ID: 921592409

View in Genome Browser
Species Human (GRCh38)
Location 1:217020101-217020123
Sequence ACCAGGACCTTTGTGATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 163}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921592409_921592416 14 Left 921592409 1:217020101-217020123 CCCTGAATCACAAAGGTCCTGGT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 921592416 1:217020138-217020160 TTTTGCTCAAATAAATAAGGAGG 0: 1
1: 0
2: 3
3: 29
4: 352
921592409_921592411 -9 Left 921592409 1:217020101-217020123 CCCTGAATCACAAAGGTCCTGGT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 921592411 1:217020115-217020137 GGTCCTGGTATTCCCTCACATGG 0: 1
1: 0
2: 0
3: 9
4: 107
921592409_921592417 30 Left 921592409 1:217020101-217020123 CCCTGAATCACAAAGGTCCTGGT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 921592417 1:217020154-217020176 AAGGAGGCATGAAATAATCCCGG 0: 1
1: 0
2: 4
3: 16
4: 224
921592409_921592415 11 Left 921592409 1:217020101-217020123 CCCTGAATCACAAAGGTCCTGGT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 921592415 1:217020135-217020157 TGGTTTTGCTCAAATAAATAAGG 0: 1
1: 0
2: 1
3: 17
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921592409 Original CRISPR ACCAGGACCTTTGTGATTCA GGG (reversed) Intronic
901285800 1:8077741-8077763 ACCAGAACCTTTCTTCTTCAAGG - Intergenic
902580596 1:17405117-17405139 ACTAGGATCTTTGTGGTTCCAGG + Intergenic
905410192 1:37763384-37763406 ACAAGGACCATTGTGATTATTGG + Intronic
906071989 1:43023702-43023724 ACAAGGACATTTGTGAGTGATGG + Intergenic
906335811 1:44929745-44929767 CCCAGGACATCAGTGATTCAAGG - Intronic
906405314 1:45537399-45537421 ACCATGATCTTTGTGAGTCAAGG + Intergenic
908036998 1:60066664-60066686 AAAAGAACATTTGTGATTCATGG - Intronic
908076041 1:60518873-60518895 ACAAGGGCATGTGTGATTCAGGG + Intergenic
912452055 1:109773303-109773325 ACGGTGACCTCTGTGATTCAAGG + Intronic
919668781 1:200319667-200319689 ACAAGGACCTTAGTTTTTCACGG + Intergenic
921269420 1:213453827-213453849 ACCTGGACCTGTGTTGTTCAAGG - Intergenic
921292098 1:213668104-213668126 TTAAGGACATTTGTGATTCATGG - Intergenic
921592409 1:217020101-217020123 ACCAGGACCTTTGTGATTCAGGG - Intronic
922167520 1:223128402-223128424 CCAAGGCCCTTTGTGATTGAGGG - Intronic
923286169 1:232497920-232497942 CCCTAGACCTTTGTGAGTCAGGG - Intronic
924210535 1:241762016-241762038 ATTAAGACATTTGTGATTCATGG - Intronic
1064310852 10:14210458-14210480 TCCAGGACCTCTGGAATTCAGGG - Intronic
1064416557 10:15155006-15155028 GCCAGGACCTGTATGCTTCATGG + Intronic
1064721278 10:18231691-18231713 TCCTGGATCTATGTGATTCAGGG + Intronic
1065077870 10:22098932-22098954 ACCAAGACCTCTGTAAGTCAGGG - Intergenic
1068597135 10:58914794-58914816 ACCTGGGCCAGTGTGATTCAAGG - Intergenic
