ID: 921595111

View in Genome Browser
Species Human (GRCh38)
Location 1:217046267-217046289
Sequence GATACTGTGCTAGGTGCTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 1, 2: 8, 3: 56, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921595111_921595113 6 Left 921595111 1:217046267-217046289 CCTATAGCACCTAGCACAGTATC 0: 1
1: 1
2: 8
3: 56
4: 316
Right 921595113 1:217046296-217046318 AAAAGAGATGATCAAGAAATAGG 0: 1
1: 1
2: 3
3: 74
4: 734
921595111_921595114 12 Left 921595111 1:217046267-217046289 CCTATAGCACCTAGCACAGTATC 0: 1
1: 1
2: 8
3: 56
4: 316
Right 921595114 1:217046302-217046324 GATGATCAAGAAATAGGTGTTGG 0: 1
1: 0
2: 1
3: 27
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921595111 Original CRISPR GATACTGTGCTAGGTGCTAT AGG (reversed) Intronic
900482979 1:2908311-2908333 GATACTGTGCTGGGTGCAGCGGG - Intergenic
902369357 1:15995959-15995981 GTTACTGTACTAAGTACTATAGG + Intergenic
903088658 1:20888914-20888936 GATCCTGTGCTAAGAGGTATGGG + Intronic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903948967 1:26982992-26983014 GCCACTGTGCAAGGTGCTAGAGG - Intergenic
904513958 1:31038528-31038550 GATACTGTGCTAGACGCTCAAGG - Intronic
906405264 1:45537010-45537032 GATACTAAGCTAAATGCTATAGG - Intergenic
906778907 1:48554965-48554987 GGTACTGTGCCAGACGCTATGGG + Intronic
906969361 1:50494750-50494772 GATAGTATGCTAGATGCTATAGG - Intronic
907487733 1:54788868-54788890 GGTCCTGTGCTGGGTGCTCTGGG + Intronic
907732935 1:57085505-57085527 AACACTGTGCTAGGTGCTGGGGG + Intronic
907907536 1:58797835-58797857 GGAACTGTGCTAAGTGCCATGGG + Intergenic
908755442 1:67465171-67465193 GACACTGTGCTAGATGCTGGGGG - Intergenic
908768915 1:67578174-67578196 GTAAATGTGCTAAGTGCTATAGG + Intergenic
908923345 1:69222972-69222994 GGTACTGTTCTAGGTGCTAAGGG + Intergenic
909120032 1:71590922-71590944 GGTGCTGTGCTTGGTGATATGGG + Intronic
909667453 1:78151088-78151110 GATACTGTGCTAAGAGCTTTAGG - Intergenic
910249728 1:85184184-85184206 GTTACTGTTCTAGGTGCTGAAGG - Intronic
911562768 1:99426652-99426674 GACACTGTTATAGGTGCTTTGGG - Intergenic
912562157 1:110558772-110558794 GGCACTGTACTAGATGCTATGGG - Intergenic
913488876 1:119359661-119359683 CATCTTGTGGTAGGTGCTATGGG - Intergenic
914782248 1:150796175-150796197 GATACTGTGTTAGGTGCTGGAGG - Intergenic
915298853 1:154940760-154940782 AATACTGTGCTAGATGCTGTGGG - Intergenic
915867817 1:159523932-159523954 GAAAATGTCCTATGTGCTATGGG + Intergenic
916242717 1:162656201-162656223 GACCCTGTGCTAGATGCTAGAGG - Intronic
916966810 1:169955257-169955279 AATACTGTGCTAGGTCCTGTGGG + Intronic
917083215 1:171278259-171278281 GGTACTGTGCTAGATGGTATGGG - Intronic
917843728 1:179003185-179003207 GACACTGTGCTCAGTGCTTTGGG - Intergenic
918090703 1:181291661-181291683 AGCACTGGGCTAGGTGCTATGGG - Intergenic
918354124 1:183689848-183689870 GGCACTGTGCCAGGTGCTGTGGG + Intronic
918424155 1:184391445-184391467 AGTAGTGTGCTAGCTGCTATGGG - Intronic
919556197 1:199056975-199056997 GATACTGTACTAAGTGGTAGAGG - Intergenic
919982908 1:202653481-202653503 CAGACTGTGCTAGATGCTTTGGG - Intronic
920003668 1:202816752-202816774 AACACTATGCTAGGTGCTAGGGG - Intergenic
920191118 1:204194506-204194528 GGTGCTGTGCTAGGTGCTAGGGG + Intronic
920833252 1:209484236-209484258 GACACCATGCTAGGTGCTAAGGG + Intergenic
921595111 1:217046267-217046289 GATACTGTGCTAGGTGCTATAGG - Intronic
923235120 1:232025543-232025565 GATACTATGCCAGGGGCTCTAGG + Intronic
