ID: 921598982

View in Genome Browser
Species Human (GRCh38)
Location 1:217087306-217087328
Sequence AATGTGAATCAGCATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1387
Summary {0: 1, 1: 0, 2: 4, 3: 84, 4: 1298}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921598982 Original CRISPR AATGTGAATCAGCATGAGAA TGG (reversed) Intronic
900825031 1:4919377-4919399 AATGTGAATCCCCAAGACAATGG - Intergenic
900848519 1:5123103-5123125 AATGTCCATTAGCAGGAGAATGG - Intergenic
901252558 1:7791551-7791573 AATGTTAATCACCAAGACAATGG - Intronic
901255034 1:7816914-7816936 AATGTCATTCAGCAGGAGAATGG + Intronic
901392918 1:8958896-8958918 AATGTGAATCTGTAAGAGCAAGG - Exonic
901471815 1:9462072-9462094 AATGTTCATCAGCAGGTGAATGG - Intergenic
902084445 1:13848363-13848385 AATGTTAATCATCAAGACAATGG + Intergenic
902981675 1:20127800-20127822 TATGTGACTCAGCCTGAAAAAGG - Intergenic
903146440 1:21375849-21375871 AATGTTAATCACCAAGACAATGG + Intergenic
903617636 1:24673398-24673420 AAAGGGAATCAGCATGTGATTGG + Intergenic
904701140 1:32358868-32358890 AATGTCCATGAGCAAGAGAAAGG - Intronic
904957732 1:34299558-34299580 AATGTACATCAGTATGAGAATGG - Intergenic
906097696 1:43235371-43235393 AATGTGAATTAGTATCAAAAGGG + Intronic
906184081 1:43847437-43847459 AATGTTACTCAGCCTGAAAATGG + Intronic
906219025 1:44062985-44063007 AATGCGCATCAGCAGAAGAATGG + Intergenic
906267568 1:44444758-44444780 AATGTATATCACCATCAGAATGG - Intronic
906872781 1:49502968-49502990 AATATTAATCAGCAAGACAATGG + Intronic
907526967 1:55059445-55059467 AATGGGAATCTGCTTTAGAATGG - Intronic
907568302 1:55458025-55458047 AATGTTCATCAGCAGGTGAATGG + Intergenic
907593533 1:55698791-55698813 AATGTGACACAGCACGTGAATGG - Intergenic
907982092 1:59493440-59493462 AATATGATTCAGCATTAAAAAGG + Intronic
908066571 1:60412589-60412611 AATTTCAAGCAGCATGTGAATGG - Intergenic
908442692 1:64170558-64170580 AATGTTAATCACCAAGATAATGG - Intronic
908450143 1:64246537-64246559 CAAGTGAATTAGCATTAGAATGG + Intronic
908715681 1:67067471-67067493 AATGTTAATCACCAAGACAATGG + Intergenic
908866458 1:68554288-68554310 AATGTTAATCACCAAGAAAATGG + Intergenic
908932995 1:69340124-69340146 AATGTTAATCACCAAGACAATGG + Intergenic
909056976 1:70833267-70833289 AATGTTAATCACCAAGACAATGG + Intergenic
909068480 1:70963764-70963786 AATGTGAATCACCAAGAAAATGG - Intronic
909177697 1:72381005-72381027 AATGTTAATCATCAAGAAAATGG - Intergenic
909227334 1:73042534-73042556 TATCTGAATTAGCATAAGAATGG - Intergenic
909228985 1:73061752-73061774 AATGTTAATCACCAAGACAATGG + Intergenic
909235986 1:73153005-73153027 AATGTCAATTACCAAGAGAATGG - Intergenic
909357549 1:74726602-74726624 AATGTTAATCATCAAGATAATGG - Intronic
909376719 1:74950116-74950138 AATGTTAATCACCAAGACAATGG + Intergenic
909710904 1:78647787-78647809 AATGTTAATCACCAAGACAATGG - Intergenic
909751346 1:79165491-79165513 AATGTTAATCACCAAGACAATGG + Intergenic
909867089 1:80686635-80686657 AATGTTAATCACCAGGACAATGG - Intergenic
910055782 1:83031943-83031965 AATGTGAATCACCAAGATAATGG + Intergenic
910117047 1:83743103-83743125 AATGTAAATAGGCATGAAAAAGG + Intergenic
910387108 1:86696462-86696484 AATGTTAATCAGTAAGAAAATGG - Intergenic
910494760 1:87814462-87814484 AGTGTGCAGCAGCATGAGACTGG + Intergenic
910526284 1:88182569-88182591 AATGAGAAGCAGAATGACAAAGG + Intergenic
911267726 1:95762604-95762626 AATGTTAATCACCAAGACAATGG - Intergenic
911511267 1:98809682-98809704 AATGTTAATCACCAAGACAATGG - Intergenic
911515840 1:98866863-98866885 AATGTTAATCACCAAGACAATGG - Intergenic
911695927 1:100890414-100890436 AATGTTAATCACCAAGACAAAGG - Intronic
911799082 1:102110587-102110609 AATGTTAATCACCAAGACAATGG - Intergenic
912055820 1:105597042-105597064 AATGTTAATCACCAAGACAATGG + Intergenic
912073111 1:105839153-105839175 AATGTTAATCACCAAGACAATGG + Intergenic
912089201 1:106049747-106049769 AATATGAGTCAGCATGAGAAGGG + Intergenic
912405567 1:109434667-109434689 AATGTTAATCACCAAGACAATGG - Intergenic
913309564 1:117475064-117475086 AATGTCCATCAACAGGAGAATGG - Intronic
913706109 1:121424517-121424539 AATTTGAACCTTCATGAGAAAGG - Intergenic
913710046 1:121473509-121473531 AATGTTAATCACCAAGACAATGG - Intergenic
915058491 1:153159086-153159108 AATGTTAATCACCAAGACAATGG - Intergenic
915388434 1:155518661-155518683 AATGTGCTACAGCTTGAGAACGG + Intronic
916010534 1:160701681-160701703 AATGTGAATTGGCATGATATAGG + Intronic
916035804 1:160921760-160921782 AATGTTAATCACCAAGACAATGG + Intergenic
916296825 1:163228586-163228608 AATGTTAATCACCAAGACAATGG - Intronic
916808035 1:168279267-168279289 AATGTTCTTCAGCATGAGATAGG - Intergenic
916983891 1:170169594-170169616 TATGTGATTTAGGATGAGAAAGG - Intergenic
917140189 1:171827523-171827545 AATGTTAATCACCAAGACAATGG - Intergenic
917716588 1:177744597-177744619 AATGTCTATCAACAAGAGAATGG - Intergenic
918165992 1:181948457-181948479 AATGTTAATCACCAAGACAATGG + Intergenic
918591969 1:186249998-186250020 AATGTTAATCACCAAGACAATGG - Intergenic
918831628 1:189405655-189405677 AATGTTAATCCCCAAGAGAATGG - Intergenic
918937768 1:190945918-190945940 AATGTGATTCAGCACAAGAGAGG - Intergenic
919011800 1:191974301-191974323 AATGTTAATCACCAAGACAATGG - Intergenic
919261950 1:195208152-195208174 AATGTTAATCACCAAGACAATGG + Intergenic
919366579 1:196669341-196669363 AATGTTAATCACCATGACAAGGG + Intronic
919376022 1:196796053-196796075 AATGTTAATCACCAAGACAATGG + Intergenic
919385726 1:196920942-196920964 AATGTTAATCACCAAGACAATGG + Intronic
919408544 1:197215158-197215180 AATGTACATCAGCATAATAATGG + Intergenic
920545925 1:206818291-206818313 AATGTCCATCAGAAGGAGAATGG + Intronic
920594568 1:207255877-207255899 AATGTTAATCACCAAGACAATGG - Intergenic
920783658 1:209019979-209020001 AATGTTAATCACCAAGACAATGG + Intergenic
920853974 1:209648734-209648756 AATGCAAGTCAGCCTGAGAAAGG + Intronic
920965632 1:210698521-210698543 AATAAGAAACAGCAAGAGAAAGG + Intronic
921531199 1:216285127-216285149 AATGTTAATCACCAAGACAATGG + Intronic
921598982 1:217087306-217087328 AATGTGAATCAGCATGAGAATGG - Intronic
921724308 1:218507436-218507458 AATGTTAATCACCAAGACAATGG + Intergenic
921765908 1:218972769-218972791 AATGTTAATCATCAAGACAATGG + Intergenic
921880454 1:220249597-220249619 AATGTTAATCACCAAGACAATGG + Intronic
922058447 1:222064031-222064053 AATGTTAATCACCAAGACAATGG - Intergenic
922667840 1:227487896-227487918 AATGTTAATCACCAAGACAATGG - Intergenic
922850852 1:228732690-228732712 GATGATATTCAGCATGAGAAGGG + Intergenic
922900724 1:229134642-229134664 AATGTTAATCACCAAGACAATGG + Intergenic
923059594 1:230458555-230458577 AATGTCTATCAACAGGAGAATGG - Intergenic
923427981 1:233891239-233891261 AATGTTAATCACCAAGACAATGG + Intergenic
923461153 1:234210855-234210877 AATGTTAATCACCAAGACAATGG + Intronic
924040458 1:239979565-239979587 AATGTTAATCACCAAGACAATGG + Intergenic
924109680 1:240685767-240685789 AAGGTGAATAGACATGAGAAAGG + Intergenic
924684199 1:246270658-246270680 AATGTCATTCAGCATTAAAAAGG - Intronic
1063335726 10:5211203-5211225 AATGTTAATCACCAAGACAATGG - Intronic
1063481549 10:6380777-6380799 AATGTTAATCACCAGGACAATGG - Intergenic
1063542526 10:6948721-6948743 AATATTATTCAGCCTGAGAAAGG + Intergenic
1063710777 10:8475916-8475938 AGGCTGAATCAGCAAGAGAAGGG - Intergenic
1064365663 10:14705516-14705538 AATGTGATTCAGCTTGAAAAAGG + Intronic
1065159955 10:22909132-22909154 AATGTTAATCACCAGGACAATGG - Intergenic
1065666215 10:28064241-28064263 AATGCTATTCAGCATGAAAAGGG + Intronic
1065980285 10:30887971-30887993 AATATGATTCAGCAACAGAAAGG - Intronic
1066154276 10:32657704-32657726 AATGTTAATCACCAAGACAATGG - Intronic
1066230485 10:33427902-33427924 ACTGTGTATCTGCATCAGAAAGG - Intergenic
1066347470 10:34602526-34602548 AATGTCCATCAGCACTAGAATGG + Intronic
1067573309 10:47387174-47387196 AATGTTAATCATCATGACAATGG - Intergenic
1068103250 10:52581921-52581943 AATGTTAATCAGCAAGACAATGG - Intergenic
1068188109 10:53613229-53613251 AATGGGGATCAGCATTAAAAAGG - Intergenic
1068215635 10:53978576-53978598 AATGTTACTCACCATGACAATGG - Intronic
1068315399 10:55335488-55335510 TATGTGAATCACCAAGGGAAGGG - Intronic
1068399335 10:56508608-56508630 AATGTTAATCACCAAGATAATGG + Intergenic
1068431132 10:56934323-56934345 AATGTTAATCACCAAGACAATGG + Intergenic
1068553996 10:58437601-58437623 AATATGAATTAGCATGGAAATGG - Intergenic
1068805831 10:61192857-61192879 AATGTTAATCACCAAGACAATGG - Intergenic
1068832459 10:61512157-61512179 AATTTGAATCATAATGGGAAAGG - Intergenic
1069070380 10:63985839-63985861 AATGTCAGTCAGCATTAGAGAGG - Intergenic
1069077420 10:64052525-64052547 AATGTTAATCACCAAGACAATGG - Intergenic
1069292729 10:66802735-66802757 AATGCCCTTCAGCATGAGAATGG + Intronic
1069577609 10:69541937-69541959 AATGTTAATCACCAAGACAATGG - Intergenic
1069711304 10:70490480-70490502 AATGTCAATCAGCAAGTGAGGGG - Intronic
1069805142 10:71117702-71117724 AATGTTAATCACCAAGACAATGG + Intergenic
1070143765 10:73758802-73758824 AATGTCTATCAGCAGAAGAATGG - Intronic
1070420928 10:76236475-76236497 GAACTGAATCAGCATGAGAATGG + Intronic
1070639756 10:78159280-78159302 AATGAGAATGAGCAGGAGAGAGG - Intergenic
1071243879 10:83741255-83741277 AATGTTAATCACCAAGATAATGG - Intergenic
1071873506 10:89819290-89819312 AATGTTAATCACCAAGACAATGG - Intergenic
1072035845 10:91561988-91562010 AATGTTAATCACCAAGACAATGG - Intergenic
1072043524 10:91632698-91632720 AACGTGAATCAGCTTGAGTTAGG - Intronic
1072355831 10:94609390-94609412 AAAGTGAATCACCCTGAGATGGG - Intronic
1072743665 10:97925373-97925395 AGTGTGTGTCAGCATGAGAGTGG + Intronic
1073039279 10:100589776-100589798 AATGTGAATCAAAATAGGAATGG + Intergenic
1073627941 10:105118973-105118995 AATGTTAATCATCAAGACAATGG + Intronic
1073883335 10:108008176-108008198 AATGTTAATCACCAAGACAATGG - Intergenic
1074068391 10:110040050-110040072 ACTGTGATACAGCGTGAGAAGGG + Intronic
1074286312 10:112101056-112101078 AATGTTAATCACCATGACAGTGG - Intergenic
1074562043 10:114543525-114543547 AATGTCCATCAGCAGGTGAATGG - Intronic
1074622402 10:115138764-115138786 AATGTTAATCACCAAGACAATGG - Intronic
1075467063 10:122659476-122659498 CATGTCAGTCAGCAGGAGAATGG - Intergenic
1075550289 10:123387988-123388010 AATGTTAATCCCCAAGAGAATGG + Intergenic
1076007305 10:126957824-126957846 AATGTCCATCAACAGGAGAATGG + Intronic
1076131210 10:128015239-128015261 AATGTGTATCAAGAGGAGAATGG + Intronic
1076472996 10:130732545-130732567 AATGTCAAACAGCATTAAAAAGG + Intergenic
1076532160 10:131152104-131152126 AATGTTAATCACCAAGACAATGG - Intronic
1076651090 10:131988523-131988545 AATGTCAATGAACAAGAGAATGG + Intergenic
1077084639 11:742893-742915 AATGTCCATCAGCAGGAGAATGG - Intergenic
1077437842 11:2551491-2551513 AATGTCCATCAGCCTGTGAATGG - Intronic
1077596683 11:3537886-3537908 AATGTGAATCTCCAAGACAATGG - Intergenic
1077827411 11:5826255-5826277 AATGTTAATCACCAAGACAATGG + Intronic
1077985090 11:7343163-7343185 AATGTTAATCACCAAAAGAATGG - Intronic
1078308988 11:10219498-10219520 AATGTTAATCACCAAGACAATGG - Intronic
1078509330 11:11973939-11973961 AATGAGATGCAGCATCAGAAGGG - Intronic
1078540784 11:12211446-12211468 AGTGAGAATCAGCATGAGGCTGG + Intronic
1078686574 11:13537881-13537903 AATGTTAATCACCAAGACAATGG + Intergenic
1078687370 11:13546193-13546215 AATGTTAATCACCAAGACAATGG + Intergenic
1079189232 11:18264249-18264271 AATGTGACTGAACTTGAGAAAGG - Intergenic
1079652177 11:22942955-22942977 AATGTTAATCACCAAGACAATGG - Intergenic
1079736249 11:24000141-24000163 AATGTTAATCACCAAGACAATGG - Intergenic
1079785275 11:24664465-24664487 AGTGTTAATCACCATGACAAGGG + Intronic
1079804260 11:24910326-24910348 AATGTTAATCACCAAGACAATGG + Intronic
1079916143 11:26371008-26371030 AATGTGAATCACCAAGACAATGG + Intronic
1079945151 11:26732758-26732780 AATGTGAACCACCAAGACAATGG + Intergenic
1079957323 11:26881632-26881654 AATGTTAATCACCAAGACAATGG + Intergenic
1080449806 11:32369257-32369279 AATGTTAATCACCAAGATAATGG - Intergenic
1080694431 11:34589053-34589075 ATTGTGAATCTGCAGCAGAAAGG + Intergenic
1080946793 11:36982411-36982433 AATGTTAATCACCAAGACAATGG - Intergenic
1080959916 11:37146086-37146108 AATGTTAATCACCAAGACAATGG - Intergenic
