 ATACCTTCACTCACTGGAAGTGG - Exonic
1151123107 17:71814872-71814894 TCACCTCCATGGTCTGGAAGAGG - Intergenic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1152444293 17:80332087-80332109 CCACCTCCTCGAACTCGCAGAGG + Exonic
1152556664 17:81056526-81056548 CCACCGCAACCCACTGAAAGCGG - Intronic
1156881698 18:42088144-42088166 CCACCTCCTCCCACTGCAACTGG + Intergenic
1160745344 19:708832-708854 CCACCTCCCCGCGCTGCGAGCGG - Intergenic
1161594309 19:5143497-5143519 CCACCCCCAGACACAGGAAGTGG - Intronic
1161712222 19:5855299-5855321 CCACCTTCACCCACAGGGAGGGG + Intergenic
1162969353 19:14170760-14170782 CGACCACCACGCACTGGGTGCGG + Exonic
1163121770 19:15222737-15222759 TCAAGTCCAGGCACTGGAAGAGG - Intergenic
1163779824 19:19240310-19240332 CCACCTCCAGGCTGGGGAAGGGG + Intronic
1164846888 19:31439864-31439886 CCACCCCCACGCCCTGGAGCAGG - Intergenic
1165233887 19:34404942-34404964 GCACCTGCAGGCACTGGGAGCGG - Exonic
1166024287 19:40066378-40066400 CCACCTCCTCTCAGTTGAAGAGG - Intergenic
1167637335 19:50662486-50662508 CGAACTCCACGCCCTGGAGGTGG + Exonic
1202710817 1_KI270714v1_random:18534-18556 CCAGCACCACGCGGTGGAAGAGG + Intergenic
931005714 2:57848972-57848994 GCAGCTCCAGGCACTGGAATAGG + Intergenic
934737550 2:96697592-96697614 CCACCTCCCTGCACTGAATGGGG - Intergenic
936651051 2:114426279-114426301 CCAGCTCCAGTCACTGGAAAGGG + Intergenic
937249151 2:120512367-120512389 CCACCCCCAGGCCCTGGCAGGGG - Intergenic
948334162 2:237194490-237194512 AGACCCCCACGTACTGGAAGGGG - Intergenic
948858043 2:240739657-240739679 CCACCACCAGGAGCTGGAAGAGG + Intronic
949055809 2:241927807-241927829 CCACCTCCACTCACAGGAGAGGG + Intergenic
949055885 2:241928103-241928125 CCACCTCCACTCACAGGAGAGGG + Intergenic
949055958 2:241928370-241928392 CCACCTCCACTCACAGGAGAGGG + Intergenic
949055966 2:241928400-241928422 CCACCTCCACTCACAGGAGAGGG + Intergenic
949056075 2:241928813-241928835 CCACCTCCACTCACAGGAGAGGG + Intergenic
1168893245 20:1307682-1307704 GCACCTGCATGCACTGGGAGGGG + Exonic
1168972897 20:1942947-1942969 CCTCCTCCACCCATTGGAATCGG + Intergenic
1172641487 20:36442902-36442924 TCAACTCCATCCACTGGAAGTGG - Intronic
1173465762 20:43280011-43280033 CCACCACCACACACTGCTAGGGG - Intergenic
1179721032 21:43316171-43316193 CCACCTCCAAGCACAAGCAGGGG - Intergenic
1180259856 21:46661874-46661896 CCTCCTGCAGGCTCTGGAAGTGG - Exonic
1181512391 22:23394750-23394772 CCACCTCAAGGCGCAGGAAGGGG - Intergenic
1182831005 22:33304468-33304490 CCATCTGCAAGCACTGGGAGGGG - Exonic
1183653046 22:39169946-39169968 CCACCATCTCGCACTGGCAGTGG + Intergenic
950494222 3:13324162-13324184 CCACCTCCAGGGACTGACAGAGG + Intronic
954089104 3:48270786-48270808 CCACTCCCTCTCACTGGAAGTGG + Exonic
955107840 3:55916654-55916676 CAACCTACAAGCACTGGAATGGG - Intronic
956164491 3:66386110-66386132 CCACGTCCACGCGCAGGACGGGG - Exonic
958657115 3:97017240-97017262 CCACTTCCAGGGAATGGAAGAGG - Intronic
968433786 4:575054-575076 CGTCCTCCACGCGCTGGACGAGG - Intergenic
971225594 4:24748753-24748775 CCATCTCCACACACTGGGTGTGG - Intergenic
977696538 4:99972012-99972034 CCACCTCCACCTACAGGAACAGG + Intergenic