923382606 1:233436710-233436732 AATACTGTGCTAGTTGCTGGAGG - Intergenic
924380864 1:243463127-243463149 GACACTGTGCTGGATGCTATGGG + Intronic
1062803441 10:396878-396900 GAGTCTGTGGTAGCTGCTATGGG - Intronic
1064323008 10:14323288-14323310 TATACTGTGCTATTTGCTTTGGG + Intronic
1065523928 10:26598420-26598442 GACACTGTTCTAAGTGCTAAGGG - Intergenic
1065526204 10:26623474-26623496 GACACTGTTCTAAGTGCTAAGGG - Intergenic
1065531755 10:26676987-26677009 GACACTGTTCTAAGTGCTAAGGG - Intergenic
1065596532 10:27318896-27318918 GACACTGTTCTAAGTGCTAAGGG + Intergenic
1067200574 10:44168388-44168410 GATGCTGTGCTTGGTTCTATGGG + Intergenic
1068384158 10:56302258-56302280 GACAATGTGCTAGGTGATTTGGG - Intergenic
1068541748 10:58302548-58302570 GACATTGTGCTACGTGCTTTAGG - Intergenic
1068548698 10:58382545-58382567 TGTACTGTGCTAGGTACAATAGG + Intergenic
1069074928 10:64029218-64029240 GGCACTGTGCTAGGAGCTTTAGG + Intergenic
1071168904 10:82840370-82840392 TATAATGTGATAAGTGCTATGGG - Intronic
1071857206 10:89637469-89637491 GTTACTGTGCTTAGTACTATAGG + Intronic
1072064208 10:91849890-91849912 GACACTTTTCTAGCTGCTATGGG + Intronic
1072790420 10:98313740-98313762 GGTGCTGTGCCAGGTGCTTTGGG + Intergenic
1073552348 10:104415115-104415137 GATACTGTACAGGATGCTATGGG + Intronic
1073857602 10:107695426-107695448 CATTCTGTACTAAGTGCTATGGG - Intergenic
1074067614 10:110031337-110031359 GGTACAGTGCTAGGTACTTTAGG + Intronic
1075650231 10:124123211-124123233 AAGACTGCGCTAGGTGCTTTGGG + Intergenic
1076164553 10:128271309-128271331 GATACTGATCTATGTGCTATGGG + Intergenic
1077562087 11:3270506-3270528 GACACTGAGCTAGCTGCTTTGGG - Intergenic
1077567981 11:3316326-3316348 GACACTGAGCTAGCTGCTTTGGG - Intergenic
1078387151 11:10902646-10902668 GACACTGTGCTAAGTGAAATGGG - Intergenic
1079153027 11:17918543-17918565 GGTGCTGTGCCAGGTGCTGTAGG + Intronic
1079158197 11:17968380-17968402 GGTGCTGTCCTAGGTGCTAGGGG + Intronic
1081771624 11:45653742-45653764 GGCACTGTTCTAGATGCTATGGG + Intronic
1081792356 11:45797216-45797238 GGTACTGTGCTAGGGGCCAGAGG + Intergenic
1084728096 11:70955001-70955023 GACACTGTGCTTGGTGGTTTGGG - Intronic
1084864546 11:72045128-72045150 CCTAGTGTGCTAGGTGTTATGGG - Intronic
1085470310 11:76753379-76753401 AGTACTGTGCTAGGTTCTAAGGG + Intergenic
1086233899 11:84603794-84603816 GACACTGTGCTAGGTATTGTGGG + Intronic
1086763988 11:90671596-90671618 GGTACTGCGCTAGGTTCTAGAGG + Intergenic
1087536778 11:99457272-99457294 GAAACTGTACTAAGTGCTACAGG + Intronic
1087621107 11:100543440-100543462 TATACTGTGCTAAGTGCTAAAGG + Intergenic
1088102916 11:106174971-106174993 GTGACTGTGCTAAGTGCTGTAGG + Intergenic
1088206204 11:107395881-107395903 GACACTGTGACAGGTCCTATAGG - Intronic
1088522690 11:110716217-110716239 GATACCGTGCCAGGTGCTTGGGG + Intergenic
1089396523 11:118139529-118139551 GGCACTGTGCCAGATGCTATAGG - Intronic
1090478667 11:127048159-127048181 GATACTGTGCTATGTGCTAAAGG + Intergenic
1090902839 11:131047643-131047665 GGTACTCTGCTAGGTGCCAAGGG + Intergenic
1092113432 12:5981099-5981121 GGCACTGTGCTAGGTGCTATGGG - Intronic
1092543425 12:9434051-9434073 GGTGCTGTGCTGGGGGCTATGGG - Intergenic
1092676073 12:10922141-10922163 GGTACTGTTCTAGGTGGTTTAGG - Intronic
1092904959 12:13092664-13092686 AATACTGTGCTAGTTGCTGTGGG - Intronic
1093087876 12:14886686-14886708 GGTACTGTGCTAGGTGCTGTGGG + Intronic
1093254842 12:16854324-16854346 AACACTGTGCTAGGTGCTGTAGG + Intergenic
1093914578 12:24787295-24787317 GATCGTGTGCTAGGTACTTTTGG - Intergenic