1080973371 11:37304416-37304438 AATGTTAATCACCAAGACAATGG - Intergenic
1081051818 11:38350564-38350586 AATGTTAATCACCAAGACAATGG - Intergenic
1081101467 11:39007299-39007321 AATGTTAATCATCAGGAAAATGG - Intergenic
1081249731 11:40814526-40814548 AATGTGAATCACCAAGACAATGG - Intronic
1081354359 11:42094977-42094999 AATGTTAATCACCAAGACAATGG + Intergenic
1082692879 11:56326821-56326843 AATGTTAATCACCAAGACAATGG + Intergenic
1082948049 11:58780845-58780867 AATGTTAATCACCAAGACAATGG - Intergenic
1082981840 11:59131460-59131482 AATGTTAATCACCAAGACAATGG + Intergenic
1082986943 11:59177228-59177250 CATGGGAATCTGCATGTGAATGG - Intronic
1083185866 11:61017548-61017570 AAGGTGAGTCAGGATGGGAAGGG + Exonic
1084252598 11:67911859-67911881 AATGTGAATCTCCAAGACAATGG - Intergenic
1084820255 11:71684173-71684195 AATGTGAATCTCCAAGACAATGG + Intergenic
1085036539 11:73303847-73303869 AATGTGCATCAGCAAGACACTGG + Intergenic
1085875693 11:80404354-80404376 AATGTTAATCACCAAGACAAAGG + Intergenic
1085986346 11:81792670-81792692 AATGTTAATCACCATGACAATGG - Intergenic
1085999605 11:81965974-81965996 AATGTCCATCAACATGAGAATGG - Intergenic
1086287924 11:85271017-85271039 AATGTTAATCACCAAGACAATGG + Intronic
1086334136 11:85782450-85782472 AATGTTAATCAGCAAGACAATGG - Intronic
1086828808 11:91534233-91534255 AATGTTAATCACCAAGACAATGG + Intergenic
1086936162 11:92747528-92747550 AATGTTAATCACCAAGACAATGG - Intronic
1086985057 11:93238541-93238563 AATGTCCATCAACAGGAGAATGG - Intergenic
1087126068 11:94626641-94626663 AATGTTAATCACCAAGACAACGG - Intergenic
1087213494 11:95469108-95469130 AATGTTCATCAACATCAGAAAGG - Intergenic
1087578739 11:100025013-100025035 AATGTTAATCACCAAGACAATGG + Intronic
1087749230 11:101988578-101988600 AATGTTAATCAGCAACAAAAAGG + Intronic
1087831786 11:102826499-102826521 AATGTTAATCACCAAGACAATGG - Intergenic
1087908677 11:103727550-103727572 AATGTTAATCACCAAGATAATGG - Intergenic
1088034118 11:105290995-105291017 AATGGCTATCAGCATGTGAATGG + Intergenic
1088305498 11:108402971-108402993 AATTTGCATCAGCAGGTGAATGG - Intronic
1088850879 11:113702561-113702583 AATGTTAATCACCAAGACAATGG + Intronic
1089888376 11:121854191-121854213 AATGTCCATCAGCACGAGAATGG + Intergenic
1090179613 11:124685068-124685090 AATGTTAATCACCAAGACAATGG + Intronic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090573054 11:128068532-128068554 AATGTTAATCACCAAGACAATGG - Intergenic
1090692527 11:129199288-129199310 AATGTTAATCACCAAGACAATGG + Intronic
1090982331 11:131734351-131734373 AATGTAAATCAGAGTCAGAAAGG - Intronic
1091199865 11:133768704-133768726 AATGTGAATCAGTAAGTAAATGG + Intergenic
1091350659 11:134891697-134891719 AATGTTAATCACCAAGACAATGG + Intergenic
1092422850 12:8346659-8346681 AATGTGAATCTCCAAGACAATGG - Intergenic
1092618240 12:10234836-10234858 AATGTTAATCACCAAGACAATGG - Intergenic
1092665503 12:10792018-10792040 AATGTTAATCACCAAGACAATGG - Intergenic
1092931890 12:13323622-13323644 AAAGTGAATCAGCATGTGAAAGG + Intergenic
1093038151 12:14352339-14352361 AATGTTAATCACTATGACAATGG - Intergenic
1093076106 12:14760640-14760662 AATGTTAATCACCAAGACAATGG + Intergenic
1093276536 12:17135606-17135628 AATGTCAATCAACACGAGAATGG - Intergenic
1093353055 12:18127937-18127959 AATGTTAATCACCAAGACAATGG + Intronic
1093570660 12:20662859-20662881 AATGTTAATCACCAAGACAATGG + Intronic
1094707639 12:32929815-32929837 AATGTTATTCAGCATTAAAAAGG - Intergenic
1094780874 12:33790219-33790241 AATGTTAATCATCAAGACAACGG - Intergenic
1095214043 12:39527248-39527270 AATGTTAATCACCAAGACAATGG - Intergenic
1095216645 12:39557544-39557566 AATGTTAATCACCAAGACAATGG + Intronic
1095243305 12:39887035-39887057 ACTCTAAATCTGCATGAGAATGG - Intronic
1095300885 12:40582208-40582230 AATGTTAATCACCAAGACAAGGG - Intergenic
1095345933 12:41148523-41148545 AATGTTAATCACCACGACAATGG - Intergenic
1095382751 12:41615302-41615324 AATGTTAATCACCAAGACAATGG + Intergenic
1095434726 12:42175125-42175147 AATGTTAATCAACAGGTGAATGG + Intronic
1095492516 12:42749308-42749330 AATGAGAACAAGCATGAGATTGG + Intergenic
1095635690 12:44430503-44430525 AATATGATTCAGGAAGAGAAAGG + Intergenic
1095765233 12:45886956-45886978 AATGTTAATCACCAAGACAATGG - Intronic
1095765968 12:45896238-45896260 AAAGTGACACAGTATGAGAAGGG + Intronic
1095836866 12:46648465-46648487 AATGTTAATCACCATGACAATGG - Intergenic
1096290537 12:50338781-50338803 AATGGGAATCAGGTTCAGAAAGG - Intronic
1096453597 12:51766955-51766977 AATGTGGATGAGCATGTTAAGGG - Intronic
1096472680 12:51889139-51889161 GATGTGAACCAGCAGGACAAAGG + Exonic
1096904870 12:54926371-54926393 AATGTTAATCACCAAGACAATGG + Intergenic
1097441384 12:59612513-59612535 AATGTTAATCACCAAGACAATGG - Intronic
1097486677 12:60212435-60212457 AATGTTAATCACCAAGACAATGG + Intergenic
1097575642 12:61389326-61389348 AATGTTAATCACCAAGACAATGG - Intergenic
1097668880 12:62513136-62513158 AATGTTAATCACCAAGACAATGG - Intronic
1097961601 12:65536719-65536741 AATGTGAATCACTTTGGGAAAGG + Intergenic
1098203755 12:68084159-68084181 AATGTTAATCACCAAGACAATGG - Intergenic
1098310010 12:69139165-69139187 AATGTGTATCAGGATGGGGAGGG + Intergenic
1098440973 12:70517947-70517969 CAAGAGAATCAGCATGTGAAGGG + Exonic
1098470139 12:70833499-70833521 AATGAGAAACAGCCTGGGAATGG + Intronic
1098493898 12:71112618-71112640 AATGTTAATCACCAAGACAATGG - Intronic
1098630865 12:72720448-72720470 AATGTTAATCAACAAGACAATGG + Intergenic
1098648838 12:72939619-72939641 AATGTTAATCACCAAGACAATGG - Intergenic
1098686906 12:73433920-73433942 AATGTTAATCACCAGGACAATGG + Intergenic
1098792035 12:74836670-74836692 AATGTTAATCACCAAGACAATGG + Intergenic
1098836312 12:75428591-75428613 AATGTTAATCACCAAGACAATGG + Intronic
1099088575 12:78278050-78278072 AATGTTAATCACCAAGACAATGG + Intergenic
1099096381 12:78379349-78379371 AATGTTAATCACCAAGACAATGG - Intergenic
1099390210 12:82070212-82070234 AATGTTAATCACCAAGACAATGG - Intergenic
1099467101 12:83001133-83001155 AATGTTAATCACCAAGACAATGG - Intronic
1099621224 12:85005184-85005206 AATGTTAATCACCAAGACAATGG + Intergenic
1099907784 12:88792313-88792335 AATGTTAATCACCAAGACAATGG + Intergenic
1100032335 12:90208850-90208872 AATGTTAATCACCAAGACAATGG + Intergenic
1100038407 12:90281573-90281595 AATGTTAATCACCAAGACAATGG + Intergenic
1100051898 12:90459708-90459730 AATGTTAATCACCAAGACAATGG + Intergenic
1100086291 12:90914346-90914368 AATGTTAATCACCAAGACAATGG - Intronic
1100170192 12:91966801-91966823 AATGTCCATCAACAGGAGAATGG + Intergenic
1100324022 12:93524110-93524132 AATGTCAATCAACAGGAGAGTGG - Intergenic
1100419886 12:94422845-94422867 AATGCGCATCAGCAGGAGAATGG - Intronic
1100674946 12:96856278-96856300 AATGTTAATCACCAAGACAATGG - Intronic
1100747542 12:97662052-97662074 AATGTTAATCACCAAGACAATGG - Intergenic
1100929177 12:99585971-99585993 AATGTTAATCATCAAGACAATGG - Intronic
1100933598 12:99638694-99638716 AATGTTAATCACCAAGACAATGG + Intronic
1101113209 12:101506508-101506530 AATGTTAATCACCAAGACAACGG + Intergenic
1101396507 12:104353372-104353394 AATATCCATCACCATGAGAATGG + Intergenic
1101607134 12:106255995-106256017 AAGGTGACCCAGCTTGAGAATGG + Intronic
1101877426 12:108605096-108605118 AATGTCCATCAACAGGAGAATGG + Intergenic
1102077480 12:110071476-110071498 TATGTCAATCATCATGATAAGGG + Intronic
1102901530 12:116641675-116641697 AATGTCCATCAGCAAAAGAATGG + Intergenic
1103263446 12:119609444-119609466 AATGTTAATCACCAAGACAATGG + Intronic
1103264525 12:119617901-119617923 AATGTTAATCACCAAGACAATGG + Intronic
1103588376 12:121972987-121973009 AATGTTAATCTGCAAGACAATGG + Intronic
1103805143 12:123566685-123566707 AATGTCCATCAGCAATAGAATGG + Intergenic
1104079904 12:125420626-125420648 AATGTTAATCACCAAGACAATGG - Intronic
1104543027 12:129685177-129685199 AATGTTAATCACCAAGACAATGG + Intronic
1105227290 13:18448025-18448047 AATGTTAATCACCAAGACAATGG + Intergenic
1106461616 13:29975230-29975252 AATGTCCATCAGGATGTGAATGG + Intergenic
1106630254 13:31464552-31464574 ACTGAGGATGAGCATGAGAATGG - Intergenic
1106718720 13:32418073-32418095 AATGTTAATCACCAAGACAATGG + Intronic
1106864379 13:33948037-33948059 AATGTTAATCACCAAGACAATGG + Intronic
1106929780 13:34651883-34651905 AATGTTAATCACCAAGACAATGG + Intergenic
1107507617 13:41050340-41050362 AATGTGATTCAGCCTTAAAAAGG - Intronic
1108076339 13:46683328-46683350 AATGCTAGTCAGTATGAGAAAGG - Intronic
1108106146 13:47012659-47012681 CATGTCTATCAGCAGGAGAATGG + Intergenic
1108184380 13:47873632-47873654 AATGTTAATCACCAAGACAATGG - Intergenic
1108759649 13:53547043-53547065 AAAGTGAAACGGTATGAGAAGGG - Intergenic
1108885623 13:55178147-55178169 AATGTAAATCACCAAGACAATGG + Intergenic
1108936844 13:55891771-55891793 AATGTTAATCACCAAGACAATGG - Intergenic
1109013215 13:56975896-56975918 AATGTTAATCACCAAGACAATGG - Intergenic
1109084437 13:57951609-57951631 AATGTTAATCACCAAGACAATGG - Intergenic
1109097830 13:58141557-58141579 AATGTTAATCACCAAGACAATGG + Intergenic
1109102183 13:58199413-58199435 AATGTTAATCACCATGACAACGG + Intergenic
1109334051 13:60970814-60970836 AATGTGAATCTCCAAGACAATGG + Intergenic
1109393715 13:61725947-61725969 AATGTTAATCACCAAGACAATGG - Intergenic
1109576244 13:64263365-64263387 AATGTTAATCACCAAGACAACGG + Intergenic
1109641913 13:65202590-65202612 AATGTTAATCACCAAGACAATGG + Intergenic
1109718305 13:66245828-66245850 AATGTTAATCACCAAGACAATGG + Intergenic
1109876147 13:68406182-68406204 AATGTTAATCACCAAGACAATGG - Intergenic
1109993440 13:70089101-70089123 ATTGTTAATCAACATAAGAATGG + Intronic
1110007691 13:70293584-70293606 AATGTTAATCACCAAGACAATGG + Intergenic
1110048450 13:70860825-70860847 AATGTTAATCACCAAGACAATGG - Intergenic
1110056989 13:70985814-70985836 AATGTTAATCACCAAGACAATGG - Intergenic
1110166330 13:72447918-72447940 AATGTTAATCACCAAGACAATGG + Intergenic
1110250734 13:73377603-73377625 AATGTTAATCACCAAGACAATGG - Intergenic
1110380163 13:74841199-74841221 AACTTGAATTAGCATGAGGAAGG - Intergenic
1110489575 13:76087302-76087324 AATGTTAATCACCAAGACAATGG - Intergenic
1110852805 13:80263585-80263607 AATGTTAATCACCAAGACAATGG - Intergenic
1110934149 13:81262562-81262584 AATGAAAATCAGCTTGATAATGG + Intergenic
1111064444 13:83072466-83072488 AATGTTAATCACCAAGACAATGG + Intergenic
1111077962 13:83263844-83263866 AATGTTAATCACCAAGACAATGG + Intergenic
1111081981 13:83322473-83322495 AATGTTAATCACCAAGACAATGG - Intergenic
1111189503 13:84789948-84789970 AATGTTAATCACCAAGACAATGG + Intergenic
1111441451 13:88286438-88286460 AATGTTAATCATCAAGACAATGG - Intergenic
1111470009 13:88668093-88668115 AATGTATATCATCCTGAGAAAGG - Intergenic
1111501519 13:89127674-89127696 AATGTTAATCACCAAGACAATGG - Intergenic
1111580956 13:90223398-90223420 AATGTCCATCAGCATGAGAATGG + Intergenic
1111619495 13:90705476-90705498 AATGTGTCTCAACATGATAAAGG - Intergenic
1112744149 13:102508507-102508529 AATGTTAATCACCAAGACAATGG + Intergenic
1112789590 13:102988175-102988197 AATGTTAATCACCAAGACAATGG - Intergenic
1112857301 13:103787074-103787096 AATGTTAATCACCATGACAATGG - Intergenic
1112954629 13:105042436-105042458 AATGTTAATCACCAAGACAATGG - Intergenic
1112995878 13:105574978-105575000 AATGTGAATCACCAAGAAAATGG + Intergenic
1113005011 13:105690942-105690964 AATGTCAATCAACAGTAGAATGG - Intergenic
1113264826 13:108606254-108606276 AATGTTAATCACCAAGACAATGG + Intronic
1113341833 13:109433084-109433106 AATGTTAATCACCAAGATAATGG - Intergenic
1113602033 13:111576539-111576561 CATGTGATTCAGCAAAAGAATGG + Intergenic
1114011743 14:18376479-18376501 AATGTTAATCACCAAGACAATGG + Intergenic
1114147504 14:19994193-19994215 AATGTTAATCACCAAGACAATGG - Intergenic
1114917849 14:27289345-27289367 AATGTTAATCACCAAGACAATGG - Intergenic
1114984483 14:28210087-28210109 AATGTTAATCACCAAGACAATGG + Intergenic
1115289312 14:31752135-31752157 AATGTTAATCACCAAGACAATGG - Intronic
1115340691 14:32290768-32290790 AATGTTAATCACCAAGACAATGG + Intergenic
1116028738 14:39545281-39545303 AATGTCATTCATCAAGAGAATGG - Intergenic
1116095247 14:40359423-40359445 AATGTTAATCACCAAGACAATGG + Intergenic
1116098956 14:40408707-40408729 AATGTTAATCACCAAGACAATGG - Intergenic