1069316573 10:67111496-67111518 ACCAAGACCTTCATTATTCAAGG - Intronic
1070459084 10:76646762-76646784 ACCAGGACTTTTTTTTTTCAAGG + Intergenic
1070874437 10:79789481-79789503 ACCTGGCCCTCTTTGATTCAGGG - Intergenic
1071641361 10:87311639-87311661 ACCTGGCCCTCTTTGATTCAGGG - Intergenic
1072430608 10:95367819-95367841 ACCAGGACCTCTGGAAGTCAGGG + Intronic
1073681590 10:105710309-105710331 TTAAGGACATTTGTGATTCATGG + Intergenic
1074725407 10:116303147-116303169 CTGAGGACATTTGTGATTCATGG - Intergenic
1074905170 10:117855642-117855664 TCAAGAACATTTGTGATTCATGG - Intergenic
1075322534 10:121503686-121503708 ACCAAGACCTTTGTGGCTAAGGG + Intronic
1081557454 11:44178520-44178542 ACCACAACCTTTGTGAGTGAGGG - Intronic
1084468873 11:69343567-69343589 ACCAGGACCTTCCTCACTCAGGG - Intronic
1086471463 11:87117784-87117806 TTAAGGACATTTGTGATTCATGG - Intronic
1087641168 11:100755298-100755320 ACCCAGCCCATTGTGATTCAAGG - Intronic
1088266773 11:107995126-107995148 TTAAGGACATTTGTGATTCATGG - Intergenic
1090516016 11:127427851-127427873 TCCAGGTCCTCTGTTATTCAAGG - Intergenic
1091041577 11:132285840-132285862 ACCAGGATCTTTACAATTCAAGG + Intronic
1091064016 11:132491730-132491752 AGCAGGACCTTTGTGTATCTTGG - Intronic
1092643547 12:10543634-10543656 ACCAGGAGCTTCGATATTCAAGG - Intergenic
1095508834 12:42927351-42927373 ACCTGAAACTTTCTGATTCAAGG - Intergenic
1097367535 12:58734437-58734459 ACTAGGACCTTTATGATAGATGG - Intronic
1099354051 12:81611432-81611454 ACCAGGACATCCGTGGTTCATGG + Intronic
1099461502 12:82927184-82927206 TTCAGAACATTTGTGATTCATGG + Intronic
1099502852 12:83434957-83434979 TTCAGAACATTTGTGATTCATGG - Intergenic
1105065217 12:133191485-133191507 TCAGGGACCTTTGTCATTCATGG + Exonic
1105907238 13:24824061-24824083 ACCAAGACCATTGTCATTCTGGG + Intronic
1109254562 13:60063443-60063465 TCAAGAACATTTGTGATTCATGG - Intronic
1109953370 13:69532174-69532196 ACAAGAACTTTTGTGATTCATGG + Intergenic
1113419928 13:110163406-110163428 ACCAGGATCTTTGGGATAGAAGG - Intronic
1115013028 14:28573221-28573243 TTCAGAACATTTGTGATTCATGG - Intergenic
1119655554 14:76414226-76414248 ACCAGGGTTTTTGTGCTTCAGGG - Intronic
1120341808 14:83229772-83229794 AGCAGGTGCTTTGTCATTCATGG + Intergenic
1123976624 15:25559862-25559884 GCCAGTGCCCTTGTGATTCAGGG - Intergenic
1125710086 15:41777790-41777812 AACAGGAAATTTGTGATTCATGG + Intronic
1127572164 15:60254282-60254304 ACCAGGACATTTGTGTTTAAAGG - Intergenic
1128691841 15:69730580-69730602 AACAGGACTTTTCTGATTCGAGG + Intergenic
1132016770 15:98324722-98324744 AGCAGTGCCTTTGTTATTCATGG + Intergenic
1135508764 16:23062783-23062805 ACAAGGGCCCTTCTGATTCAAGG - Exonic
1136910924 16:34143490-34143512 TTAAGGACATTTGTGATTCATGG - Intergenic
1139280611 16:65767193-65767215 ACCATGAACTTTGTCCTTCAGGG + Intergenic