1094089123 12:26628747-26628769 CAGACTGTGCTAGGTGCCACAGG + Intronic
1094258255 12:28461057-28461079 GTTACTGTGCTGAGTACTATAGG + Intronic
1094409643 12:30155602-30155624 GATACTGAGCTAAGCGCTCTGGG - Intergenic
1095053922 12:37578511-37578533 GAAACTGTTCTGGTTGCTATTGG - Intergenic
1096146048 12:49279575-49279597 GTCACTGTGCTGGGTACTATAGG + Intergenic
1096876322 12:54633056-54633078 GATTCTGTGCTTGGTGGTAATGG - Intronic
1096993351 12:55822675-55822697 GATACTGTGCTGAGTGTAATAGG - Exonic
1097333626 12:58358354-58358376 GATCCTGTGCTAGGTGCTGGAGG + Intergenic
1098527865 12:71507326-71507348 ATCACAGTGCTAGGTGCTATTGG - Intronic
1099462556 12:82941331-82941353 GATATTGTGCTCAGTGCTAGGGG - Intronic
1101057830 12:100937506-100937528 GGTACTGTGCTAGGTGCTTATGG - Intronic
1101067869 12:101041580-101041602 AGTACTGTGCTAAGTACTATTGG + Intronic
1101657456 12:106735732-106735754 AGTCCTGTGCTGGGTGCTATGGG + Intronic
1101728683 12:107408859-107408881 GATGCTGTGCTGGGTGCCAGGGG + Intronic
1102215053 12:111154958-111154980 GCTGCTGTGGTAGGTGCTATGGG + Intronic
1102330122 12:112021854-112021876 GATGCTGTTCTAGGTGCTGGGGG - Intronic
1102795464 12:115685577-115685599 GATACTGTGCTGGGTTCTGAGGG + Intergenic
1105051112 12:133051938-133051960 GTTACTGTGCTAGGTACTATGGG + Intronic
1106211123 13:27647176-27647198 GATACTGTGCAAGGTGCTATGGG - Intronic
1106258660 13:28044678-28044700 GATAATGTACCAGGTGTTATGGG - Intronic
1106301114 13:28466640-28466662 CATACTGTGCTAGGAGCTGTGGG + Intronic
1107357167 13:39579937-39579959 GAAACTGTGATAGGTACTATGGG - Intronic
1108222438 13:48250123-48250145 TATACTGTGCTAGATCCTGTGGG - Intronic
1108448164 13:50529674-50529696 GACTCTGTGCTAGTTGCTACTGG + Intronic
1112083482 13:96002913-96002935 CATCCTGTTCTAGGAGCTATGGG - Intronic
1112247326 13:97746937-97746959 GACCCTGTGCTAGGTGCTGAAGG - Intergenic
1112691169 13:101896272-101896294 GAAACTGTCCTTGGTGGTATGGG - Intronic
1114547628 14:23514073-23514095 GAGCCTGTGCCAGGTGCCATGGG - Intergenic
1114732178 14:25004695-25004717 TATCTTGTGCTAGGTGGTATCGG - Intronic
1115468302 14:33740400-33740422 CATACTGTGCTAGGTGCTGAGGG - Intronic
1117127544 14:52646544-52646566 AACACTGTGCAAGGTACTATGGG + Intronic
1119864668 14:77963405-77963427 GATCCTATGCTAGATGCTGTGGG - Intergenic
1119865259 14:77967874-77967896 CATCCAGTGCTAGGTGCTGTGGG - Intergenic
1119989924 14:79184902-79184924 AATACTTTGCTTGGTCCTATAGG + Intronic
1120504538 14:85338320-85338342 GTTACTGTACTGGATGCTATAGG - Intergenic
1120752539 14:88211223-88211245 GACACTGTGCTAAGTGAAATAGG + Intronic
1122200943 14:100122161-100122183 GATGGTGTGCAAGGTGCTGTGGG - Intronic
1123023270 14:105412005-105412027 GAGACCGGGCTAGGGGCTATGGG + Exonic
1124816128 15:32994630-32994652 GGCACTGTGCTAGGTGCTCGAGG - Intronic
1125459151 15:39892091-39892113 AGCACTGTGCCAGGTGCTATAGG + Intronic
1125903951 15:43372936-43372958 GAAACTGTGCTAGGTGCTCTGGG - Intronic
1126075376 15:44904043-44904065 GGCACTGTGCTGGGTGCTGTGGG + Intergenic
1126082994 15:44983744-44983766 GGCACTGTGCTGGGTGCTGTGGG - Intergenic
1126168674 15:45675726-45675748 GATACTGTCCTAGGTGCTGAGGG - Intronic
1126304384 15:47238578-47238600 AATACTGTGCTAGGCACTCTTGG - Intronic
1127187459 15:56494123-56494145 GCCACTGTGCTGGGTGCTGTAGG - Intergenic
1127355987 15:58200676-58200698 GTTACTGGGCTTGGTGCTGTAGG - Intronic
1127705962 15:61547459-61547481 GAGACTGTACTAGGTGCTGATGG - Intergenic