1116126630 14:40796729-40796751 AATGTTAATCACCAAGACAATGG - Intergenic
1116272140 14:42785976-42785998 AATGTTAATCACCAAGAAAATGG + Intergenic
1116296716 14:43119978-43120000 AATGTTAATCAACAAGATAATGG - Intergenic
1116393733 14:44423074-44423096 AATGTTAATCACCAAGACAATGG - Intergenic
1116672998 14:47867738-47867760 AATGTCAATCAACAGGAGAATGG - Intergenic
1116780807 14:49236032-49236054 AATGTTAATCACCAAGACAATGG + Intergenic
1117085432 14:52196121-52196143 AATGTTAATCACCAAGACAATGG + Intergenic
1117752290 14:58936363-58936385 AATGTTAATCACCAAGACAATGG - Intergenic
1117840916 14:59860079-59860101 AATGTGAATCCCCAAGACAAAGG + Intronic
1117990082 14:61424717-61424739 AATGTTAATCACCAAGACAATGG + Intronic
1118012481 14:61624057-61624079 AATGTAAAGCAGTAGGAGAAAGG - Intronic
1118046559 14:61976790-61976812 AATGTTAATCACCAAGACAATGG - Intergenic
1118083296 14:62387125-62387147 AATGTTAATCACCAAGACAATGG + Intergenic
1118484433 14:66200695-66200717 AATGTTAATCACCAAGACAATGG + Intergenic
1118603612 14:67487477-67487499 AATTTGAAGCTGAATGAGAATGG - Intronic
1118615201 14:67570202-67570224 AATGTGAATCAGTATGAACGTGG + Intronic
1119007319 14:70943671-70943693 AATGTTAATCACCAAGACAATGG + Intronic
1119011917 14:71001950-71001972 AATCTGAATCAGGAAGATAAAGG - Intronic
1119040336 14:71269111-71269133 AATGTTAATCATCAAGACAATGG + Intergenic
1119880752 14:78097542-78097564 AATGTTAATCACCAAGACAATGG - Intergenic
1119963055 14:78881834-78881856 AATGTTAATCACCATGATAATGG + Intronic
1120083125 14:80237441-80237463 AATGTTAATCACCACGAAAATGG - Intronic
1120247973 14:82028026-82028048 AATGTTAATCACCAAGACAATGG - Intergenic
1120358002 14:83458940-83458962 AATGTTAATCACCAAGACAATGG + Intergenic
1120405110 14:84084407-84084429 AATGTTAATCACCATGACAATGG - Intergenic
1120417988 14:84243872-84243894 AATGTTAATCACCAAGACAATGG - Intergenic
1120472103 14:84938645-84938667 ATTCTGGAACAGCATGAGAAGGG - Intergenic
1120522739 14:85543728-85543750 AATGGTAAACAGCATGGGAAAGG - Intronic
1120590905 14:86372494-86372516 AATGTTAATCACCAAGAGAATGG + Intergenic
1120636933 14:86964817-86964839 AATGTTAATCACCAAGACAATGG + Intergenic
1120651875 14:87144039-87144061 AATGTTCATCAATATGAGAATGG - Intergenic
1120661596 14:87257538-87257560 AATGTTAATCACCAAGACAATGG + Intergenic
1120933853 14:89874394-89874416 AATGTTAATCACCAAGACAACGG - Intronic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1121165511 14:91792684-91792706 AATGTGAATGAAAATAAGAATGG + Intronic
1121166457 14:91806813-91806835 AATGTTAATCATCAAGACAATGG + Intronic
1121230912 14:92357497-92357519 AATGTTATTCAGCCTGAAAAAGG + Intronic
1121290026 14:92766587-92766609 AATGAGAACCAGCCTGAGAGGGG + Intergenic
1121499002 14:94418869-94418891 AATGTCAATCACCAAGACAATGG + Intergenic
1121664256 14:95660001-95660023 AATGGGAATCAGGCTGAGAAGGG - Intergenic
1121699501 14:95941980-95942002 AATGTTAATCACCAAGACAATGG + Intergenic
1122196638 14:100092379-100092401 CATGTCCATCAGCAGGAGAATGG + Intronic
1123696939 15:22885107-22885129 AATGTCAATCACCAAGACAATGG - Intronic
1124064083 15:26323334-26323356 AATCTTAATCTGCATGGGAAGGG + Intergenic
1124556119 15:30727391-30727413 AATGTTAATCACCAAGACAATGG - Intronic
1124675152 15:31678379-31678401 AATGTTAATCACCAAGATAATGG + Intronic
1126243687 15:46476293-46476315 AATGTCCATCAGCATGTGAATGG - Intergenic
1126580581 15:50239010-50239032 AATGAGAATCAGTATTAAAATGG + Intergenic
1126942878 15:53785099-53785121 AATGTTAATCACCAAGACAATGG - Intergenic
1127186422 15:56485517-56485539 AATGTTAATCACCAAGACAATGG + Intergenic
1127565256 15:60181870-60181892 AATGTGCATCAGCAAGAGAATGG + Intergenic
1128372009 15:67047272-67047294 AATGTCCATCAGCAAGAAAAAGG - Intergenic
1128468929 15:67935816-67935838 ACTGTGTATCACCATGAGAAAGG + Intergenic
1128631452 15:69272592-69272614 AGTCTGAATGAGCATGGGAAAGG - Intergenic
1129991688 15:79970406-79970428 ATTGTGAAGCTGCATGAGAGAGG + Intronic
1130085246 15:80772544-80772566 AAAGTGCAGCAGCATGGGAATGG - Intergenic
1130385775 15:83410467-83410489 AATGTCCATCAACAGGAGAATGG - Intergenic
1130409400 15:83631825-83631847 AATGTTAATCACCAAGACAATGG - Intergenic
1130422092 15:83757598-83757620 AATGTTAATCACCAAGACAATGG - Intronic
1132055016 15:98644696-98644718 AATGTAAATCAAAAGGAGAATGG - Intergenic
1132107518 15:99074052-99074074 CATGTGGATCTGCATGATAATGG + Intergenic
1132353794 15:101156803-101156825 AAAATGACTCAGCTTGAGAAAGG + Intergenic
1133401604 16:5491501-5491523 AATGTCCATCAACAGGAGAATGG + Intergenic
1133458872 16:5969085-5969107 AATATAAATCAGAATTAGAAAGG - Intergenic
1133478850 16:6149839-6149861 AATGTGAATCTTCATGAAAGTGG + Intronic
1134105526 16:11483401-11483423 AATGTCAATCAACAGGTGAATGG + Intronic
1134660649 16:15981721-15981743 AATGTTAATCACCAAGACAATGG - Intronic
1134782925 16:16915042-16915064 AATGTCTATCAGGAGGAGAATGG + Intergenic
1135297260 16:21292126-21292148 AATGTCCATCAACATGTGAATGG + Intronic
1135919093 16:26632088-26632110 AATGTTAATCACCAAGACAATGG - Intergenic
1135931317 16:26739791-26739813 AATGTCAATCAGTAGAAGAATGG + Intergenic
1136674848 16:31893403-31893425 AATGTTAATCACCAAGATAATGG - Intronic
1136709897 16:32228536-32228558 AATGTTAATCACCAAGACAATGG + Intergenic
1136758012 16:32700875-32700897 AATGTTAATCACCAAGACAATGG - Intergenic
1136810094 16:33169500-33169522 AATGTTAATCACCAAGACAATGG + Intergenic
1136816570 16:33279580-33279602 AATGTTAATCACCAAGACAATGG + Intronic
1137257265 16:46786613-46786635 ATTTTGAAGCAGCAAGAGAAAGG + Intronic
1137260437 16:46823703-46823725 AATGTCCATCAACAGGAGAATGG + Intronic
1137546575 16:49408614-49408636 GATGGGAAACAGGATGAGAAGGG + Intergenic
1137951863 16:52791652-52791674 AATGTTAATCACCAAGACAATGG + Intergenic
1138895396 16:61198512-61198534 AATGTTAATCACCAAGACAATGG + Intergenic
1139011450 16:62639578-62639600 AATGTGACTCAGAATGAAATAGG - Intergenic
1139682903 16:68579432-68579454 AAGGTGCATCAGCAGGTGAATGG + Intergenic
1139790895 16:69434257-69434279 AATGTCAATCAACAAGTGAATGG - Intronic
1140992770 16:80230451-80230473 AATGAGAATCAGCATCAGGCTGG - Intergenic
1141140494 16:81494025-81494047 AATGTGATTCACCATGTGATCGG + Intronic
1141313135 16:82934499-82934521 AATGTTAATCACCAAGACAATGG - Intronic
1142315236 16:89340043-89340065 AATGTTAGTCAACAGGAGAATGG - Intronic
1203060163 16_KI270728v1_random:961224-961246 AATGTTAATCACCAAGACAATGG - Intergenic
1142508846 17:381755-381777 AATGTTTATCAGCAGTAGAATGG - Intronic
1142987498 17:3705207-3705229 AATGAGAATGAGTGTGAGAATGG + Intergenic
1143210907 17:5186525-5186547 AATGTTAATCCGCAAGACAATGG - Intronic
1143214697 17:5215864-5215886 AATGTCCATCAGCAGTAGAATGG + Intronic
1144500191 17:15779392-15779414 AATGTTAATCAACAGGACAATGG - Intergenic
1147037506 17:37692748-37692770 TCTGTGTATCAGCAGGAGAATGG + Intronic
1148533559 17:48418697-48418719 ATTGTTTATCAGCATAAGAATGG + Intronic
1148638745 17:49169166-49169188 AATATGAAGCAGCATGGGAAAGG - Intronic
1148801040 17:50225986-50226008 AATGTTAATCACCAAGACAATGG - Intergenic
1149079051 17:52632378-52632400 AATGTTAATCACCAAGACAATGG + Intergenic
1149112419 17:53049052-53049074 AATGTTAATCACCAAGACAATGG - Intergenic
1149115998 17:53097433-53097455 AATGTTAATCATCAAGACAATGG + Intergenic
1149143111 17:53457912-53457934 AATGTTAATCACCAAGACAATGG + Intergenic
1149190100 17:54050697-54050719 AATGTTAATCACCAAGACAATGG - Intergenic
1149234148 17:54570746-54570768 AATGTTAATCACCAAGACAATGG - Intergenic
1149368698 17:55971166-55971188 AATGAGAATGAGAATGAGAATGG + Intergenic
1149507540 17:57207134-57207156 AATGTTCATCAGCTTAAGAATGG - Intergenic
1150830958 17:68518699-68518721 AATGTTAATCACCAAGACAATGG - Intronic
1151292275 17:73159133-73159155 AATGTGAATCTGCAGGACATGGG + Intergenic
1151501052 17:74489021-74489043 AATGTGAATCCCCAAGACAATGG - Intergenic
1153110569 18:1581303-1581325 AAGGGGACTCAGCATCAGAAAGG - Intergenic
1153455073 18:5271625-5271647 AATGTTAATCACCAAGACAATGG - Intergenic
1153827829 18:8892983-8893005 AATGTTCATCAGTAGGAGAATGG + Intergenic
1155426623 18:25714011-25714033 AATCTGAAGGAGCAAGAGAACGG + Intergenic
1155515945 18:26624276-26624298 AATGTTAATCACCAAGACAATGG + Intronic
1155842939 18:30668469-30668491 AATGTTAATCACCAAGACAATGG - Intergenic
1156052410 18:32952646-32952668 AATGTTAATCATCAAGACAATGG - Intronic
1156265964 18:35488666-35488688 AATGTTAATCACCAAGACAATGG - Intronic
1156784353 18:40892725-40892747 AATGTTAATCACCAAGACAATGG + Intergenic
1156908973 18:42388357-42388379 AATGTCAATCAACAAGAAAATGG - Intergenic
1157135598 18:45051433-45051455 CATGTGAATCAGAATCATAATGG - Intronic
1157355464 18:46929603-46929625 AATGTCCATCAGCAAGAGAAAGG - Intronic
1157512640 18:48289354-48289376 AATGCCCATCAGCAAGAGAATGG + Intronic
1157751820 18:50185708-50185730 AATGCTCATCAGCATGGGAATGG + Intronic
1157843122 18:50977641-50977663 AATGTTAATCACCAAGACAATGG - Intronic
1158083334 18:53620254-53620276 AATGTTAATCAGTAGGAGATGGG - Intergenic
1158222945 18:55169062-55169084 AATGTTAATCACCAAGATAATGG + Intergenic
1158293016 18:55963065-55963087 AATCTGATATAGCATGAGAAGGG + Intergenic
1158299293 18:56033651-56033673 AATGTTAATCACCAAGACAATGG - Intergenic
1158345938 18:56517305-56517327 AATGTGTATCAGGATGTGTAAGG - Intergenic
1158680498 18:59562342-59562364 AATGTGAATCAGAATTAAAGAGG + Intronic
1159138207 18:64361572-64361594 AATGTTAATCACCAAGACAATGG - Intergenic
1159151998 18:64533663-64533685 AATGTTAATCACCAAGACAATGG + Intergenic
1159204500 18:65232839-65232861 AATGTTAATCACCAAGACAATGG + Intergenic
1159282968 18:66310744-66310766 AATGTTAATCACCAAGACAATGG - Intergenic
1159357711 18:67358580-67358602 AATGTTAATCACCAAGACAATGG + Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159555454 18:69940821-69940843 AATGTAAATCACCAAGACAATGG + Intronic
1159640590 18:70859247-70859269 AATGTTAATCATCACGACAATGG + Intergenic
1159838761 18:73372399-73372421 AATGTTAATCACCAAGACAATGG + Intergenic
1160302359 18:77694987-77695009 AATGTCTATCAACAGGAGAATGG - Intergenic
1160627243 18:80219120-80219142 AATGTTAATCACCAAGACAATGG - Intronic
1161142791 19:2658568-2658590 AATATGATTCAGCCTGAAAAAGG + Intronic
1162593278 19:11607047-11607069 AATGTTAATCACCAAGACAATGG - Intronic
1163230037 19:15995555-15995577 AATGTTAATCACCAAGACAATGG + Intergenic
1163953098 19:20609511-20609533 AATGTGCATCAGCAGGTAAATGG + Intronic
1164541519 19:29124791-29124813 AATGTTAATCACCAAGACAATGG - Intergenic
1165180300 19:33961581-33961603 AAAGTGAATTGGCATCAGAAAGG - Intergenic
1166164986 19:40981021-40981043 AATGTTAATCACCAAGACAATGG - Intergenic
1166407857 19:42534604-42534626 AATGTCAATCAGCCTTAAAATGG + Intronic
1166526346 19:43512815-43512837 AATGTTAATCACCAAGACAATGG + Intronic
1167350872 19:48973842-48973864 AATGTGAACCAACAAGAGGAAGG + Intronic
1167540306 19:50082254-50082276 AATGTCAATCAACAGTAGAATGG - Intergenic
1167629398 19:50615542-50615564 AATGTCAATCAACAGTAGAATGG + Intergenic
925312139 2:2892383-2892405 AATGTGTATAAACATGATAAGGG + Intergenic
925456248 2:4018833-4018855 AATGTTAATCACCAAGACAATGG - Intergenic
925498177 2:4476005-4476027 AATGTGAAAAGGCATGAGTAGGG - Intergenic
925724402 2:6859353-6859375 AATGTTAATCACCAAGACAATGG + Intronic
925738059 2:6981195-6981217 AATGTTAATCAGTAAGACAATGG - Intronic
926280657 2:11442943-11442965 AATGTTAATCACCAAGAGAATGG - Intergenic
926391898 2:12402566-12402588 AATGTTAATCACCAAGACAATGG + Intergenic
926949489 2:18226573-18226595 AATGTTAATCACCAAGAAAATGG + Intronic
926986755 2:18632800-18632822 AATGTTAATCACCAAGACAATGG + Intergenic
927302778 2:21535651-21535673 AATGTTAATCACCAAGACAATGG + Intergenic
927528258 2:23768899-23768921 AATGTCCACCAGCATGTGAATGG - Intronic
927556400 2:24036681-24036703 AATGTCAATCAACAAGGGAATGG + Intronic
928071057 2:28217080-28217102 AATGTCAAAGAGCATGACAATGG - Intronic
928290486 2:30032886-30032908 AATGTTAATCAACCAGAGAATGG + Intergenic
928821380 2:35366176-35366198 AATGTTAATCACCAAGACAATGG + Intergenic
928864218 2:35897459-35897481 AATGTTCATCAACATTAGAATGG - Intergenic
928906072 2:36369156-36369178 AATGAGAATCTGCATGCCAAGGG + Intronic
929275510 2:40021094-40021116 AATGTTAATCACCAAGACAATGG + Intergenic