1141563750 16:84887339-84887361 CCCAGGCACTTTGTGGTTCAAGG - Intronic
1142000432 16:87661220-87661242 ACAAGGACCCTTGTGGTTCGGGG + Intronic
1142160393 16:88554574-88554596 ACGAGGACCTTTGTGGTTCAGGG + Intergenic
1146684627 17:34833077-34833099 ACCAGGACCTTTGGTTCTCATGG + Intergenic
1146772129 17:35578597-35578619 ACCAGGACCTCTGGGATGCCTGG + Exonic
1153766329 18:8378494-8378516 CCAAGGAACCTTGTGATTCAAGG - Intronic
1158790318 18:60772742-60772764 TTCAGAACATTTGTGATTCATGG - Intergenic
1159756696 18:72374649-72374671 GACAGGACCTCTGTGAATCAGGG - Intergenic
1166214063 19:41324368-41324390 TCTAGGACCTTTGTGATTCTAGG - Exonic
1167437767 19:49489835-49489857 ACCAGGACCTGTGGGAGACAAGG - Exonic
1168161852 19:54515735-54515757 CCCATGAGCTTTGTGATTCTTGG - Intergenic
928622610 2:33106313-33106335 ATTAGAACATTTGTGATTCATGG - Intronic
929973562 2:46608480-46608502 TTGAGGACATTTGTGATTCAAGG - Intronic
930165866 2:48203284-48203306 TCTGGGACTTTTGTGATTCAAGG - Intergenic
932493161 2:72134048-72134070 ACAAGAAGCTTTGTGATTTATGG - Intronic
932579580 2:72984720-72984742 ACCAGGACCTCTGTGACTGCAGG - Intronic
933546373 2:83717869-83717891 ACCATGAACTTTGTCCTTCATGG + Intergenic
934869872 2:97853622-97853644 AAAAGAACATTTGTGATTCATGG + Intronic
934925044 2:98376378-98376400 ACCAGGACCTGTGTGACTTCTGG - Intronic
935460281 2:103323278-103323300 TTCAGAACATTTGTGATTCATGG + Intergenic
937111868 2:119372830-119372852 CCCAGGACCTGTGTGAGGCAGGG + Intergenic
939974232 2:148697762-148697784 GCCAGGACCTTTGGGTTTTAGGG + Intronic
941219561 2:162759286-162759308 CCCAGGACCTGTGTGAGGCAAGG - Intronic
944231842 2:197403131-197403153 ATCAGGACTTTTGTTAATCAAGG + Intronic
946628965 2:221645582-221645604 AACAGGATTTTTGTGATTCAAGG - Intergenic
1171770251 20:29317755-29317777 TTAAGGACATTTGTGATTCATGG + Intergenic
1171784557 20:29450335-29450357 TTAAGGACATTTGTGATTCACGG - Intergenic
1171824341 20:29880392-29880414 TTAAGGACATTTGTGATTCACGG - Intergenic
1175169301 20:57068841-57068863 ACCATGACAGTTTTGATTCAAGG - Intergenic
1175665674 20:60857766-60857788 AGCAGGATCTCTGTGATTCTGGG - Intergenic
1175928895 20:62484383-62484405 AGCAGGGCCTTTGTGTTCCAGGG + Intergenic
1177289047 21:19086430-19086452 ACAAGGACACTTGTGATTTAGGG - Intergenic
1177917772 21:27111971-27111993 AGCAGGATCTTTTTTATTCAAGG - Intergenic
1178562513 21:33652220-33652242 ACCCAGACCTTTGTGGTTCTGGG + Intronic
1179934431 21:44593106-44593128 AGCAGGACCTGTGTGTTCCAGGG + Intronic
1180339690 22:11607875-11607897 TTAAGGACATTTGTGATTCACGG - Intergenic
1183234124 22:36604053-36604075 ATAAGAACATTTGTGATTCATGG + Intronic
953071169 3:39521361-39521383 ACCAGGACATTTTTTATACAGGG + Intronic
953174623 3:40538787-40538809 TTAAGGACATTTGTGATTCATGG + Intronic