1128381823 15:67118885-67118907 GATTCTGTGCTAGGTACAACAGG - Intronic
1128440374 15:67702067-67702089 GACACTGGGCTAGGTACTTTGGG - Intronic
1129855633 15:78822769-78822791 GATACTGTACTAGTAGCAATGGG - Intronic
1131760616 15:95618682-95618704 GGCACTGTGCTAGGCGCTAGGGG + Intergenic
1132107529 15:99074149-99074171 CATACTGTGCCAGGTGCTGGGGG - Intergenic
1132463128 16:65300-65322 GATACTGCTCTAGGTGCTTGAGG + Intronic
1134206154 16:12239446-12239468 GGTACTGAGCCAGGTGCTTTGGG - Intronic
1134426785 16:14156550-14156572 GATACCGTGCTAGGGCCTCTGGG + Intronic
1138072454 16:54006621-54006643 GAAACTGTGGTTGGTGCAATTGG - Intronic
1138236351 16:55386451-55386473 CCTGCTGTGCTAGGTGCTCTGGG - Intergenic
1138549101 16:57737568-57737590 AATGCTGTGCTAAGTGCTTTAGG - Intronic
1139395853 16:66638238-66638260 GTTACTGTGCTTGGTGCCTTGGG - Intronic
1139665930 16:68456195-68456217 GATACTGTTCTACATGCTGTGGG - Intergenic
1141219231 16:82053624-82053646 CATGCTGGGCTAGGTGCTACAGG - Intronic
1142546771 17:709625-709647 GTCACTGTGCTAGGTGCTGAGGG - Intronic
1144378785 17:14672111-14672133 GATTCTGTGCTAGGCACTAGGGG + Intergenic
1147773355 17:42883140-42883162 GGTACTGTGCTAGGTGCTGGCGG + Intergenic
1149672950 17:58431734-58431756 GGTACTGTGCTAGGTCCAATAGG - Intronic
1150962849 17:69934056-69934078 GACACTGTGCTAAGTGAAATAGG + Intergenic
1152054541 17:78013517-78013539 GGTACTGTGCTGATTGCTATGGG + Intronic
1153539781 18:6141128-6141150 CATACTGTACTATGTGCTACAGG + Intronic
1156280856 18:35636643-35636665 GATACTGTGTCAGGTACTGTAGG - Intronic
1156534527 18:37849825-37849847 GTCACTGTGCTAAGTGCTAAGGG + Intergenic
1156906228 18:42355475-42355497 GACAATGTAGTAGGTGCTATTGG - Intergenic
1157713583 18:49866719-49866741 GGCACTGTGCTAGGTGCTGCAGG + Intronic
1158268556 18:55687180-55687202 GATACTCTGCTAGGTGCTGCTGG + Intergenic
1159932735 18:74331411-74331433 GGTTCTATGCTAGGTGCTATGGG - Intronic
1161700559 19:5792382-5792404 GATGCTGTGCTAGATGCTGGGGG + Intergenic
1162671332 19:12260195-12260217 GTTACTGGGCTTGGTGCTGTAGG - Intronic
1164954992 19:32375012-32375034 TATATTGGGTTAGGTGCTATTGG + Intronic
1165555840 19:36631286-36631308 GTTACTGTGCTGGATACTATAGG + Intergenic
1168335631 19:55596024-55596046 GATACAGTGCTAGGCTCTCTGGG - Intronic
925797529 2:7563116-7563138 GGCTCTGTGTTAGGTGCTATGGG - Intergenic
926312176 2:11682758-11682780 GAGACTGTGCTAGGTGCTGTGGG - Intronic
927840546 2:26439438-26439460 GATACTTTTCAAGGTGCTGTTGG - Intronic
928336586 2:30403813-30403835 ACTATTGTGCTAGGTGCTATTGG - Intergenic
928420739 2:31136567-31136589 GGCAGTGTGTTAGGTGCTATGGG - Intronic
929464882 2:42135430-42135452 GGCACTGGTCTAGGTGCTATTGG - Intergenic
929866435 2:45721128-45721150 AATCCTGAGCTAGGTGCTGTCGG + Intronic
929914882 2:46126683-46126705 GGTTCTGTGTTAGGTCCTATGGG - Intronic
932557012 2:72833373-72833395 GATACATTGCAAGGTGCAATGGG - Intergenic
932613651 2:73218336-73218358 GGCACTGTGCTAGGTGCTGTGGG + Intronic
932938990 2:76139782-76139804 GACACTGAGCTAGCTGCTGTAGG - Intergenic
933349170 2:81131157-81131179 AACACTTTGCTAGATGCTATGGG - Intergenic
935456894 2:103280422-103280444 GGAACTGCGCTAGGTGGTATTGG + Intergenic
937577009 2:123435846-123435868 GTAACTGTGCTAGGTACTGTAGG - Intergenic
937774893 2:125764763-125764785 GATGCTGTGCTAGATGCTGTGGG + Intergenic
938970521 2:136426882-136426904 GACACTGTGTTAGGTGCCAGGGG + Intergenic
939527757 2:143318796-143318818 GATACTTTTCTAGGTGCTGGGGG - Intronic