929689233 2:44060602-44060624 AATGTTAATCACCAAGACAATGG - Intergenic
930294001 2:49530498-49530520 AATGTTAATCACCAAGACAAGGG - Intergenic
930310414 2:49732555-49732577 AAAGTTAATCAGCAAGAAAATGG - Intergenic
930427909 2:51234494-51234516 AATGTTAATCACCAAGATAATGG - Intergenic
930942173 2:57026111-57026133 AATGTTAATCACCAAGACAATGG - Intergenic
931041379 2:58304937-58304959 AATGTTAATCACCAAGACAATGG + Intergenic
931176777 2:59861993-59862015 AATGTTAATCAACAAGACAATGG - Intergenic
931316726 2:61139930-61139952 AATGTCCATCAGCAAGAGACTGG + Intergenic
931479393 2:62624917-62624939 AATGTAAATCAGGATGTGTAAGG + Intergenic
931553418 2:63472460-63472482 AATGTGGAACAGAATGACAAAGG - Intronic
931614081 2:64138035-64138057 AATCAGCATCAGCATGGGAAAGG - Intronic
931949896 2:67350414-67350436 AATGTGAATCACCAAGACAATGG - Intergenic
932299703 2:70657631-70657653 AACGTGAATCAGAAGGAGGATGG - Exonic
932458024 2:71862052-71862074 AACGTGAATCAGCATGGGCTGGG - Intergenic
933092407 2:78137648-78137670 AATGTTAATCACCAAGACAATGG + Intergenic
933268195 2:80204193-80204215 AATGTTAATCACTAAGAGAATGG - Intronic
933298130 2:80513948-80513970 AATGTGATTCAGGAGAAGAAAGG - Intronic
934029779 2:88032653-88032675 AATGTCAATCAACAGGTGAATGG + Intronic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
934616931 2:95777548-95777570 AATATGATTCAGCCTTAGAAAGG - Intergenic
934643962 2:96047011-96047033 AATATGATTCAGCCTTAGAAAGG + Intergenic
934837379 2:97603105-97603127 AATATGATTCAGCCTTAGAAAGG + Intergenic
934993731 2:98938644-98938666 GAGGAGACTCAGCATGAGAAGGG + Intergenic
935139836 2:100343433-100343455 AATGTTAATCACCAAGACAATGG + Intergenic
935323101 2:101907340-101907362 AATGTTAATCACCAAGACAATGG - Intergenic
935368792 2:102323077-102323099 AATGTCTATCAACAGGAGAATGG - Intronic
935419801 2:102854930-102854952 AATGTGGATCACCAAGACAATGG - Intergenic
935425848 2:102917459-102917481 AATGTTAATCACCAAGACAATGG - Intergenic
935527278 2:104186336-104186358 AATGTCAATTCACATGAGAAAGG - Intergenic
935615986 2:105082398-105082420 AAGGTTAATCGGCATCAGAAGGG - Intronic
936728993 2:115358082-115358104 AATGTTAATCACCAAGACAATGG - Intronic
936909480 2:117575379-117575401 AATGTTAATCACCAAGACAATGG - Intergenic
936969581 2:118164486-118164508 AATGTTAATCACCAAGACAATGG + Intergenic
937049334 2:118875648-118875670 AATGTCAATCAATCTGAGAAGGG + Intergenic
937768201 2:125686276-125686298 AGAGTGACGCAGCATGAGAAAGG - Intergenic
938417326 2:131114442-131114464 AATGTTAATCACCAAGACAATGG - Intronic
938525189 2:132122815-132122837 AATGTTAATCACCAAGACAATGG - Intergenic
938845283 2:135202072-135202094 AATATTAATCAGTATGGGAATGG + Intronic
939111027 2:138007700-138007722 AATGTGAAACAAGATGAGAAAGG - Intronic
939120585 2:138111370-138111392 AATGATAATCAGTATGAGATTGG - Intergenic
939585098 2:143994543-143994565 AATATTATTCAGCATTAGAAAGG + Intronic
940143714 2:150523468-150523490 AATGTTAATCACCAAGACAATGG + Intronic
940444744 2:153764670-153764692 AATGTTAATCACCATGACAATGG + Intergenic
940505288 2:154546372-154546394 AATGTTAATCACCAAGACAATGG + Intergenic
940578848 2:155550274-155550296 AATGTTAATCACCAAGACAATGG - Intergenic
940620554 2:156107728-156107750 AATGTCCATCAACAGGAGAATGG + Intergenic
940691280 2:156923859-156923881 AATGTTAATCACCAAGAAAATGG + Intergenic
940728369 2:157361632-157361654 AATGTTAATCAGCAAGACAATGG + Intergenic
940731224 2:157395053-157395075 AATGTGAATTAACAAGGGAATGG + Intergenic
940734360 2:157432443-157432465 AATGTCACTGGGCATGAGAAAGG - Intronic
940828890 2:158445408-158445430 ATTGTGATTCAGACTGAGAAAGG - Intronic
941057689 2:160807139-160807161 AATGTTAATCACCAAGATAATGG - Intergenic
941081202 2:161062679-161062701 ATTGTGTATAAGCATGAAAATGG - Intergenic
941319966 2:164041744-164041766 AATGTTAATCACCAAGACAAAGG - Intergenic
941445156 2:165591450-165591472 AATGTTAATCACCAAGACAATGG + Intronic
941513186 2:166438747-166438769 ACTGTGAAACATCATGATAATGG - Intronic
941620441 2:167771862-167771884 AATGCCAATATGCATGAGAAGGG - Intergenic
941649762 2:168080642-168080664 AATGTTAATCACCAAGACAATGG + Intronic
942069408 2:172302542-172302564 AATGTCCATCAGCTGGAGAATGG - Intergenic
942118235 2:172749646-172749668 AATGTTAGTCAGCAAGACAATGG - Intronic
942283329 2:174389633-174389655 AATGTTAATCACCAAGACAAGGG + Intronic
942380448 2:175385755-175385777 AATGTTAATCACCAAGACAATGG + Intergenic
942908035 2:181206839-181206861 AATGTCAATCACCAAGACAATGG - Intergenic
943406453 2:187493467-187493489 AATGTTAATCACCAGGAAAATGG - Intronic
943478240 2:188385491-188385513 AATGTTAATCATCAAGATAATGG - Intronic
943483912 2:188456231-188456253 AATGTTAATCACCAAGACAATGG + Intronic
943550718 2:189336471-189336493 AATGTTCATCATCAAGAGAAAGG + Intergenic
943644334 2:190392546-190392568 AATGTCCATCAACATGTGAATGG - Intergenic
943788110 2:191901180-191901202 AATGTTAATCACCAAGACAATGG + Intergenic
943902624 2:193460263-193460285 AATGTTATTCAGCTTTAGAAAGG - Intergenic
944021788 2:195114386-195114408 AATGTTAATCACCAAGACAATGG + Intergenic
945089871 2:206168824-206168846 AATGTTAATCACCAAGACAAGGG + Intergenic
945135092 2:206618321-206618343 AAAGTGAATCAACAAGAGCAAGG - Exonic
945456287 2:210055925-210055947 AATGTTAATCACCAAGACAATGG + Intronic
945495348 2:210501265-210501287 AATGTTAATCACCAAGACAATGG - Intronic
945593985 2:211768833-211768855 AATGTTAATCACCAAGACAATGG - Intronic
945644026 2:212467262-212467284 AATGTTAATCACCAAGACAATGG + Intronic
945713419 2:213329720-213329742 AATGTTAATCACCAAGACAATGG + Intronic
945724799 2:213463353-213463375 AATGTTAATCACCAAGACAATGG + Intronic
945930946 2:215854406-215854428 AATGTTAATCACCAAGACAATGG + Intergenic
946515448 2:220405883-220405905 AATGTTAATCACCAAGACAATGG - Intergenic
946874447 2:224114031-224114053 AATGTTAATCACCAAGACAATGG + Intergenic
947011574 2:225571749-225571771 AATGTTAATCACCAAGATAATGG - Intronic
947070179 2:226280379-226280401 AATGTTAATCACCAAGACAATGG + Intergenic
947296487 2:228635996-228636018 AATGTTAATCACCAAGACAATGG - Intergenic
947359082 2:229329353-229329375 AATGTCCATCAGCAGGTGAATGG + Intergenic
947599771 2:231439410-231439432 AATGTCCATCAGGAGGAGAATGG - Intergenic
947903047 2:233738836-233738858 AATGTTAATCACCAAGACAATGG + Intronic
947922768 2:233892719-233892741 AATGTTAATCAACAGGAGAATGG + Intergenic
948520133 2:238531342-238531364 AATGTTAATCACCAAGACAATGG + Intergenic
948979963 2:241489112-241489134 AATCTGAATCAACATAAGCAAGG - Intronic
1169086389 20:2826692-2826714 AATGTTCATCAACAAGAGAACGG - Intergenic
1169185187 20:3609761-3609783 AATGTTATTCAGCATTAAAAAGG + Intronic
1169592782 20:7163810-7163832 AATGTTAATCACCAAGACAATGG + Intergenic
1169593991 20:7177090-7177112 AATGTTAATCACCAAGACAATGG - Intergenic
1169609625 20:7364496-7364518 AATGTTAATCACCAAGACAATGG + Intergenic
1169673538 20:8131051-8131073 AATGTCAATCAACAGGTGAATGG - Intergenic
1170310014 20:14982389-14982411 AATGTTAATCACCAAGACAATGG + Intronic
1170337145 20:15282242-15282264 AATGTTAATCACCAAGACAATGG - Intronic
1170641755 20:18160536-18160558 AATGTCCATCAACAGGAGAATGG - Intronic
1170767314 20:19301221-19301243 AATGTGAAAATGCATGTGAAAGG + Intronic
1170938493 20:20829778-20829800 AATGTTAATCACCAAGACAATGG + Intergenic
1172720201 20:36994304-36994326 AATGTTAATCACCAAGACAATGG + Intergenic
1172893241 20:38281836-38281858 AATGTTAATCACCAAGACAATGG - Intronic
1173412701 20:42828483-42828505 AATGTTAATCACCAAGACAAGGG + Intronic
1174195243 20:48768272-48768294 AATGTCCATCAACAGGAGAACGG + Intronic
1175037975 20:56018236-56018258 AAGGTGAATCAGCATAAAATGGG + Intergenic
1175287501 20:57846847-57846869 AATGTGCATCAACAGGAGAATGG - Intergenic
1176657755 21:9602898-9602920 AATGTTAATCACCAAGACAATGG - Intergenic
1176676114 21:9778960-9778982 AATCTGAGTCAGGATGAGGAAGG + Intergenic
1176883709 21:14229499-14229521 AATGTTAATCACCATGACAATGG + Intergenic
1177085299 21:16695364-16695386 AATGTTAATCACCAAGATAATGG - Intergenic
1177117102 21:17099831-17099853 ATTATGAATCAGCAGAAGAAAGG - Intergenic
1177144897 21:17396944-17396966 AAGGAGATTCAACATGAGAAAGG + Intergenic
1177223060 21:18218560-18218582 AATGTTAATCACCAAGACAATGG - Intronic
1177238682 21:18428405-18428427 AATGTTAATCACCAAGACAATGG + Intronic
1177408273 21:20698719-20698741 AATGTTAATCACCAAGACAATGG + Intergenic
1177496199 21:21895062-21895084 AATGTTAATCAGCAAGACAATGG - Intergenic
1177599175 21:23288850-23288872 AATGTTAATCACCAGGACAATGG + Intergenic
1177628726 21:23700102-23700124 AATGCTAATCACCATGACAATGG + Intergenic
1178099643 21:29253496-29253518 AATGTGAATCCCCAAGACAATGG - Intronic
1178143905 21:29716833-29716855 AATGTTAATCACCAAGACAATGG + Intronic
1178338553 21:31765991-31766013 AATGTTAATCACCAAGACAACGG + Intergenic
1178711359 21:34919830-34919852 AATGTGAATCAAATTGTGAAAGG + Intronic
1179992651 21:44956690-44956712 AAGGAAAATCAGCATGAGACCGG - Intronic
1180436236 22:15307287-15307309 AATGTTAATCACCAAGACAATGG + Intergenic
1180518479 22:16171483-16171505 AATGTTAATCACCAAGACAATGG + Intergenic
1180571087 22:16720413-16720435 AATGAGTATGAGCATGAAAATGG - Intergenic
1181857866 22:25795155-25795177 AATGTCTATCAGCAGGAGAATGG - Intronic
1182650694 22:31848689-31848711 AATGTTAATCACCAAGACAATGG - Intronic
1182815122 22:33155729-33155751 AATGTTAATCACCAAGACAAAGG + Intergenic
1183068151 22:35377932-35377954 AGGCTGAATCAGCATGCGAAAGG + Intergenic
1183222068 22:36521553-36521575 AATGTTCATCAGCATGTGAATGG + Intronic
1184883555 22:47327899-47327921 AATGTCACTCAGCCTCAGAAAGG + Intergenic
949156299 3:830686-830708 AATGTGAATCACCAAGACAATGG - Intergenic
949495562 3:4628453-4628475 AAGGTGAAACAGGATGAGAGAGG - Intronic
949623665 3:5844752-5844774 AATGTTAATCACCAAGACAATGG - Intergenic
949662224 3:6292212-6292234 AATGTGAATCACCAAGACAATGG - Intergenic
950245060 3:11407934-11407956 AATGTTAATCACCAAGACAATGG - Intronic
950275980 3:11661272-11661294 AAACTGAGTCATCATGAGAAAGG + Intronic
950412157 3:12846070-12846092 AATGTTAATCACCAAGACAATGG + Intronic
950627204 3:14256239-14256261 AATGTCCATCATCAGGAGAATGG - Intergenic
951013903 3:17708357-17708379 AATGTCCATCAGCAGGGGAATGG - Intronic
951137863 3:19124896-19124918 AATGTCAATCAACAATAGAAAGG + Intergenic
951290026 3:20863649-20863671 AATGTTAATCACCAAGACAATGG - Intergenic
951317515 3:21205031-21205053 AATGTTAATCACCAAGACAATGG + Intergenic
951407452 3:22317768-22317790 AATGTGAATCAGGCTGGGCATGG + Intronic
951643918 3:24866558-24866580 AACCAGAATCAGCAAGAGAAGGG + Intergenic
951969624 3:28429595-28429617 AATGTTAATCACCAAGACAATGG + Intronic
952141103 3:30480204-30480226 AATGTTAATCACCAAGACAATGG + Intergenic
952198551 3:31101507-31101529 AATGTTAATCACCAGGACAATGG - Intergenic
952480283 3:33754081-33754103 AATGTTAATCACCAAGACAATGG - Intergenic
952575773 3:34772958-34772980 AATGTTAATCACCAAGACAATGG + Intergenic
952831469 3:37568409-37568431 AATGTTAATCGCCATGACAATGG - Intronic
952939764 3:38433370-38433392 AATGTTAATCACCAAGACAATGG - Intergenic
952973963 3:38678499-38678521 AAAGAGAATCAGAATGGGAAGGG + Intergenic
953000576 3:38929250-38929272 AATATTAATCAGCCTGAAAAAGG + Intronic
953131136 3:40139940-40139962 AATGTTCATCAGCAGGTGAATGG - Intronic
953376591 3:42433528-42433550 AATGTCCATCAACAGGAGAATGG + Intergenic
953710027 3:45262146-45262168 AATGTCTATCAACAGGAGAAAGG + Intergenic
954482106 3:50809646-50809668 AATGTTCATCAGCAGTAGAATGG + Intronic
954571576 3:51645353-51645375 AATTTGAATCAGAATGAGATAGG - Intronic
955465319 3:59230680-59230702 AATGTTAATCACCAAGACAATGG - Intergenic
955547023 3:60041903-60041925 AATGAGAATAAGAATTAGAAGGG - Intronic
955826235 3:62951139-62951161 AATGTTAATCAACAAGACAATGG + Intergenic
956169597 3:66422183-66422205 AATGTTAATCACCAAGACAATGG - Intronic
956262581 3:67361371-67361393 AAAGTCTAGCAGCATGAGAAGGG + Intronic
956363155 3:68470862-68470884 AATGTTAATCACCAAGACAAAGG + Intronic
956375470 3:68609037-68609059 AATGTTAATCACCAAGACAATGG - Intergenic
956391587 3:68779374-68779396 AATGTTAATCACCAAGACAATGG + Intronic
956492643 3:69790022-69790044 AATGTCCATCAGCAGGTGAATGG + Intronic
956558863 3:70551369-70551391 AATGTTAATCACCAAGACAATGG - Intergenic