953242860 3:41165339-41165361 ACCCGGTTCTTTGTGATTCCAGG + Intergenic
954036848 3:47855360-47855382 ACCAGTTCCTTTGTGGTTCCAGG - Exonic
954103982 3:48399221-48399243 AGCAGGTGCTTTGTCATTCAAGG - Intronic
955077633 3:55628977-55628999 ACCAGGAGCTTTGCTATCCAGGG + Intronic
955382013 3:58446853-58446875 TTCAGAACCTTTGTGATTCCTGG - Intergenic
957126180 3:76164336-76164358 TTAAGGACATTTGTGATTCATGG - Intronic
958164078 3:89856663-89856685 AGCAGGACCTTTCAAATTCATGG - Intergenic
958452206 3:94287652-94287674 ATAAGAACATTTGTGATTCATGG + Intergenic
959767579 3:110049939-110049961 ACCAGGACTTTTGTGAGACTGGG - Intergenic
964118224 3:153158166-153158188 TCCAGCATCTTTGTGACTCAGGG + Intergenic
965867920 3:173228250-173228272 ATAAGAACATTTGTGATTCATGG - Intergenic
967178901 3:186886125-186886147 ACCCGGACCTTTCTGATTTGAGG - Intergenic
972560413 4:40222864-40222886 TTCAGAACATTTGTGATTCATGG + Intronic
974978335 4:68920346-68920368 ACCAGGGCTTTTGTAACTCATGG - Intergenic
975501525 4:75091203-75091225 TCCAGAACATTTGTGATTCATGG + Intergenic
976438878 4:85050375-85050397 TTCAGGAACTTTATGATTCATGG - Intergenic
976584764 4:86783481-86783503 ACCAGGACTTTTGCTGTTCATGG + Intronic
976621082 4:87127890-87127912 ATCAGGACCTTAATGATTAAGGG + Intronic
977173598 4:93792771-93792793 ACAAGGGCATTTGTGATCCATGG + Intergenic
977411803 4:96675423-96675445 ACCATGACCCTTGTGATACATGG + Intergenic
979071764 4:116216778-116216800 ACCAGGATATTTTTGATTCAGGG - Intergenic
982247695 4:153370501-153370523 AACAGAACATTTGTGATTAAGGG - Intronic
982488071 4:155992949-155992971 ATAAGAACATTTGTGATTCATGG - Intergenic
982856904 4:160394937-160394959 ATCAGGACCTTTGAGAATGAGGG - Intergenic
983014948 4:162602084-162602106 ACAAGGACCCTTGTGCTTCCTGG + Intergenic
983549628 4:169003233-169003255 TTCAGAACATTTGTGATTCATGG + Intronic
983794744 4:171847926-171847948 TCAAGAACGTTTGTGATTCATGG - Intronic
989116975 5:37964522-37964544 ACCAGAACCTTGGAGATACAAGG - Intergenic
990969804 5:61492711-61492733 AGCACAACCTTTGTGATTCAGGG + Intronic
992127842 5:73660478-73660500 TTAAGGACATTTGTGATTCATGG - Intronic
992640764 5:78766768-78766790 ACCAGCACCCTCGTGATTCTGGG - Intronic
993126466 5:83842138-83842160 CTAAGGACATTTGTGATTCATGG + Intergenic
993633226 5:90313135-90313157 ACCAGGAGCTTTGATATTCCAGG + Intergenic
994996544 5:107071063-107071085 ATAAGAACATTTGTGATTCACGG - Intergenic
996537601 5:124594529-124594551 TCCAGGACCTTTGAAATGCATGG + Intergenic
997721128 5:136079233-136079255 AGAAGGACCTTGGAGATTCACGG - Intergenic
999043338 5:148440659-148440681 ACCTGGCCCTTTCTCATTCACGG + Intronic
1000521124 5:162295883-162295905 ACCAAGACCTGTGTGTGTCATGG - Intergenic
1004780289 6:18901055-18901077 AACAGGCCCTTTGTGATCAAGGG - Intergenic
1005164864 6:22908129-22908151 TCTAGGAACTTTGTTATTCAAGG - Intergenic