940221916 2:151361692-151361714 GGTATTTTGCTAGGTGCTGTGGG - Intronic
941158865 2:162012451-162012473 AAGACTGTGCCGGGTGCTATGGG - Intronic
942020570 2:171863985-171864007 CACACTGTGCAAGGTTCTATGGG + Intronic
942022607 2:171881742-171881764 GGTACTGTGCAAGGTGCTAGAGG - Intronic
942507417 2:176657763-176657785 GAAAATGTGATAAGTGCTATTGG + Intergenic
943052766 2:182936791-182936813 GACACTGTGCTGAGTGCTACAGG - Intronic
944100496 2:196021170-196021192 AAGTCTGTGCTAGTTGCTATGGG + Intronic
944547899 2:200815883-200815905 GATACTGTTCTTGGTGCAACGGG + Intronic
947685993 2:232085311-232085333 GAAACTGTTCTAGGTGCCAAGGG - Intronic
1169171466 20:3469117-3469139 GATTCTGAGGTAGGTGCCATAGG + Intergenic
1170223918 20:13970050-13970072 GAAACTGTGCAGGGTGCTAGAGG - Intronic
1170984184 20:21242971-21242993 GACACTGGGCTAGGTGCTGCAGG - Intronic
1172193458 20:33076330-33076352 GACACTGTTCTAAGTGCTTTAGG + Intergenic
1173118410 20:40268347-40268369 CATACTGTAGTAGGTGCTGTTGG - Intergenic
1173340783 20:42150977-42150999 GGCATTGTGCCAGGTGCTATGGG - Intronic
1177635718 21:23784523-23784545 GATACTGTGCTCTGTTCTCTAGG + Intergenic
1178000089 21:28151805-28151827 GTTACTGTACTAAATGCTATAGG - Intergenic
1178350551 21:31870391-31870413 GACACCGTGCTAGGTACTGTAGG + Intergenic
1179526698 21:41982414-41982436 CATACAGGGCTAGGTGCTTTAGG + Intergenic
1180710901 22:17838840-17838862 AATTCTGTGCTTGGTGCTGTAGG + Intronic
1181106148 22:20576878-20576900 GATACTGTGCCAGAGGCTATGGG - Intronic
1182608981 22:31530540-31530562 GACACTGTGCTAGGTACTGGAGG + Intronic
1182851612 22:33479292-33479314 GATGCTGTGCTAGGTGTTGGAGG - Intronic
1183771340 22:39928554-39928576 CCTACTGTGTTGGGTGCTATGGG + Intronic
1184605025 22:45567861-45567883 GAAAGTGTACTAGGTGCTTTGGG + Intronic
950173107 3:10852847-10852869 AGCTCTGTGCTAGGTGCTATGGG + Intronic
950872421 3:16241217-16241239 GATACTATGCTAGGGACTCTGGG - Intergenic
950983282 3:17331970-17331992 GATACTGTTACAAGTGCTATGGG + Intronic
951574780 3:24102479-24102501 GGCACTGTGTTAGGTGCTGTAGG - Intergenic
952840977 3:37645101-37645123 AATACTGTGCTAGGTGCTGGGGG + Intronic
953143264 3:40249050-40249072 TCTACTGTGATAGGAGCTATAGG - Intronic
953373430 3:42408659-42408681 GATGGAGTGCTAGGGGCTATGGG - Intronic
953683127 3:45054584-45054606 GACACTGTGCTATGTGCTGATGG - Intergenic
955009805 3:55003020-55003042 GGTGCTGTACTAGGTGCTAGAGG + Intronic
957036453 3:75297887-75297909 GACACTGTGCTGGGTGCTGCAGG + Intergenic
960388843 3:117052109-117052131 GGAACTGTGGTAAGTGCTATAGG + Intronic
960791329 3:121434471-121434493 AATACTGTGCTGTGTGCTTTGGG - Intronic
960793649 3:121460504-121460526 GATTATGTGCCAGGTGCTGTAGG - Intronic
961006498 3:123409277-123409299 GGGGCTGTGCTAGGTGCCATGGG + Intronic
961104210 3:124227582-124227604 GACACTGTGCTAGGCACTAGAGG + Intronic
963743506 3:149102749-149102771 GATCCTCTTCTAGGTGCTATAGG - Intergenic
964516002 3:157508388-157508410 GCTCCTGTACTAGGTCCTATGGG - Intronic
964625918 3:158759835-158759857 GATGCTGGGCTAAGAGCTATTGG + Intronic
965120748 3:164552817-164552839 GTTACTGTGCTGAATGCTATAGG + Intergenic
965460039 3:168951339-168951361 GGTGCTGTGCTTGGTGCTATGGG - Intergenic
966041793 3:175500095-175500117 GACCCTCTGCTAGGAGCTATGGG + Intronic
967011352 3:185437738-185437760 AGCACTGTGCTAGGTGCTTTGGG + Intronic
967115970 3:186339195-186339217 AATACTCTGCTAGGAGCTATGGG + Intronic
967220998 3:187248036-187248058 GGCACTGTGCTAGGTCCTAGGGG - Intronic
969920890 4:10538720-10538742 GGTACTGTGCCAGGTTATATGGG + Intronic