956577055 3:70763628-70763650 AATGTGGATCAGCGTGAGCATGG + Intergenic
957066662 3:75528298-75528320 AATGTGAATCCCCAAGACAATGG - Intergenic
957107090 3:75903995-75904017 AATGAGCATGAGCATGAAAATGG + Intergenic
957113118 3:75992170-75992192 AATGTTAATCACCAAGACAATGG + Intronic
957374259 3:79336214-79336236 AATGTTAATCACCAAGACAATGG + Intronic
957629399 3:82699393-82699415 AATGTTCATTAGCAAGAGAATGG - Intergenic
957703945 3:83755731-83755753 AATGTTAATCCCCAAGAGAATGG + Intergenic
957909455 3:86603381-86603403 AATGTTAATCACCAAGACAATGG + Intergenic
958005997 3:87812621-87812643 AATGTTAATCACCAAGACAATGG + Intergenic
958060523 3:88474187-88474209 AATGTTAATCACCAAGACAATGG + Intergenic
958152152 3:89704389-89704411 AATGTTAATCACCAAGACAATGG - Intergenic
958157361 3:89771716-89771738 AATGTTAATCACAATGATAATGG - Intergenic
958583860 3:96061287-96061309 AATGTTAATCACCAAGACAATGG + Intergenic
958637416 3:96763176-96763198 AATGTTAATCACCAAGACAATGG + Intergenic
958688117 3:97425641-97425663 AATGTTAATCACCAAGACAATGG - Intronic
958823535 3:99003007-99003029 AATGTTAATCACCAAGACAATGG - Intergenic
958831718 3:99098488-99098510 AATGTTAATCCCCATGACAATGG + Intergenic
958910042 3:99984019-99984041 TATGTTAATTAGCATGAAAAAGG + Intronic
958911183 3:99995971-99995993 AATGTTAATCACCAAGACAATGG - Intronic
959031871 3:101308680-101308702 AATGTTAATCACCAAGACAATGG - Intronic
959229649 3:103632063-103632085 AATGTTAATCACCAAGACAATGG + Intergenic
959439658 3:106360251-106360273 AATGTTAATCACCAAGACAATGG + Intergenic
959730066 3:109590911-109590933 AATGTTAATCACCAAGACAATGG - Intergenic
959742621 3:109737766-109737788 AATGTTAATCACCAAGATAATGG - Intergenic
959785739 3:110295175-110295197 AATGTTAATCAACAAGACAATGG - Intergenic
959838667 3:110949492-110949514 AATGTGAATCACCAAGACAATGG - Intergenic
959846535 3:111040262-111040284 AATGTTAATCACCACGACAATGG + Intergenic
959851752 3:111096490-111096512 AATGTTAATCATCAAGACAATGG + Intronic
960492310 3:118332805-118332827 AATGTTAATCAACAAGACAATGG + Intergenic
960502811 3:118457384-118457406 AATGGAAATGAGAATGAGAAAGG + Intergenic
960510001 3:118538197-118538219 AATGTGAATGAGCAAAATAATGG + Intergenic
961067860 3:123891260-123891282 AATGTTAATCCCCATGACAATGG - Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961286486 3:125809756-125809778 AATGTGAATCCCCAAGACAATGG + Intergenic
961503869 3:127357137-127357159 AATGTTAATCACCAAGACAATGG - Intergenic
961720242 3:128889686-128889708 AATATGACTCAGCATTAAAAAGG - Intronic
961839596 3:129697518-129697540 AATGTTAATCACCAAGACAATGG - Intronic
961900285 3:130203214-130203236 AATGTGAATCTCCAAGACAATGG - Intergenic
962139208 3:132770919-132770941 AATGTGAGTCAGCAAGTGAATGG + Intergenic
962294755 3:134172994-134173016 AATATGAATGATTATGAGAAGGG - Intronic
962460960 3:135612435-135612457 AATGTTAATCACCAAGACAATGG + Intergenic
962724028 3:138204353-138204375 AATTTGATGCTGCATGAGAAGGG - Intronic
963072887 3:141319339-141319361 AATGTTAATCTGCAAGACAATGG - Intergenic
963539534 3:146567373-146567395 AATGTTAATCACCAAGACAATGG - Intergenic
963683607 3:148410756-148410778 AATGTTAATCACCAAGACAATGG - Intergenic
963846038 3:150159076-150159098 AGTGTGAAGCAGCAGAAGAATGG - Intergenic
963878382 3:150501523-150501545 AATGTTAATCACCAAGACAATGG - Intergenic
963952778 3:151221373-151221395 AATGTTAATCACCAAGAAAATGG + Intronic
964274516 3:154995350-154995372 AATGTTAATCACCAAGACAATGG - Intergenic
964279919 3:155052738-155052760 AATGTTAATCACCAAGACAATGG - Intronic
964456983 3:156879594-156879616 AATGTTAATCACCAAGACAATGG + Intronic
964605463 3:158556019-158556041 AATGTTAATCACCAAGACAATGG + Intergenic
964897162 3:161612557-161612579 AATGTTAATCAGAAAGACAATGG + Intergenic
964912693 3:161801416-161801438 AATGTTAATCACCAAGACAATGG - Intergenic
964924956 3:161944295-161944317 AATGTAAATTAGTATGAGTAAGG - Intergenic
964926353 3:161963351-161963373 AATGTTAATCACCAAGACAATGG + Intergenic
965028777 3:163336006-163336028 AATGTTAATCACCAAGATAATGG - Intergenic
965066570 3:163857770-163857792 AATGTTAATCACCAAGAAAATGG + Intergenic
965090049 3:164150038-164150060 AATGTTAATCACCAAGACAATGG - Intergenic
965108477 3:164388532-164388554 AATGTTAATCACCAAGACAAAGG - Intergenic
965189236 3:165506728-165506750 AATGTTAATCACCAGGAAAATGG - Intergenic
965198794 3:165631029-165631051 AATGTTAATCACCAAGACAATGG + Intergenic
965237757 3:166148429-166148451 AATGTTCATCAGCAGGTGAAAGG + Intergenic
965275521 3:166677381-166677403 AATGTTAATCAACAAGACAATGG - Intergenic
965714210 3:171585412-171585434 AATGTCCATCAGCAGGAGAGTGG + Intergenic
965777105 3:172242748-172242770 AATGTTAATCCGCAAGACAATGG - Intronic
965929741 3:174028760-174028782 AATGTTAATCACCAAGACAATGG + Intronic
965968965 3:174529953-174529975 AATGTTAATCACCAAGACAATGG - Intronic
966741925 3:183242294-183242316 AATGTTAATCACCAAGACAAAGG + Intronic
967462345 3:189761146-189761168 AATGTTAATCACCAAGACAATGG - Intronic
967505303 3:190246417-190246439 AATGTTAATCACCAAGACAATGG - Intergenic
967624100 3:191665993-191666015 CATGTGAATGATAATGAGAATGG + Intergenic
967633822 3:191777995-191778017 AATGTTAATCACCAAGACAATGG + Intergenic
967672277 3:192251588-192251610 AATGTCTATCATCAGGAGAATGG + Intronic
967777080 3:193395637-193395659 AATGTTAATCACCAAGACAATGG - Intergenic
968392175 4:202912-202934 AATGTTAATCACCAAGACAATGG + Intergenic
968753840 4:2404454-2404476 AATGTCCATCAGCAGGTGAATGG + Intronic
969011264 4:4064364-4064386 AATGTGAATCCCCAAGACAATGG - Intergenic
969190365 4:5513354-5513376 AATGTTAATCAGCAAGACAATGG - Intergenic
969742817 4:9045534-9045556 AATGTGAATCCCCAAGACAATGG + Intergenic
969904617 4:10382725-10382747 AATGTTAATCAGCAAGACAGTGG + Intergenic
970659264 4:18265460-18265482 AATGTTAATCACCAAGACAATGG - Intergenic
970758190 4:19451221-19451243 AATGTTAATCACCAAGACAATGG - Intergenic
970784935 4:19784075-19784097 AATGTTAATCACCAAGACAATGG - Intergenic
970801381 4:19976773-19976795 AATGTTAATCACCAAGACAATGG - Intergenic
970987693 4:22177051-22177073 AATGTTAATCACCAAGACAATGG - Intergenic
971022034 4:22546538-22546560 AATGTTAATCACCAAGACAACGG - Intergenic
971119587 4:23689191-23689213 AATGTTAATCACCAAGACAATGG + Intergenic
971147601 4:23995779-23995801 AATGACAATCAGGATGAGGAAGG - Intergenic
971546235 4:27890869-27890891 AATGTTAATCACCAAGACAATGG + Intergenic
971681546 4:29706971-29706993 AATGTTAATCACCAAGACAATGG - Intergenic
971710604 4:30106047-30106069 AATGTTAATCACCAAGACAATGG - Intergenic
971900362 4:32650403-32650425 AATGTTAATCACCAAGACAATGG - Intergenic
972012793 4:34205800-34205822 AATGTTAATCACCAAGACAATGG + Intergenic
972038517 4:34557900-34557922 AATGTACCTCAGTATGAGAAAGG + Intergenic
972057905 4:34827028-34827050 AATGTTAATCACCAAGACAATGG - Intergenic
972137309 4:35908342-35908364 AATGTTAATCACCAAGACAATGG + Intergenic
972483264 4:39518239-39518261 AATATTAATCAGCAATAGAATGG - Intronic
972484817 4:39530978-39531000 AATGTTAATCACCAAGACAATGG - Intergenic
972582382 4:40406456-40406478 AATGTTAATCACCAAGACAATGG + Intergenic
972757003 4:42057658-42057680 AATGTTAATCACCAAGAAAAGGG - Intronic
972872073 4:43312835-43312857 AATGTTAATCACCAAGACAATGG + Intergenic
972879470 4:43406455-43406477 AATGCTAATCACCAGGAGAATGG + Intergenic
972890687 4:43553271-43553293 AATGTTAATCACCAAGACAATGG + Intergenic
973022828 4:45224935-45224957 AATGTTAATCACCATGACAATGG + Intergenic
973176858 4:47216950-47216972 AATATTTATCAGCAAGAGAATGG + Intronic
974206055 4:58704974-58704996 AATGTCAATCACCAAGACAATGG + Intergenic
974279506 4:59774477-59774499 GATGTCAAACAGGATGAGAATGG + Intergenic
974587379 4:63896582-63896604 AATGTTAATCACCAAGACAATGG - Intergenic
974628514 4:64453937-64453959 AATGTTAATCACCAAGACAATGG - Intergenic
974779098 4:66528622-66528644 AATGTTAATCACCAAGACAATGG + Intergenic
974843337 4:67323112-67323134 AATGTTAATCACCAAGACAAAGG + Intergenic
974846078 4:67352137-67352159 AATGTTAATCAGCAAGACAATGG - Intergenic
974867307 4:67596991-67597013 AATGTTAATCACCAAGACAATGG + Intronic
974897557 4:67957737-67957759 AATGTTAATCACCAAGACAATGG + Intronic
974960418 4:68692322-68692344 AATGTTAATCACCAAGACAATGG - Intergenic
974972226 4:68844684-68844706 AATGTTAATCAACAAGACAATGG + Intergenic
975046175 4:69807437-69807459 AATGTTAATCATCAAGACAATGG + Intergenic
975052610 4:69884044-69884066 AAAGTTAATCACCAAGAGAATGG - Intergenic
975257507 4:72255393-72255415 AATGTTAATCACCATGACAATGG + Intergenic
975456436 4:74597004-74597026 AATGTTAATCACCAAGACAACGG + Intergenic
975481988 4:74890960-74890982 AATAGGAATAAGGATGAGAAGGG + Intergenic
975658124 4:76661770-76661792 AATGTCCATCAGTAGGAGAATGG - Intronic
976277115 4:83289362-83289384 AATGTGAATCACCAAGACAATGG + Intergenic
976283404 4:83347250-83347272 AATGTTAATCACCAGGACAATGG - Intergenic
976332889 4:83852202-83852224 AATGTGAATCAGCAACAGTCTGG + Intergenic
976442215 4:85088877-85088899 AATGTTAATCACCAAGACAATGG + Intergenic
976446496 4:85136040-85136062 ACTATAAATCAGCATGAGATTGG - Intergenic
976581398 4:86740615-86740637 AATGTTAATCACCAAGACAATGG - Intronic
976715597 4:88119940-88119962 AATGTTAATCACCAAGACAATGG + Intronic
976726618 4:88221913-88221935 AATGTTAATCACCAAGACAATGG + Intronic
977006118 4:91570785-91570807 AATGTTAATCAGCAAGACAATGG - Intronic
977021414 4:91765218-91765240 AATGTTAATCACCAAGACAATGG + Intergenic
977197561 4:94081667-94081689 AATGTTAATCACCAAGACAATGG - Intergenic
977356452 4:95952827-95952849 AATGTTAATCACCAAGACAATGG - Intergenic
977402182 4:96546664-96546686 AATGTTCATCAGTATGAGAATGG - Intergenic
977435399 4:96989054-96989076 AATGTTAATCACCAAGACAATGG + Intergenic
977521073 4:98084345-98084367 AATGTTAATCAGTAGGGGAATGG - Intronic
977615065 4:99079253-99079275 AATGTCCATCAACAGGAGAATGG + Intronic
977654029 4:99501636-99501658 AATGTCCATCAACATGAGAATGG + Intergenic
977850357 4:101820259-101820281 AATATGTATCAGCATGAGTTTGG - Intronic
977952897 4:102994063-102994085 AATGTTAATCACCAAGACAATGG - Intronic
977965412 4:103141471-103141493 AATGTCTATCAGCAGGAAAATGG - Intronic
978057234 4:104285878-104285900 AATTTGAAACACCATGAGTAAGG + Intergenic
978210670 4:106132143-106132165 AATGTTAATCACCAAGACAATGG + Intronic
978903995 4:113985195-113985217 AATGTTAATCACCAAGACAATGG + Intergenic
978983625 4:114982730-114982752 AATGTTAATCACCAAGACAATGG + Intronic
978991188 4:115084439-115084461 AATGTTAATCACCAAGACAATGG + Intronic
979004361 4:115272041-115272063 AATGTTCATCAACATTAGAATGG - Intergenic
979038325 4:115754273-115754295 AATGTTAATCACCAAGACAATGG + Intergenic
979065971 4:116133148-116133170 AATGTTAATCACCAGGACAATGG - Intergenic
979137450 4:117127733-117127755 AGTGTTAATCAGCAAGACAATGG + Intergenic
979139254 4:117151533-117151555 AATGTCAATCACCAAGACAATGG - Intergenic
979177085 4:117678992-117679014 AATGTTAATCACCAAGACAATGG + Intergenic
979776396 4:124593624-124593646 AATGTTAATCACCAAGACAATGG + Intergenic
979895924 4:126156892-126156914 AATGTTAATCACCAAGACAATGG - Intergenic
979966827 4:127086347-127086369 AATGTTAATCACCAAGACAATGG + Intergenic
979984439 4:127296216-127296238 AATGTTAATCACCAAGACAATGG - Intergenic
980065028 4:128177916-128177938 AATGTCTATCTGCAGGAGAATGG + Intronic
980242264 4:130191739-130191761 AATGTTAATCACCAAGACAATGG - Intergenic
980255984 4:130381826-130381848 AATGTTAATCACCAAGACAATGG + Intergenic
980266591 4:130524333-130524355 AATGTTAATCACCAAGAAAAGGG - Intergenic
980308806 4:131100695-131100717 AATGTGAATCCCCAAGACAATGG + Intergenic
980324418 4:131323785-131323807 AATGTTAATCACCAAGACAATGG + Intergenic
980346790 4:131632948-131632970 AATGTTAATCACCAAGACAATGG + Intergenic
980545846 4:134260375-134260397 AATGTTAATCACCAAGACAATGG - Intergenic
980654115 4:135759682-135759704 AATGTTAATCACCAAGACAATGG - Intergenic
980686513 4:136237188-136237210 AATGTTAATCACCAAGACAATGG + Intergenic
980850461 4:138374580-138374602 AATGTTAATCACCAAGACAATGG - Intergenic
981359572 4:143831308-143831330 AATGTTAATCACCAAGACAATGG + Intergenic
981370334 4:143952376-143952398 AATGTTAATCACCAAGACAATGG + Intergenic
981380093 4:144062300-144062322 AATGTTAATCACCAAGACAATGG + Intergenic