979333834 4:119445421-119445443 CCACCTCCACGACCAGGAAACGG + Intergenic
980855167 4:138431350-138431372 CCTCCTCCACCCAAGGGAAGTGG + Intergenic
985618376 5:938256-938278 ACACCTCCACGGACAGGCAGTGG - Intergenic
985660549 5:1155030-1155052 CCTCCTCAGCCCACTGGAAGCGG + Intergenic
986821696 5:11474264-11474286 CCACCTCCATGCACTGGACAAGG + Intronic
993658653 5:90603145-90603167 CCACCTCTACACACTGCAACTGG - Intronic
999327332 5:150651243-150651265 CCACCTCAGCGCAGTGGAACGGG + Exonic
999385399 5:151150712-151150734 CCCCCACCACACACTGGAAAGGG - Intronic
1000156661 5:158558981-158559003 CCACCTGAAGGCACTGGAAAAGG + Intergenic
1000829454 5:166084935-166084957 CCTCCTCCATGCTCTGGAAATGG + Intergenic
1001835306 5:174826318-174826340 GCTCCGCCAGGCACTGGAAGAGG + Intergenic
1002025282 5:176392633-176392655 CCATCTCCAGGCGCTGGGAGGGG - Exonic
1004298005 6:14431684-14431706 CCACCTCCAGGCACTGCAGATGG - Intergenic
1005275446 6:24211947-24211969 CCAGGGCCACGGACTGGAAGTGG + Intronic
1006789050 6:36686688-36686710 CCAGCTCAATGGACTGGAAGGGG + Exonic
1010547368 6:77174200-77174222 CCAGCTGCAGGCACTGGAATTGG - Intergenic
1019421385 7:952883-952905 ACACCTGCACCCACTGGGAGGGG + Intronic
1023140227 7:37094557-37094579 TCCCCTCCACCCACTGGATGGGG + Intronic
1023756938 7:43428033-43428055 CCACCTGCACCTAGTGGAAGGGG + Intronic
1024845004 7:53633084-53633106 CCCCTTGCACGCCCTGGAAGGGG - Intergenic
1024867601 7:53921465-53921487 CAACCTCCATGCTGTGGAAGGGG - Intergenic
1028206237 7:88020645-88020667 CCACCGCGATGCAGTGGAAGAGG - Intronic
1029655013 7:101918521-101918543 CACCCTCCACCCACTGGCAGTGG - Intronic
1031402888 7:121346365-121346387 CCACCTCCTGCCACAGGAAGAGG + Intergenic
1032047617 7:128622563-128622585 CCACCTCCACGGCCAGGAAACGG - Intergenic
1032845417 7:135747947-135747969 CCACCTCCTCACAAAGGAAGGGG - Intronic
1034330992 7:150282144-150282166 CCTCCACCGGGCACTGGAAGCGG - Intronic
1034667051 7:152827709-152827731 CCTCCACCGGGCACTGGAAGCGG + Intronic
1035531717 8:357726-357748 CCACCTGCACACACTGTCAGAGG - Intergenic
1036274597 8:7339351-7339373 CCGTTTCCACGCAATGGAAGTGG - Intergenic
1036346755 8:7970995-7971017 CCGTTTCCACGCAATGGAAGTGG + Intergenic
1037814091 8:22102808-22102830 GCACCACCACGCCCTGGAGGAGG - Exonic
1042465864 8:69129594-69129616 CCACCTCAACTCCCTGGAGGCGG + Intergenic
1043426708 8:80155303-80155325 CCACCTCAAATCACTGGAATAGG - Intronic
1049247395 8:141570103-141570125 CCACCCCCATGAACTTGAAGAGG - Intergenic
1058120896 9:101137506-101137528 CCACCTCCACCCAGAGGAACTGG - Intronic
1059620597 9:116000882-116000904 ACACCTCCAGACACAGGAAGGGG - Intergenic
1061004691 9:127921858-127921880 GCGCCTCCACCCACTGGCAGAGG + Exonic
1061293644 9:129665990-129666012 CCACCTCCTGGACCTGGAAGAGG + Exonic
1190561793 X:51693894-51693916 CCACCCCAACTCAATGGAAGGGG - Intergenic
1193347668 X:80423194-80423216 CCAGCTACAGCCACTGGAAGGGG + Intronic
1196022752 X:111007419-111007441 CCACTGCCACCCACTGGAAAGGG - Intronic
1197215043 X:123859822-123859844 CCACCTCCCCGAACCGGATGGGG - Intronic
1197527267 X:127578129-127578151 CCACCACCTGGCACTGGCAGAGG - Intergenic