970055430 4:11965816-11965838 GAAACAGTGCTAGGAGCTTTTGG + Intergenic
970213510 4:13734891-13734913 GGTTCTGTTCTAGGTGCTTTGGG + Intergenic
970331745 4:14993566-14993588 GACACTGTGCAAGGCACTATGGG - Intergenic
971045362 4:22799772-22799794 AATACTGGGCTGGGTGCAATGGG - Intergenic
971955934 4:33418327-33418349 GATACAGTGCTAGGTGTTAGAGG + Intergenic
972299636 4:37772626-37772648 GGCACTGTGCTAGGTGCTAATGG + Intergenic
973801586 4:54483690-54483712 GTCACTGTGCTAGGTGCTTGGGG + Intergenic
974519334 4:62961045-62961067 GAAAATGAGCTATGTGCTATTGG + Intergenic
975694234 4:76995819-76995841 GAGCCTGTGCTAGGAGCTACAGG + Intronic
976033003 4:80780420-80780442 TATGCTGTGCTAATTGCTATGGG - Intronic
978132294 4:105213811-105213833 AGTACTGTACTAGGTGCCATGGG - Intronic
978424437 4:108567466-108567488 GATAATGTGCTTGGTGCTTGTGG - Intergenic
983160574 4:164408886-164408908 GATATTTTTCTAAGTGCTATAGG - Intergenic
984665819 4:182428162-182428184 GATACTGCATTAGGTGCTTTTGG + Intronic
986951432 5:13090576-13090598 GAGAATGTGCTAGGTATTATTGG - Intergenic
988804776 5:34729999-34730021 GATGCTGTGCTATGTGGTCTGGG + Intronic
992074254 5:73176403-73176425 GAGACTGTGCTAGGAGCTAAAGG + Intergenic
993551142 5:89275418-89275440 GACACTGTTCTAGGTACAATAGG - Intergenic
994041276 5:95262345-95262367 GTTACTGTGCTTGGAGCCATGGG - Intronic
995031550 5:107487422-107487444 GATACTGTGCTAGATGCTCTGGG - Intronic
995031584 5:107487806-107487828 AACACTGTGCTTGTTGCTATAGG - Intronic
995536953 5:113146190-113146212 GAGACTGTGCTGGGTGCTACAGG + Intronic
995892528 5:116971094-116971116 AGTACTGTGCAAGGTGCTAATGG + Intergenic
996749835 5:126877259-126877281 GACACTGTGCTATGGGATATGGG + Intronic
996880580 5:128292477-128292499 GATACCGTGCTAGGAGCTAAAGG - Intronic
997216440 5:132114991-132115013 GCCTCTGTCCTAGGTGCTATGGG - Intergenic
997725151 5:136114061-136114083 GACACTATGCCAGGTGCTAAGGG - Intergenic
997872530 5:137517744-137517766 AATACTGTTCCAGCTGCTATGGG + Intronic
998555973 5:143124147-143124169 AATACTGTGCTAGTCGCTATGGG - Intronic
998595023 5:143520482-143520504 GGTACTGTGCTAGGTGCTGTAGG + Intergenic
999216310 5:149938500-149938522 GACACTGGGCTAGGTGCCAGGGG + Intronic
999887378 5:155937773-155937795 GACACTGTGCAATGTGTTATTGG + Intronic
1000295849 5:159912866-159912888 AACACTGAGCTAGGTGCTGTGGG - Intergenic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1000655931 5:163877745-163877767 GATACTGTTTTGGGTGCTAAAGG - Intergenic
1001419035 5:171573025-171573047 GACACTGTGCTTGGTGCTAGAGG - Intergenic
1003810699 6:9776742-9776764 AATACTGTGCAAGGCACTATAGG - Intronic
1004484899 6:16057270-16057292 GCCACTGTGGAAGGTGCTATAGG - Intergenic
1004943057 6:20581360-20581382 GATACTGAGTTAGATGCTGTAGG + Intronic
1005217654 6:23550617-23550639 AATATTATGCAAGGTGCTATGGG + Intergenic
1006852717 6:37110759-37110781 GGCACTGTGCTTAGTGCTATAGG - Intergenic
1007016712 6:38475598-38475620 GATGCTGTGCGTGGTGCTGTGGG - Intronic
1007398212 6:41589290-41589312 GATGCTCTGCTAGGTGCTGGAGG - Intronic
1007697272 6:43741553-43741575 GATGCTGGGCTGGGGGCTATTGG + Intergenic
1008698195 6:54066741-54066763 GATACTGAGTCAGGTGCTGTGGG + Intronic
1009300614 6:62013651-62013673 GACACTGTTCTATGTGCTTTTGG + Intronic
1009904535 6:69853585-69853607 GGTACTATGCTAGGTACTGTGGG + Intergenic
1010504319 6:76638267-76638289 GAGACTGTGCTAAATGCTTTAGG + Intergenic
1010715746 6:79227866-79227888 CTACCTGTGCTAGGTGCTATGGG + Intronic