981590832 4:146358760-146358782 AATGTCCATCATCAGGAGAATGG - Intronic
981822116 4:148898416-148898438 AATGTTAATCACCAAGACAATGG - Intergenic
982301149 4:153880811-153880833 AATGTTAATCACCAAGACAATGG + Intergenic
982609044 4:157550975-157550997 AATGTTAATCACCAAGACAATGG + Intergenic
982610117 4:157562894-157562916 ACTGTGATTCAGCATGTCAAAGG - Intergenic
982920458 4:161267424-161267446 AATGTTAATCACCAAGACAATGG - Intergenic
982987816 4:162232621-162232643 AATGTGAATCTCCAAGACAATGG - Intergenic
983164519 4:164459377-164459399 AATGTTAATCACCAAGACAATGG + Intergenic
983393870 4:167168742-167168764 AATGTTAATCACCAAGACAATGG + Intronic
983419283 4:167496731-167496753 AATGTTAATCACCAAGACAATGG - Intergenic
983564887 4:169139499-169139521 CATGTTAATCAGCAGTAGAATGG - Intronic
983825077 4:172249482-172249504 AATGTTAATCACCAAGACAATGG + Intronic
983854945 4:172632686-172632708 AATGTTAATCACCAAGACAATGG + Intronic
984031706 4:174612364-174612386 AATGTTAATCCCCATGACAACGG - Intergenic
984318624 4:178161590-178161612 AATGTTAATCACCAAGACAATGG - Intergenic
984353276 4:178622383-178622405 AATGTTAATCACCAAGACAATGG - Intergenic
984454230 4:179944972-179944994 AATGTTAATCACCAAGACAATGG + Intergenic
984895040 4:184530933-184530955 AATGTCTATCAGCAGGTGAATGG - Intergenic
985159899 4:187033879-187033901 AATGTTAATCACCAAGACAATGG + Intergenic
985189384 4:187355288-187355310 GATGAGAATAAGAATGAGAACGG - Intergenic
985399414 4:189579786-189579808 AATCTGAGTCAGGATGAGGAAGG - Intergenic
985417654 4:189753188-189753210 AATGTTAATCACCAAGACAATGG + Intergenic
985431873 4:189888679-189888701 AATGTTAATCACCAAGACAATGG - Intergenic
985811482 5:2093012-2093034 AATGTTAATCAACAAGTGAATGG + Intergenic
986137892 5:4999557-4999579 AATGTTAATCACCAAGACAATGG - Intergenic
986188409 5:5468009-5468031 AATGTCCATCAGCAGGTGAATGG + Intronic
986258765 5:6124212-6124234 AATGTTAATCACCAAGACAATGG - Intergenic
986341864 5:6795898-6795920 AATGTGTATCAACAAGAGAAAGG - Intergenic
986557613 5:9027166-9027188 AATGTAAATCACCAAGACAATGG + Intergenic
986801998 5:11270635-11270657 CATGAGAAGCAGCATTAGAAAGG + Intronic
986852392 5:11829283-11829305 AATGTTAATCACCAAGACAATGG + Intronic
987016660 5:13827295-13827317 AATGTTAATCACCAAGACAATGG + Intronic
987216629 5:15744110-15744132 AATGTTAATCACCAAGACAATGG - Intronic
987315704 5:16721212-16721234 TTTGTGAATCAGCAAGAGGAGGG - Intronic
987511728 5:18848006-18848028 AATGTTAATCACCAAGACAATGG - Intergenic
987560357 5:19511893-19511915 AATGTTAATCACCAAGACAATGG + Intronic
987659506 5:20854702-20854724 AATGTTAATCACCAAGAAAATGG + Intergenic
987709094 5:21486279-21486301 AATGTTAATCACCAAGACAATGG - Intergenic
987851633 5:23362318-23362340 AATGCGAATCACCAAGACAATGG - Intergenic
988047872 5:25981316-25981338 AATGTCAAAAACCATGAGAAGGG - Intergenic
988091144 5:26542548-26542570 AATGTTAATCACCAAGACAATGG - Intergenic
988099305 5:26657172-26657194 AATGTTAATCACCAAGACAATGG - Intergenic
988649368 5:33131562-33131584 AATGTTAATCACCAAGATAATGG + Intergenic
988750518 5:34187874-34187896 AATGTTAATCACCAAGACAATGG + Intergenic
988764142 5:34350945-34350967 AATGTTAATCACCAAGAAAATGG - Intergenic
988872218 5:35403212-35403234 AATGTAAATAATTATGAGAAAGG - Intergenic
988886097 5:35559424-35559446 AATGTTAATCACCAAGACAATGG - Intergenic
988911278 5:35846042-35846064 AATGTTAATCACCAGGACAATGG - Intergenic
989067856 5:37481687-37481709 AATGTTAATCACCAAGACAATGG - Intronic
989656830 5:43753713-43753735 AATGTTAATCACCAAGACAATGG - Intergenic
989673470 5:43946683-43946705 AATGTTAATCACCAAGACAATGG - Intergenic
989971911 5:50535237-50535259 AATTTGAACCTTCATGAGAAAGG + Intergenic
990021078 5:51128337-51128359 AATGTTAATCACCAAGACAATGG + Intergenic
990143314 5:52730835-52730857 AATGTTAATCACCAAGACAATGG + Intergenic
990566196 5:57031897-57031919 AATGTGCATCATTAGGAGAATGG - Intergenic
990701122 5:58475699-58475721 AATGTTAATCACCAAGACAATGG - Intergenic
990729780 5:58795703-58795725 AATGGAAATCACCATTAGAAGGG - Intronic
991206833 5:64059593-64059615 AATGTTAATCACCAAGACAACGG + Intergenic
991536204 5:67671860-67671882 AATGGGAATCAGCATTTCAAGGG - Intergenic
991586934 5:68211099-68211121 AATGTTAATCACCAAGATAATGG - Intergenic
991735655 5:69629788-69629810 AATGTTAATCACCAAGACAATGG + Intergenic
991738780 5:69651072-69651094 AATGTTAATCACCAAGACAATGG + Intergenic
991759417 5:69905355-69905377 AATGTTAATCACCAAGACAATGG - Intergenic
991787918 5:70212763-70212785 AATGTTAATCACCAAGACAATGG + Intergenic
991790355 5:70230813-70230835 AATGTTAATCACCAAGACAATGG + Intergenic
991812146 5:70485427-70485449 AATGTTAATCACCAAGACAATGG + Intergenic
991815104 5:70505904-70505926 AATGTTAATCACCAAGACAATGG + Intergenic
991818240 5:70527189-70527211 AATGTTAATCACCAAGACAATGG + Intergenic
991838645 5:70780421-70780443 AATGTTAATCACCAAGACAATGG - Intergenic
991880364 5:71213127-71213149 AATGTTAATCACCAAGACAATGG + Intergenic
991882805 5:71231153-71231175 AATGTTAATCACCAAGACAATGG + Intergenic
992215786 5:74523774-74523796 AATGTTAATCACCAAGACAATGG + Intergenic
992864654 5:80945590-80945612 AATGTCCATCAGCAGGTGAATGG + Intergenic
993036913 5:82769036-82769058 AATGTTAATCGGCAAGACAATGG + Intergenic
993067173 5:83114250-83114272 AATGTTAATCACCAAGACAATGG - Intronic
993200756 5:84812586-84812608 AATGTTAATCACCAAGACAATGG + Intergenic
993208753 5:84921171-84921193 AATGTTAATCACCAAGAAAATGG + Intergenic
993225865 5:85166944-85166966 AATGTTAATCACCAAGACAAGGG + Intergenic
993517473 5:88856472-88856494 AATGTTAATCACCAAGACAATGG + Intronic
993801735 5:92351287-92351309 AATGTTAATCACCAAGATAATGG + Intergenic
993945851 5:94116436-94116458 AATGTTAATCACCAAGACAATGG + Intergenic
994076946 5:95663120-95663142 AATGTCCATCAGCAGTAGAATGG + Intronic
994276274 5:97842305-97842327 AAAGTGGAGCAGCATCAGAAAGG - Intergenic
994412820 5:99431039-99431061 AAGGGAAATCAGCAGGAGAACGG - Intergenic
994421221 5:99527622-99527644 AATGTTAATCACCAAGACAATGG - Intergenic
994481021 5:100334681-100334703 AAGGGAAATCAGCAGGAGAACGG + Intergenic
994485820 5:100386692-100386714 AATGTTAATCACCAAGACAATGG + Intergenic
994764481 5:103899841-103899863 AATGTTAATCACCAAGACAATGG + Intergenic
994823265 5:104680448-104680470 AATGTTAATCACCAAGACAATGG + Intergenic
994878947 5:105461259-105461281 AATGTTAATCACCAAGACAATGG - Intergenic
995055354 5:107753514-107753536 AATGTTAATCACCAAGATAATGG + Intergenic
995113457 5:108453667-108453689 AATGTTAATCACCAAGACAATGG + Intergenic
995147714 5:108805945-108805967 AATGTTAATCACCAAGACAATGG + Intronic
995390920 5:111639737-111639759 AATGTTAATCACCAAGACAATGG + Intergenic
995429053 5:112054515-112054537 AATGTTAATCACCAAGAAAATGG + Intergenic
995576773 5:113544906-113544928 AATATGAATCAATATGACAATGG - Intronic
995591040 5:113699689-113699711 AATGTTAATCACCAAGACAATGG - Intergenic
995627284 5:114092957-114092979 AATGTTAATCACCAAGACAATGG - Intergenic
995691010 5:114825597-114825619 AATGTTAATCACCAAGACAATGG - Intergenic
995703643 5:114962315-114962337 AATATGAATCACCAAGACAATGG - Intergenic
995872246 5:116755916-116755938 AATGTTAATCACCAAGACAATGG + Intergenic
995925501 5:117369114-117369136 AATGTTAATCATGATGACAATGG + Intergenic
996177526 5:120378325-120378347 AATGTTAATCACCAAGACAATGG + Intergenic
996222342 5:120949584-120949606 AATGTTAATCACCAAGACAATGG + Intergenic
996257837 5:121426904-121426926 AATGTTAATCACCAAGACAATGG - Intergenic
996419363 5:123244918-123244940 AATGCGCATCATCATCAGAAAGG + Intergenic
996534399 5:124562167-124562189 AATGTGAATCAACTTGAGATTGG - Intergenic
996605784 5:125319988-125320010 AATGTCTATCAACAGGAGAATGG - Intergenic
996774792 5:127121481-127121503 AATGTTAATCACCAAGACAATGG - Intergenic
996967353 5:129321499-129321521 AATGTTAATCACCAAGACAATGG - Intergenic
997088377 5:130827312-130827334 AATGTTAATCACCAAGACAATGG - Intergenic
997102127 5:130980827-130980849 AATGTTAATCACCAAGACAATGG - Intergenic
997125105 5:131218301-131218323 GATATTAATCATCATGAGAATGG + Intergenic
997651394 5:135523987-135524009 AATGTTAATCACCAAGACAATGG - Intergenic
997689850 5:135821053-135821075 AAGGTGAACCAGCCTGAAAAGGG - Intergenic
997883619 5:137612115-137612137 GATGTGAAGCAGCATGGAAAGGG - Intergenic
998192711 5:140041303-140041325 AATTTGAATAAGCACGAGACAGG + Intronic
998209588 5:140184331-140184353 AATGTTCATCAATATGAGAATGG - Intronic
998554743 5:143112303-143112325 AATGGGGATCAGCATTAGGAAGG + Intronic
998756287 5:145384356-145384378 AATGTTCATCAACAGGAGAATGG + Intergenic
998756989 5:145391598-145391620 AATGTTAATCACCAAGACAATGG - Intergenic
998980839 5:147700464-147700486 AATGGAAATCAGAGTGAGAAAGG + Intronic
999110792 5:149119485-149119507 AATGTGACACAGCATGGGAATGG + Intergenic
999589687 5:153131345-153131367 AATGTTAATCACCAAGACAATGG - Intergenic
1000016443 5:157282004-157282026 AATATGAAGCAGCAGGAAAATGG - Intronic
1000103065 5:158035367-158035389 AATGTTAATCACCAAGACAATGG + Intergenic
1000121427 5:158201613-158201635 TCTGTGAGTCAGGATGAGAAAGG - Intergenic
1000522783 5:162318695-162318717 AATGTTAATCACCAAGACAATGG + Intergenic
1001094758 5:168767660-168767682 AATGAACGTCAGCATGAGAATGG - Intronic
1002869757 6:1156500-1156522 AATGTTAATCACCAAGACAATGG + Intergenic
1003230094 6:4243833-4243855 AATGTTAATCACCAAGATAATGG - Intergenic
1003268995 6:4590920-4590942 CCTGTGAGTCTGCATGAGAAAGG - Intergenic
1003310678 6:4967333-4967355 AATGTCCATCAACAGGAGAATGG + Intergenic
1003690144 6:8346136-8346158 AATGTAAATCACCAAGACAATGG + Intergenic
1003883483 6:10499486-10499508 AATGTCTATCAGCAGGTGAATGG - Intronic
1004177601 6:13353749-13353771 AATGAGATCCAGCATTAGAAGGG + Intergenic
1004798923 6:19123421-19123443 AATGTTACTCAGCACGAAAAAGG + Intergenic
1005141572 6:22637835-22637857 ACTGTGCATCATCACGAGAAGGG - Intergenic
1005159820 6:22845910-22845932 AATTTTAATCAGCTTGAAAATGG - Intergenic
1005180137 6:23095456-23095478 AATGTTAATCACCAAGACAATGG + Intergenic
1005296114 6:24428979-24429001 GATGTGATTCAGCATGAGAGAGG + Exonic
1005548587 6:26894179-26894201 AATGTTAATCACCAAGACAATGG + Intergenic
1005783358 6:29217349-29217371 AATGTTAATCACCAAGACAATGG + Intergenic
1005984191 6:30860247-30860269 AATGTTAATCACCAAGACAATGG - Intergenic
1006062914 6:31438963-31438985 AATGTCAATCACCATGACAATGG + Intergenic
1006649884 6:35542936-35542958 AATGTCCATCAACAGGAGAATGG - Intergenic
1007045313 6:38767687-38767709 AATGTGCATCAGCAGAGGAATGG - Intronic
1007223410 6:40296397-40296419 AATATTAATCAGCAAGACAATGG + Intergenic
1007458765 6:42001354-42001376 AATGTCTATCAACAAGAGAATGG + Intronic
1007779728 6:44246076-44246098 AAAGCGAACCAGCTTGAGAAAGG + Intergenic
1008120535 6:47611094-47611116 AACTTGCATCAGCAGGAGAAGGG + Intronic
1008216927 6:48803568-48803590 AAACTGAGTCAGCATCAGAATGG - Intergenic
1008221642 6:48861566-48861588 AATATGAATCAGAATTAGAGTGG - Intergenic
1008363547 6:50649844-50649866 AATGTTAATCACCAAGACAATGG + Intergenic
1008371271 6:50734049-50734071 AATATGTATCAGCAAAAGAAAGG + Intronic
1008889465 6:56470718-56470740 AATGTGAATTAGAATGAAAAAGG + Intronic
1009019345 6:57935286-57935308 AATGTTAATCACCAAGACAATGG + Intergenic
1009051539 6:58282623-58282645 AATGTTAATCACCAAGACAATGG + Intergenic
1009242401 6:61198501-61198523 AATGTTAATCACCAAGACAACGG + Intergenic
1009383569 6:63062857-63062879 AATGTTAATCACCAAGACAATGG + Intergenic
1009501588 6:64420398-64420420 AATGTTAATCACCAAGACAATGG - Intronic
1009546081 6:65021098-65021120 AATGTTAATCACCAAGACAATGG - Intronic
1009554818 6:65149092-65149114 AATGTTAATCACCAGGATAATGG - Intronic
1009559458 6:65221233-65221255 AATGTTAATCACCAAGACAATGG + Intronic
1009637529 6:66285109-66285131 AATGTTAATCACCAAGACAATGG + Intergenic
1009645262 6:66393911-66393933 AATGTGAATCACCAAGACAATGG - Intergenic
1009710190 6:67308347-67308369 AATGTTAATCACCAAGACAATGG + Intergenic
1009726013 6:67537030-67537052 AATGTTAATCACCAAGACAATGG + Intergenic
1009772420 6:68160843-68160865 AATGTTAATCACCAAGACAATGG + Intergenic
1009792327 6:68419797-68419819 AATGTTAATCATCAAGACAATGG + Intergenic
1010055071 6:71555943-71555965 AATGTTAATCACCAAGACAATGG + Intergenic
1010248403 6:73683058-73683080 AATGTTAATCACCAAGACAATGG - Intergenic