1005332134 6:24760875-24760897 ACCAGGAACTATGGGATTAAGGG - Intergenic
1006592093 6:35165912-35165934 ACCAGGAAGTTTGTTTTTCAAGG - Intergenic
1010687971 6:78874324-78874346 AGCAGTAACTATGTGATTCAGGG - Intronic
1011036228 6:82978498-82978520 ACAAGGCCCTTTGGGATTTAAGG - Intronic
1015652039 6:135473860-135473882 AATAGAACCATTGTGATTCAGGG - Intronic
1015744788 6:136498374-136498396 ACCAGGACCTGCCCGATTCATGG + Intronic
1016786186 6:148012929-148012951 ACCAGGAGCTCTGAGTTTCATGG - Intergenic
1022604379 7:31794711-31794733 ACCTGCACCTCTGTGAATCAGGG - Intronic
1023034268 7:36116966-36116988 CCCAGGTCATTTGAGATTCAGGG + Intergenic
1024549454 7:50549669-50549691 AAAAGAACATTTGTGATTCATGG + Intronic
1027047529 7:75000970-75000992 GCCAGGACCTTTGGAATTAACGG - Intronic
1029263632 7:99321890-99321912 ACCAGGACCTTCCAGATTCAAGG + Intergenic
1030172837 7:106621609-106621631 ACTAGAACATCTGTGATTCATGG - Intergenic
1030944569 7:115701167-115701189 TCCATGACCTTTGTGATACTGGG - Intergenic
1035474833 7:159135914-159135936 GCCAGGACCTGTGTGTTTGAGGG - Intronic
1037420489 8:18696603-18696625 ACTAAGACCTTTGTAATTCTGGG - Intronic
1039757562 8:40539823-40539845 AGCAGTATCTTTGTAATTCATGG + Intronic
1040096352 8:43447280-43447302 ACCTGAATATTTGTGATTCAGGG - Intergenic
1041893980 8:62902923-62902945 ACAAGGTTCTTTGTGAGTCAGGG + Intronic
1044065155 8:87689649-87689671 ACCAGCACGCTTGTTATTCAGGG + Intergenic
1044616064 8:94142991-94143013 TCAAGAACATTTGTGATTCATGG - Intronic
1047450901 8:124964233-124964255 AGGAGCACCTTTGTTATTCATGG + Intergenic
1047946921 8:129889531-129889553 TTAAGAACCTTTGTGATTCATGG + Intronic
1048129219 8:131675111-131675133 TTAAGGACATTTGTGATTCATGG - Intergenic
1051081461 9:13299251-13299273 ACCAGAATGTTTGTGATTAAAGG + Intergenic
1053748866 9:41233805-41233827 TTAAGGACATTTGTGATTCACGG + Intergenic
1054337511 9:63819582-63819604 TTAAGGACATTTGTGATTCACGG - Intergenic
1056297387 9:85206396-85206418 TCCAGTAGCTTTGTCATTCAGGG + Intergenic
1056465518 9:86849864-86849886 TCTAGGACTTTTATGATTCAAGG + Intergenic
1061055261 9:128219075-128219097 ACCGGGACCTTGGTCATTCCGGG - Exonic
1203445162 Un_GL000219v1:47195-47217 TTAAGGACATTTGTGATTCACGG - Intergenic
1186749354 X:12605708-12605730 CTCAGGACCTTTGTGCTTCATGG + Intronic
1189086513 X:38030858-38030880 AGCAGGAACTTTGGAATTCATGG - Intronic
1189096877 X:38149931-38149953 ACCAGGACCCTTGGGAGTCATGG - Intronic
1192165138 X:68823398-68823420 ACCAGGACCTTCCTCATTGAAGG + Intergenic
1197549868 X:127877689-127877711 ACCAGGAACATTTTCATTCAGGG + Intergenic
1198883634 X:141308999-141309021 AAAAGAACATTTGTGATTCATGG - Intergenic
1199032891 X:143021929-143021951 ACCAAGACCTTTGTTCTTAAGGG + Intergenic
1200395562 X:155984849-155984871 GACAGGACCTTTTGGATTCAAGG - Intergenic