1010760240 6:79714289-79714311 AATCCTGTGATTGGTGCTATAGG - Intergenic
1011744877 6:90399832-90399854 GGTACTGTGCTTGGTGGTAGAGG - Intergenic
1013280520 6:108632188-108632210 GATGCGGTGCTAGGCGCTATGGG + Intronic
1013471155 6:110467515-110467537 CACACTGTGCTGGGTGCTACAGG - Intronic
1013552111 6:111217944-111217966 GGCACTGTGCTATGTGCTAGAGG - Intronic
1013639384 6:112058442-112058464 GGCACTGTGCTAGGTGCTGGTGG + Intronic
1013722826 6:113051350-113051372 GATGCTGTCACAGGTGCTATGGG - Intergenic
1014051601 6:116961831-116961853 GACACTGTGCTGGGTACTTTAGG - Intergenic
1014148511 6:118026004-118026026 GGCACTCTGCTAGGTGCTGTGGG + Intronic
1014262878 6:119240059-119240081 TAAACTGTGGTAGATGCTATGGG + Intronic
1014741216 6:125149538-125149560 GGGACTGTGCTAGATGCTAAGGG - Intronic
1016534904 6:145099005-145099027 GATACTCTGCTAGGTTCTGATGG - Intergenic
1018307959 6:162478082-162478104 GAGACTGTGGTAGGTACTAGGGG - Intronic
1018319315 6:162589889-162589911 AATACTGTGCCAGATGCTGTTGG - Intronic
1018617955 6:165705477-165705499 GGCACCGAGCTAGGTGCTATGGG - Intronic
1018688071 6:166318949-166318971 GACACTGTGCTTGGTGCTCAAGG - Intergenic
1019201509 6:170319988-170320010 GGTTCTGTGCTAGGTGCATTAGG + Intronic
1020150996 7:5681538-5681560 GACACTGTCCTTGGTGCTACAGG - Intronic
1021800287 7:24298677-24298699 GGTACTCTGCTAGGTTCTAGGGG + Intergenic
1021914354 7:25416561-25416583 GGTACTATGCTTTGTGCTATAGG - Intergenic
1021922283 7:25497430-25497452 GATGCTGTGCTAAGTACTGTGGG + Intergenic
1022725006 7:32973190-32973212 GGGACTGTGCCAGGTGCTTTGGG - Intronic
1023014836 7:35956466-35956488 GGTACTGTGCTTGGTGCTAGGGG + Intergenic
1024066168 7:45738554-45738576 GGTACTGTGCTTGGTGCTAGGGG - Intergenic
1024341655 7:48270066-48270088 GACACTGTGCCAACTGCTATGGG - Intronic
1025048595 7:55714641-55714663 GGGACTGTGCCAGGTGCTTTGGG + Intergenic
1025628230 7:63243361-63243383 GGTACTGTGCTTGGTGGTAGGGG - Intergenic
1027603674 7:80272262-80272284 GGCACTGTGCTAGGTACTGTCGG + Intergenic
1027971621 7:85090151-85090173 GATTCTGTGCCAGGTGCTAAAGG - Intronic
1028300964 7:89200323-89200345 CTTACTGTGTTAGGGGCTATAGG - Intronic
1029093941 7:98070337-98070359 GACACTGTAATAGGTGCTACGGG - Intergenic
1029154809 7:98508994-98509016 GATACTTTCCTATGTGCTAGTGG + Intergenic
1029496776 7:100899542-100899564 GATACTGTGCAAGGAGCAACAGG - Intergenic
1032022490 7:128416729-128416751 GGCACTGTGCTAGGTGTTAGAGG + Intergenic
1034088140 7:148339058-148339080 GTTACTGTGCTTGATGCTATTGG - Intronic
1035411530 7:158647260-158647282 GAGGCTGTGCTAGGTGCTGTTGG + Intronic
1036802684 8:11804068-11804090 GATAGTGTTCTAGGTGCTGGAGG + Intronic
1038598548 8:28913664-28913686 AGAACTGTGCTGGGTGCTATGGG - Intronic
1038837887 8:31148881-31148903 GGCATTGTGCTAGGTGCTACAGG - Intronic
1038914817 8:32009404-32009426 GATGCTGTTTTAGGTGCTAGGGG + Intronic
1039923196 8:41907199-41907221 AGCACTGTGCTAGGTGCTCTGGG - Intergenic
1041978382 8:63826046-63826068 AGAACTGTGCTAGGAGCTATAGG - Intergenic
1041992311 8:64008268-64008290 GATACTATGATAGGTACTAAAGG + Intergenic
1042952696 8:74218271-74218293 AACACCATGCTAGGTGCTATGGG - Intergenic
1043579204 8:81692222-81692244 GATACTGTGTTAGATGTGATAGG + Intergenic
1043647762 8:82543221-82543243 GATTTTGTGCTAGCTGCTATAGG - Intergenic
1044680331 8:94771403-94771425 GGCATTGTGCTAGGTGCTAAAGG + Intronic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046773986 8:118144445-118144467 GGCACTGTGCTAGGTGCTTTGGG - Intergenic