1010324137 6:74545172-74545194 AATGTTAATCACCAAGACAATGG - Intergenic
1010458260 6:76083201-76083223 AATGTTAATCACCAAGAAAATGG - Intergenic
1010610723 6:77951679-77951701 AATGTTAATCACCAAGACAATGG + Intergenic
1010645902 6:78387143-78387165 AATGTTAATCACCAAGACAATGG - Intergenic
1010651079 6:78455908-78455930 AATGTTAATCACCAAGAGGATGG - Intergenic
1010845472 6:80702181-80702203 AATGTGAATAACCAAGACAATGG + Intergenic
1010882877 6:81201387-81201409 AATGTTAATCACCAAGACAATGG + Intergenic
1010906775 6:81501117-81501139 AATGTTAATCACCAAGACAATGG + Intronic
1011032873 6:82942435-82942457 AATGTTAATCACCAAGACAATGG + Intronic
1011110570 6:83833386-83833408 AATGTTAATCACCAAGACAATGG + Intergenic
1011211166 6:84958307-84958329 AATGTTAATCACCAAGACAATGG + Intergenic
1011343833 6:86347046-86347068 AATGTTAATCACCAAGACAATGG - Intergenic
1011382616 6:86759392-86759414 AATGTTAATCACCAAGACAATGG + Intergenic
1011738317 6:90334240-90334262 AATGTTAATCACCAAGACAATGG - Intergenic
1011791177 6:90900651-90900673 ACTGTGAAGCAGGCTGAGAAGGG + Intergenic
1011915792 6:92504971-92504993 AAAGTGAAACAGAAAGAGAAAGG + Intergenic
1011916354 6:92511319-92511341 AATGTGAATCACCAAGAAAATGG + Intergenic
1011933003 6:92737705-92737727 AATGTTAATCACCAAGACAATGG + Intergenic
1012038768 6:94176525-94176547 AATGTTAATCAAGATGGGAAAGG - Intergenic
1012078942 6:94730277-94730299 AATATGTATCACCATGTGAATGG - Intergenic
1012161377 6:95889060-95889082 AATGTTAATCACCAAGACAATGG - Intergenic
1012380680 6:98615955-98615977 AATGTTAATCACCAAGACAATGG - Intergenic
1012690812 6:102308484-102308506 AATGTTAATCACCAAGACAATGG - Intergenic
1012691588 6:102319772-102319794 AATGTTAATCACCAAGACAATGG + Intergenic
1013148997 6:107426040-107426062 AATGTTAATCACCAAGACAATGG + Intronic
1013338616 6:109191457-109191479 AATGTTAATCAGCAAGGCAATGG + Intergenic
1013391148 6:109687637-109687659 AATGTGAATCAGCTTGGGAGTGG + Intronic
1013688032 6:112609013-112609035 AATGTTAATCACCATGACAAGGG + Intergenic
1013761153 6:113519942-113519964 AATATAATTCAGCAAGAGAAAGG + Intergenic
1013829591 6:114255913-114255935 AATGTTAATCACCAAGACAATGG - Intronic
1013928549 6:115502513-115502535 AATGTTAATCACCAAGACAATGG + Intergenic
1013951901 6:115792795-115792817 ATTGTGTAATAGCATGAGAAAGG + Intergenic
1014068199 6:117151011-117151033 AATGTGAATCACCAAGACAATGG - Intergenic
1014134027 6:117866838-117866860 AATGTTAATCACCAAGACAAAGG - Intergenic
1014135450 6:117883892-117883914 AATGTTAATCACCAAGACAATGG - Intergenic
1014260871 6:119215468-119215490 AATCTGAAACAGCAGGAGAGAGG + Intronic
1014649561 6:124018357-124018379 AATGTTAATCACCAAGAAAATGG - Intronic
1014855869 6:126399993-126400015 AATGTCCATCAGCATTAAAATGG - Intergenic
1014883125 6:126746878-126746900 AATGTTAATCACCAAGACAATGG - Intergenic
1015013234 6:128376565-128376587 AATGTTAATCACCAAGACAATGG - Intronic
1015110769 6:129589121-129589143 AATGTTAATCACCAAGACAATGG - Intronic
1015257961 6:131201174-131201196 AATGTGAGACAGAATGAGATGGG - Intronic
1015713178 6:136163543-136163565 AATGTTAATCACCAAGACAATGG - Intronic
1015995715 6:138993885-138993907 AATGTTAATCACCAAGACAATGG + Intergenic
1016151470 6:140747199-140747221 AATGTTAATCACCAAGACAATGG + Intergenic
1016175177 6:141071388-141071410 AATGTTAATCAGCAAGACAATGG + Intergenic
1016564898 6:145441420-145441442 AATGTTAATCACCAAGACAATGG - Intergenic
1016592820 6:145765596-145765618 AATGTAAATCACCAAGACAATGG + Intergenic
1016641867 6:146358959-146358981 ACTGTGTCACAGCATGAGAATGG - Intronic
1016790280 6:148060404-148060426 AATGTTAATCACCAAGACAATGG - Intergenic
1017133524 6:151128843-151128865 AATGTTAATCACCAAGACAATGG + Intergenic
1017401735 6:154072111-154072133 AATGAGAATCAACGTGGGAATGG + Intronic
1017640611 6:156490512-156490534 AATGTTAATCACCAAGACAATGG + Intergenic
1017763638 6:157590254-157590276 AATGTTAATCACCAAGACAATGG + Intronic
1018086338 6:160304068-160304090 AATGTTAATCACCAAGACAATGG - Intergenic
1018489655 6:164279272-164279294 AATGTTAATCACCAAGACAATGG + Intergenic
1018507162 6:164483721-164483743 AATGTTAATCACCAAGACAATGG - Intergenic
1018511087 6:164525842-164525864 AATGTTAATCACCAAGACAATGG + Intergenic
1018514254 6:164561746-164561768 AATGTTAATCACCAAGACAATGG + Intergenic
1018527417 6:164728634-164728656 AATGTTAATCACCAAGAAAATGG + Intergenic
1019039309 6:169090596-169090618 AATGTTAATCACCAAGACAATGG + Intergenic
1019081570 6:169434874-169434896 AATGTTAATCACCAAGACAATGG + Intergenic
1019085068 6:169467750-169467772 AATGTTAATCACCAAGACAATGG - Intronic
1019291756 7:253973-253995 AATCTGTATCAGCACGAGACAGG + Intronic
1019688533 7:2396390-2396412 AAGGTGAGGCAGCATGAGAGGGG - Intergenic
1020581723 7:10011472-10011494 AATGTTAATCACCAAGACAATGG + Intergenic
1020958730 7:14776342-14776364 AATGTTAATCACCAAGACAATGG + Intronic
1021001873 7:15341128-15341150 AATGTTAATCACCAAGACAAGGG - Intronic
1021175039 7:17440314-17440336 AATGTTAATCACCAAGACAATGG - Intergenic
1021400879 7:20208726-20208748 AATGTTAATCACCAAGACAATGG + Intronic
1021441288 7:20680007-20680029 AATGTCAATCAGGAATAGAATGG + Intronic
1021617643 7:22519667-22519689 AATGTTAATCACCAAGACAATGG + Intronic
1021672907 7:23050205-23050227 AATGTTCATCAGCTTGTGAAGGG - Intergenic
1021753974 7:23833499-23833521 AATGTTAATCACTAAGAGAATGG + Intergenic
1022417102 7:30187797-30187819 AATGTTAATCACCAAGACAATGG - Intergenic
1022927239 7:35069157-35069179 AATGTTAATCACCAAGACAATGG + Intergenic
1023386426 7:39662245-39662267 AATGTTAATCACCAAGACAATGG - Intronic
1023386435 7:39662289-39662311 AATGTTAATCACCAAGACAACGG - Intronic
1023756835 7:43426584-43426606 AAACTGAATAAGCATAAGAAAGG - Intronic
1023893580 7:44413085-44413107 AATTTGAATCAGGATTAGATAGG - Intronic
1024207504 7:47176683-47176705 AATGTTAATCACCAAGACAATGG + Intergenic
1024384695 7:48738438-48738460 AATGTTAATCACCAAGACAATGG + Intergenic
1024865882 7:53904607-53904629 AATGTTAATCACCAAGACAATGG - Intergenic
1024912102 7:54457880-54457902 AATGTTAATCACCAGGACAATGG + Intergenic
1025953931 7:66168067-66168089 AATGTGCATCAGCAGACGAATGG - Intergenic
1026103274 7:67400239-67400261 AATGTCCATCAACATGAAAATGG - Intergenic
1026353111 7:69534667-69534689 AATGTGAGTCAGCAGGAGCGGGG + Intergenic
1026373982 7:69731580-69731602 AATAAGAAACAGCATGTGAAAGG - Intronic
1027616684 7:80432682-80432704 AATGTCAATCAGTATGTGCATGG + Intronic
1028045019 7:86107472-86107494 AATGTTAATCACCAAGACAATGG + Intergenic
1028289236 7:89044909-89044931 AATGTTAATCAGCAAGACAATGG + Intronic
1028375034 7:90136437-90136459 AATGTTAATCACCAAGACAATGG - Intergenic
1028410005 7:90520305-90520327 AATGTACATCACCAGGAGAATGG + Intronic
1028790113 7:94844282-94844304 AATGTTAATCATCAAGACAATGG + Intergenic
1028844105 7:95460747-95460769 AATGTTAATCACCAAGACAATGG + Intergenic
1028844377 7:95462907-95462929 AAGGTGAATGAGAAAGAGAAAGG + Intergenic
1028961096 7:96750338-96750360 AATGTTAATCACCAAGACAATGG - Intergenic
1029070549 7:97892378-97892400 AATGTGAATCCCCAAGACAATGG - Intergenic
1029380428 7:100210900-100210922 AAAGTCAATCAGGAAGAGAATGG - Intronic
1029948362 7:104556653-104556675 AATGTTAATCACCAAGACAATGG - Intronic
1029950652 7:104580921-104580943 AATGTCCATCAACAGGAGAATGG - Intronic
1029961394 7:104692340-104692362 AATGTTAATCACCAAGACAATGG + Intronic
1030108547 7:106007282-106007304 AATGTTAATCACCAAGACAATGG - Intronic
1030158816 7:106485910-106485932 AATGAGACTGATCATGAGAAGGG - Intergenic
1030217653 7:107062381-107062403 AATGTCCATCAACAGGAGAATGG + Intronic
1030510948 7:110481248-110481270 AATGTTAATCAGCAAGACAATGG - Intergenic
1030546571 7:110903645-110903667 GATGTCAATCAGCAGGTGAATGG - Intronic
1030722444 7:112885278-112885300 AATGTGAATCACCAAGACAGTGG - Intronic
1030786561 7:113670652-113670674 AATGTTAATCACCAAGACAATGG + Intergenic
1030826761 7:114168702-114168724 AATGTGAATCCTCAAGACAATGG + Intronic
1030851111 7:114487464-114487486 AATGTTAATCACCAAGACAATGG - Intronic
1030907710 7:115206875-115206897 AATGTTAATCACCAAGACAATGG - Intergenic
1030915129 7:115303578-115303600 AATGTTAATCACCAAGACAATGG + Intergenic
1031125485 7:117768965-117768987 AATGTTCATCAACAAGAGAATGG - Intronic
1031458740 7:122018207-122018229 AAGATGACTGAGCATGAGAACGG - Intronic
1031522028 7:122778456-122778478 AATGTTAATCACCAAGACAATGG + Intronic
1031725364 7:125230754-125230776 AATGTTAATCACCAAGACAATGG - Intergenic
1032448639 7:132006728-132006750 AATGTTCATCAACAGGAGAATGG - Intergenic
1032560928 7:132892551-132892573 AATGTTAATCACCAAGACAATGG + Intronic
1033031653 7:137832670-137832692 AATGTTAATCACCAAGACAATGG - Intronic
1033707097 7:143900769-143900791 AATGTCCATCAGCAGTAGAATGG + Intronic
1033858720 7:145598267-145598289 AGTATGAAAAAGCATGAGAAAGG - Intergenic
1033871710 7:145762377-145762399 AATGTTAATCACCAGGACAATGG + Intergenic
1033998789 7:147386256-147386278 AATGTTAATCATCAAGACAATGG - Intronic
1034071736 7:148192719-148192741 AATTTGCATCAGAATGAGAGAGG + Intronic
1034718423 7:153264725-153264747 AATGTTAATCACCAAGACAATGG - Intergenic
1034751108 7:153569615-153569637 AATGTTAATCACCAAGACAATGG - Intergenic
1034904862 7:154934839-154934861 AATGTTAATCACCAAGACAATGG - Intronic
1035135489 7:156698802-156698824 AATGTTAATCACCAAGATAATGG - Intronic
1035192702 7:157185776-157185798 AAAGTACATCAGAATGAGAAAGG - Intronic
1035367514 7:158358610-158358632 AATGGGACTCAGCCTCAGAAAGG + Intronic
1036248021 8:7137348-7137370 AATGTGAATCTCCAAGACAATGG + Intergenic
1036582332 8:10086920-10086942 AATGAGAATGAGAATGAGAATGG + Intronic
1036886233 8:12555650-12555672 AATGTGAATCCCCAAGACAATGG - Intergenic
1036893849 8:12614738-12614760 AATGTGAATCCCCAAGACAATGG - Intergenic
1037061804 8:14521491-14521513 AATATGAATCAGCAGTAAAAGGG - Intronic
1037205954 8:16320568-16320590 AATGTTAATCACCAAGACAATGG + Intronic
1038016332 8:23518754-23518776 AATGTGACACAGCAACAGAAAGG - Intergenic
1038056839 8:23866903-23866925 AATGTCCATCAACATGTGAATGG - Intergenic
1038457147 8:27683049-27683071 AATGTCGATCATCAGGAGAATGG + Intergenic
1039298289 8:36181578-36181600 AATGTTAATCACCAAGACAATGG - Intergenic
1039485771 8:37908601-37908623 AATGTCTATCAGCTTTAGAATGG - Intergenic
1039642791 8:39241803-39241825 AATGTTAATCACCAAGACAATGG - Intronic
1039652084 8:39353280-39353302 AATGTTAATCACCAAGACAATGG + Intergenic
1039681073 8:39737109-39737131 AATGTTAATCATCAGGACAATGG + Intergenic
1040793260 8:51258560-51258582 AATGGGAAGAAGAATGAGAAGGG + Intergenic
1041146210 8:54878936-54878958 AATGTTATTCAGCCTTAGAAAGG - Intergenic
1041162220 8:55057112-55057134 AATGTCCATCAGTAAGAGAATGG + Intergenic
1041422873 8:57689116-57689138 AATGTAAATCAGCCTGACATAGG - Intergenic
1041434249 8:57819934-57819956 AATGTGAATCCCCAAGACAATGG - Intergenic
1041955515 8:63554388-63554410 AATGTTAATCACCAAGACAATGG - Intergenic
1041984891 8:63909707-63909729 AATGTTAATCACCAGGACAATGG - Intergenic
1042265969 8:66909814-66909836 AATGTTAATCACCAAGACAATGG + Intronic
1042581831 8:70288133-70288155 TATGTGAATTACTATGAGAAAGG + Intronic
1042622113 8:70717713-70717735 AATGTTAATCACCAGGACAATGG - Intronic
1042631566 8:70821903-70821925 AATGTTAATCACCAAGACAATGG - Intergenic
1042989305 8:74620789-74620811 AATGTTAATCACCAAGACAATGG - Intronic
1043040236 8:75253485-75253507 AATGTTAGTCAGCAAGACAATGG - Intergenic
1043297533 8:78683657-78683679 AATGTTAATCACCAAGACAAAGG - Intronic
1043308161 8:78823230-78823252 AATGTTAATCACCAAGACAATGG + Intergenic
1043370280 8:79583591-79583613 AATGTTAATCAACAGGACAATGG + Intergenic
1043518500 8:81019318-81019340 AATGTTAATCACCAAGACAATGG + Intronic
1043644295 8:82498508-82498530 AATGTTAATCACCAAGACAATGG + Intergenic
1043680856 8:83022737-83022759 AATGTTAATCACCAAGACAATGG - Intergenic
1043696668 8:83227962-83227984 AACCTGAATCAACATAAGAATGG - Intergenic
1044051769 8:87514917-87514939 AATGTTAATCACCATGACAATGG + Intronic
1044055890 8:87569475-87569497 AATGTTAATCACCAAGACAATGG + Intronic
1044107401 8:88227589-88227611 ATTATGAATCAGCATCTGAATGG + Intronic
1044127072 8:88471866-88471888 AATGTTAATCACCAAGACAATGG - Intergenic
1044188386 8:89283622-89283644 AATGTTAATCACCAAGACAATGG + Intergenic