1047533251 8:125696341-125696363 GATACTGTGCTGAGGGCCATGGG - Intergenic
1048018382 8:130517463-130517485 GCTACTGTGCTAGGCCCTTTGGG + Intergenic
1048977484 8:139681033-139681055 GATGCTGTGCTAGAGGCTGTTGG - Intronic
1050556523 9:6794161-6794183 GACACTATGCCAGGTGCTAGAGG + Intronic
1051135079 9:13910924-13910946 GATACTGTGCTCAGTGTGATAGG - Intergenic
1051246072 9:15112980-15113002 GATACTGTTCTAGGTGGTGTGGG - Intergenic
1051417289 9:16855364-16855386 GATACTCTATTAGGTGCCATAGG - Intronic
1052274501 9:26662079-26662101 GATATTATGCTAAGTGCTAGAGG - Intergenic
1052330209 9:27259998-27260020 GAAACTGTGCTAAGTGCTGGGGG + Intergenic
1052636312 9:31109854-31109876 GTTACTGTACTGGATGCTATAGG - Intergenic
1053377828 9:37623134-37623156 GACACTGTGTTAGGTGCTGAGGG + Intronic
1053796305 9:41729957-41729979 GAAACTGTTCTGGTTGCTATTGG + Intergenic
1054148877 9:61584909-61584931 GAAACTGTTCTGGTTGCTATTGG - Intergenic
1054184710 9:61942027-61942049 GAAACTGTTCTGGTTGCTATTGG + Intergenic
1054468640 9:65516018-65516040 GAAACTGTTCTGGTTGCTATTGG - Intergenic
1054653797 9:67646470-67646492 GAAACTGTTCTGGTTGCTATTGG - Intergenic
1057737173 9:97673969-97673991 TATTATGTGCCAGGTGCTATAGG + Intergenic
1058947918 9:109876210-109876232 TATACTGTGCTAGCTTGTATTGG - Intronic
1060718390 9:125955895-125955917 AATACTGTACCAGGTGCTGTGGG - Intronic
1060788004 9:126465593-126465615 GATACTGTTCTAGGAGCTGGGGG + Intronic
1061046890 9:128170192-128170214 GATCCTGTGGGAGTTGCTATTGG - Intronic
1062145814 9:134989114-134989136 GATACAGTGGTCGGTGCTGTGGG - Intergenic
1062702534 9:137914869-137914891 GGCACTGTTCTAGGTGCTAGAGG + Intronic
1185635881 X:1551415-1551437 GACACTGTGCTAGGTGCATAGGG - Intergenic
1187107614 X:16260480-16260502 GGCACTGTGCTGGATGCTATGGG + Intergenic
1187257023 X:17652989-17653011 GGTACTGTGCTGGGTGCTTGTGG - Intronic
1187537010 X:20150862-20150884 TATACTTTGCTAGTTGCTCTGGG + Exonic
1188447568 X:30272135-30272157 GATACTGTGTTTGGTGCTGTTGG - Intergenic
1188997169 X:36899713-36899735 GATACTGGGCTAGAAACTATGGG - Intergenic
1189863003 X:45292438-45292460 GGCACTGTGCTAGGTGCTTTGGG + Intergenic
1190031556 X:46978015-46978037 GATACTGTGCTAAGAGCTAGGGG + Intronic
1190744524 X:53314327-53314349 GGTTCTGTGTTAGGTGCTGTGGG - Intronic
1190977854 X:55424582-55424604 GACACTGTGCTAAGTGAAATAGG + Intergenic
1191857624 X:65639956-65639978 GGTGCTGTGCTAGATGCTAGGGG + Intronic
1192864193 X:75113586-75113608 GATACTGTGGTATGTTCCATGGG - Intronic
1193227007 X:78995616-78995638 GATACTGAGAAAGGTTCTATCGG - Intergenic
1193653860 X:84173430-84173452 GACACTGTGCCAGCTGCTTTAGG - Intronic
1194964879 X:100276435-100276457 TGAACTGTGCTAGGTGCCATGGG - Intergenic
1195608879 X:106841113-106841135 GATACTCTGCTAGGTACTTAAGG + Intronic
1195922537 X:109998043-109998065 GCCACTCTGCTAGGTGCTGTGGG + Intergenic
1197151253 X:123222237-123222259 AGTACTGTGCTGGATGCTATGGG - Intronic
1197259833 X:124306056-124306078 GGTACTATGCTAGGTGCTAGGGG + Intronic
1197853813 X:130893380-130893402 GACACTGTGCTAGGCACTTTGGG + Intronic
1198126939 X:133654193-133654215 GCTATTGTGTTAGGTGCCATGGG + Intronic
1198136452 X:133755975-133755997 GACTCTGTACTAGGTGCTAGAGG + Intronic
1198384939 X:136119745-136119767 TGCACTGTGCTAGGTGCCATTGG - Intergenic
1199806930 X:151309373-151309395 GGCACTGTGCTTGGTGCTACAGG + Intergenic
1199901342 X:152175425-152175447 GGTTCTGTGCTAGGTGCTTGGGG + Intronic
1199914460 X:152324002-152324024 GATACTCTGCTAAGTGCTCTGGG - Intronic