1044207473 8:89508213-89508235 AATGTCAATCAACATTAGAAAGG + Intergenic
1044324892 8:90847951-90847973 AATGTTAATCACCAAGACAATGG - Intronic
1044395652 8:91708066-91708088 AATGTTAATCACCAAGACAATGG + Intergenic
1044610800 8:94090073-94090095 AATGTTTATCAGCAAGAGAAGGG + Intergenic
1044851386 8:96432369-96432391 AATGTTAATCACCAAGACAATGG + Intergenic
1045007077 8:97925829-97925851 AATATGAATCTCCATGACAAGGG - Intronic
1045139783 8:99267817-99267839 AATGTTAATCACCAAGACAATGG + Intronic
1045255005 8:100512052-100512074 AATTTCAATCAGTAGGAGAAAGG + Intronic
1045422211 8:102027159-102027181 AATGTTAATCACCAAGACAATGG - Intronic
1045588234 8:103563127-103563149 AATGTTAATCACCAAGACAATGG - Intronic
1045849233 8:106673595-106673617 AATGTTAATCACCAAGACAATGG + Intronic
1046025076 8:108712585-108712607 AAACTGGATCAGGATGAGAATGG - Intronic
1046244359 8:111539284-111539306 AATGTTAATCACCAAGACAATGG + Intergenic
1046264613 8:111814574-111814596 AATGTTAATCACCAAGACAATGG - Intergenic
1047060519 8:121219661-121219683 AATGTTAATCAGCAAGACAATGG - Intergenic
1047482146 8:125294144-125294166 AATGTTACTCAGCACTAGAAAGG - Intronic
1047490478 8:125370114-125370136 AATGTTAATCACCAAGACAATGG - Intergenic
1047586851 8:126282594-126282616 AATGTTAATCATCAAGACAACGG + Intergenic
1047869887 8:129071212-129071234 AATGTTAATCATCAAGACAATGG + Intergenic
1047924447 8:129669352-129669374 AATGTTAATCACCAAGACAATGG + Intergenic
1047972802 8:130099903-130099925 AATGTCCATCAGCAGGTGAATGG - Intronic
1047979418 8:130164993-130165015 GATGATAAACAGCATGAGAAAGG + Intronic
1048069736 8:131009133-131009155 AATGTCAATCACCAAGACAATGG + Intronic
1048178584 8:132174806-132174828 CATGTGTATCTGCATGTGAAAGG + Intronic
1048661314 8:136605132-136605154 AAAGGGAATCAGTATGAGCATGG - Intergenic
1048749347 8:137653531-137653553 ATTTCTAATCAGCATGAGAAAGG + Intergenic
1048782409 8:138016938-138016960 AATGTTAATCACCAAGACAATGG + Intergenic
1048895830 8:138991168-138991190 AATGTTAATCACCAAGACAATGG - Intergenic
1049287479 8:141783660-141783682 AATGGGAAACAGCAGGAGAAGGG + Intergenic
1049848278 8:144815913-144815935 AGTGTCCATCAGCATGTGAATGG + Intergenic
1050086500 9:1971961-1971983 AATGTTAATCACCAAGACAATGG + Intergenic
1050218705 9:3361166-3361188 AATGTGAAACAGAAGGAAAAAGG + Intronic
1050773666 9:9234450-9234472 AATGTTAATCACCAAGACAATGG - Intronic
1050795276 9:9532171-9532193 AATGTGACTCAGAGTGAGGATGG + Intronic
1050849249 9:10263760-10263782 AATGTTAATCACCAAGACAATGG + Intronic
1050877696 9:10660369-10660391 AATGTAACTGAGCATCAGAAGGG + Intergenic
1050915275 9:11122942-11122964 AATGTTAATCATCAAGACAATGG - Intergenic
1051435451 9:17026218-17026240 AAAGTGAATTAGTGTGAGAATGG + Intergenic
1051967427 9:22845506-22845528 AATGTTAATCACCAAGACAATGG - Intergenic
1051986548 9:23096342-23096364 AATGTTAATCACCATGACAATGG + Intergenic
1052054023 9:23882987-23883009 AATGTTAATCACCAAGACAATGG - Intergenic
1052079128 9:24180858-24180880 AATGTTAATCACCAAGACAATGG - Intergenic
1052105496 9:24510026-24510048 AATGCTAATCAGCAAGACAATGG + Intergenic
1052187842 9:25620379-25620401 AATGTTAATCACCAAGACAATGG - Intergenic
1052210237 9:25894456-25894478 AATGTTAATCCCCATGACAATGG - Intergenic
1052284919 9:26774300-26774322 CATGTGAATGAGCATGTGATTGG + Intergenic
1052322905 9:27187548-27187570 AATGTCCATCAACATTAGAAAGG + Intronic
1052453767 9:28667270-28667292 AATGTGACCCAATATGAGAAAGG - Intronic
1052540867 9:29810420-29810442 AATGTTAATCACCAAGACAATGG + Intergenic
1052599111 9:30600737-30600759 AATGTTAATCACCAAGACAATGG - Intergenic
1052666107 9:31497045-31497067 AATGTTAATCACCAAGACAATGG - Intergenic
1052705453 9:31988894-31988916 AATGTTAATCACCAAGACAATGG - Intergenic
1053703898 9:40730267-40730289 AATGTTAATCACCAAGACAATGG - Intergenic
1053724940 9:40990135-40990157 AATCAGAATCAGCAGGAGAGAGG + Intergenic
1054341028 9:63861866-63861888 AATCAGAATCAGCAGGAGAGAGG - Intergenic
1054344945 9:63905430-63905452 AATGTTAATCACCAAGACAATGG + Intergenic
1054413981 9:64853876-64853898 AATGTTAATCACCAAGACAATGG - Intergenic
1055264064 9:74475623-74475645 AATGTTAATCACCAAGACAATGG + Intergenic
1055350912 9:75387186-75387208 AATGTTATTCAGCCTTAGAAGGG + Intergenic
1055701496 9:78949774-78949796 AATGTCAATCACCAAGACAATGG + Intergenic
1055774429 9:79752333-79752355 AATGTTAATCACCAAGACAAGGG - Intergenic
1056042895 9:82686140-82686162 AATGTTAATCACCAAGACAATGG - Intergenic
1056064240 9:82916538-82916560 AATGTTAATCACCAAGAAAATGG - Intergenic
1056092160 9:83216227-83216249 AATGTTAATCACCAAGACAATGG + Intergenic
1056103537 9:83324040-83324062 AATGTTCATCAACAGGAGAATGG + Intronic
1056325467 9:85474990-85475012 AATGTTAATCACCAAGACAATGG + Intergenic
1056743036 9:89276330-89276352 AATGTTAATCACCAAGACAATGG - Intergenic
1056931186 9:90879307-90879329 AATGTTAAGTAGCATGAAAAGGG - Intronic
1057282968 9:93726164-93726186 ATTGTCAATGAGCAAGAGAAAGG - Intergenic
1057381836 9:94575520-94575542 AATGCATATCAACATGAGAATGG - Intronic
1057589290 9:96358119-96358141 AATATTAATCAGCCTGAAAAAGG + Intronic
1058149858 9:101452432-101452454 AATGTTAATCACCAAGACAAAGG + Intergenic
1058240145 9:102548022-102548044 AATGTTAATCATCAAGACAATGG + Intergenic
1058636252 9:107041372-107041394 GATATGAATGAGCATGTGAATGG - Intergenic
1058729661 9:107837604-107837626 AATGTCCATCAGCAGGAGCATGG + Intergenic
1059243499 9:112829143-112829165 AATGTCCATCAACATGTGAATGG - Intronic
1059570143 9:115425408-115425430 AATGTTAATCACCAAGATAACGG - Intergenic
1060021398 9:120134291-120134313 AATGTTAATCACCAAGACAATGG - Intergenic
1060342071 9:122786482-122786504 ATGGTGAAGCAGCATGAGAGAGG + Intergenic
1060365655 9:123010412-123010434 AAAGTGAATCAGAAAGAGAGAGG + Exonic
1060438026 9:123612472-123612494 AATGTGAGCCAGTATTAGAAAGG - Intronic
1062438718 9:136559396-136559418 AATGTTAATCACCAAGACAATGG + Intergenic
1203635483 Un_KI270750v1:106472-106494 AATGTTAATCACCAAGACAATGG - Intergenic
1186207314 X:7214213-7214235 AATGTGACTCAGCAGAAAAAGGG - Intergenic
1186477571 X:9869709-9869731 AATGTCAATCAACAGGTGAATGG - Intronic
1186679375 X:11855344-11855366 AATGTTAATCACCAAGACAATGG - Intergenic
1186711896 X:12206567-12206589 AATGTGACTCATCATAAGAATGG - Intronic
1187161654 X:16770769-16770791 AATGTGCATCAACAGTAGAATGG + Intergenic
1187226886 X:17381685-17381707 AATGTCCATCATCAGGAGAATGG - Intronic
1187667450 X:21628827-21628849 AATGTTAATCACCAAGACAATGG - Intronic
1188124559 X:26351621-26351643 AATGTTAATCACCAAGACAATGG - Intergenic
1188155525 X:26737069-26737091 AATGTTAATCACCAAGACAATGG - Intergenic
1188169857 X:26911454-26911476 AATGTTAATCACCAAGACAATGG + Intergenic
1188187366 X:27131124-27131146 AATGTGAATCACCACAACAATGG - Intergenic
1188457085 X:30379569-30379591 AATGTTAATCACCAAGACAATGG + Intergenic
1188755227 X:33953325-33953347 AATGTTAATCACCATGACAATGG - Intergenic
1188774014 X:34189987-34190009 AATGTTAATCACCAAGACAATGG - Intergenic
1188857067 X:35209441-35209463 AATGTTAATCACCAGGACAATGG - Intergenic
1188997547 X:36904636-36904658 AATGTTAATCACCAAGACAATGG + Intergenic
1189253789 X:39621563-39621585 AATGTGAATCCCCAAGACAATGG - Intergenic
1189376808 X:40472970-40472992 AATGTCCATCAGTATAAGAATGG - Intergenic
1189738622 X:44096290-44096312 AATGTGTATCAACAGCAGAATGG + Intergenic
1189788657 X:44583053-44583075 AATGTTAATCACCAAGACAATGG + Intergenic
1189877900 X:45455850-45455872 AATGTTAATCACCAAGACAATGG + Intergenic
1190269730 X:48853166-48853188 AATGTTAATCACCAAGACAATGG - Intergenic
1190971239 X:55350616-55350638 AATGTACATCAGCACAAGAAAGG - Intergenic
1191084105 X:56545952-56545974 AATGTTAATCACCAAGACAATGG - Intergenic
1191095024 X:56664964-56664986 AATGTTAATCACCAAGACAATGG + Intergenic
1191711043 X:64150101-64150123 AATGTTAATCACCAAGACAATGG - Intergenic
1192028325 X:67480356-67480378 AATGGAAATCTGTATGAGAACGG + Intergenic
1192356248 X:70406971-70406993 TCTGTGAATGAGCATGAGGATGG + Exonic
1192689641 X:73349072-73349094 AATGTTAATCACCAAGACAAAGG + Intergenic
1192841875 X:74865555-74865577 AATGTTAATCACCAAGACAATGG + Intronic
1192920088 X:75697015-75697037 AATGTTAATCACCAAGACAATGG - Intergenic
1192932878 X:75826188-75826210 AATGTTAATCACCAAGACAATGG - Intergenic
1192958944 X:76105331-76105353 AATGTCCAACAGCAAGAGAATGG - Intergenic
1192967642 X:76195914-76195936 AATGTTAATCACCAAGACAATGG - Intergenic
1193027129 X:76856319-76856341 AATGTTAATCACCAAGACAATGG - Intergenic
1193029163 X:76879336-76879358 AATGTTAATCACCAAGACAATGG - Intergenic
1193043187 X:77024943-77024965 AATGTTAATCACCAAGACAATGG - Intergenic
1193167724 X:78301213-78301235 AATGTTAATCACCAAGACAATGG - Intronic
1193246605 X:79237276-79237298 AATGTTAATCACCAAGACAATGG - Intergenic
1193250251 X:79282061-79282083 AATGTTAATCATCAAGATAATGG - Intergenic
1193261434 X:79411306-79411328 AATGTGGATTGGCAAGAGAAAGG - Intergenic
1193506283 X:82348397-82348419 AATGTTAATCACCAAGACAATGG - Intergenic
1193769682 X:85573968-85573990 AATGTAAATGAATATGAGAAAGG + Intergenic
1193796885 X:85888064-85888086 AATGTTAATCACCAAGACAATGG + Intronic
1193840748 X:86405174-86405196 AATGTTAATCACCAAGACAATGG - Intronic
1193857893 X:86626929-86626951 AATGTAAATCACCAAGATAATGG - Intronic
1193890915 X:87045497-87045519 AATGTTAATCACCATGACAATGG + Intergenic
1193943972 X:87709211-87709233 AATGTTAATCACCAAGACAATGG - Intergenic
1194254024 X:91613991-91614013 AATGTTAATCACCAAGACAATGG - Intergenic
1194302402 X:92204190-92204212 AATGTTAATCACCAAGACAATGG - Intronic
1194320548 X:92441314-92441336 AATGTTAATCACCAAGACAATGG + Intronic
1194389564 X:93299793-93299815 AATGTTAATCACCAAGACAATGG + Intergenic
1194419206 X:93651209-93651231 AATGTCTATCAGCAGAAGAATGG + Intergenic
1194442875 X:93954692-93954714 AATGTTAATCACCAAGACAATGG + Intergenic
1194495922 X:94616352-94616374 AATGTTAATCACCAAGACAATGG - Intergenic
1194525205 X:94969389-94969411 AATGTTAATCACCAAGACAATGG + Intergenic
1194527066 X:94989823-94989845 AATGTTAATCACCAAGACAATGG - Intergenic
1194535048 X:95095942-95095964 AATGTTAATCACCAAGACAATGG + Intergenic
1194542437 X:95190669-95190691 AATGTTAATCACCAAGACAATGG - Intergenic
1194560259 X:95411554-95411576 AATGTAAATCACCAAGACAATGG + Intergenic
1194778246 X:97991643-97991665 AATGTTAATCACCAAGAAAATGG - Intergenic
1194779783 X:98010615-98010637 AATGTTAATCACCAAGACAATGG + Intergenic
1194905894 X:99576145-99576167 AATGTTAATCACCAAGACAATGG + Intergenic
1194920553 X:99759747-99759769 AATGTTAATCACCAAGACAATGG + Intergenic
1194929362 X:99867644-99867666 AATGTTAATCACCAAGACAATGG + Intergenic
1194982283 X:100453049-100453071 AATGTTAATCACCAAGACAATGG + Intergenic
1195430784 X:104786892-104786914 AATGAGAATGAGAATGAGAGAGG - Intronic
1195585326 X:106558570-106558592 AATGTCAATCAACAGTAGAATGG + Intergenic
1195842530 X:109190025-109190047 AATGTAAATCAACAGGAAAATGG + Intergenic
1195865001 X:109422866-109422888 AATGTCCATCAGCAGGAAAATGG + Intronic
1196012674 X:110905035-110905057 AATGTTAATCACCAAGACAATGG - Intergenic
1196028588 X:111070427-111070449 AATGTGGCTCAGCCTTAGAAAGG - Intronic
1196521187 X:116674201-116674223 AATGTCCATCAACAGGAGAAAGG - Intergenic
1196522919 X:116695232-116695254 CATGTGAATAAGGATGGGAATGG - Intergenic
1196768412 X:119270531-119270553 AATGAGAATGAGGATGAGAGAGG + Intergenic
1196827603 X:119753198-119753220 AATGTGAACCATCAGGAGAGAGG - Intergenic
1196930476 X:120676415-120676437 AATGTTAATCACCAAGACAATGG - Intergenic
1197040368 X:121929593-121929615 AATGTTAATCACCAAGACAATGG + Intergenic
1197223076 X:123932137-123932159 AATGTGAATCACCAAGACAATGG + Intergenic
1197251488 X:124220546-124220568 AATGTCCATCAGCTGGAGAATGG - Intronic
1197387769 X:125821843-125821865 AATGTTAATCACCAAGACAATGG - Intergenic
1197536126 X:127691161-127691183 AATGTTAATCAACAAGAAAATGG + Intergenic
1197673615 X:129306215-129306237 AATGTTCATCAACATTAGAATGG - Intergenic
1197866116 X:131019099-131019121 AATGTTCATCAACAGGAGAATGG - Intergenic
1197896292 X:131319123-131319145 CATGTGCAACAGCATGACAAGGG + Intronic
1198188731 X:134282492-134282514 AATATTAATCAGCATTAAAAAGG + Intergenic
1198274610 X:135089207-135089229 AATGTTAATCACCAAGACAATGG + Intergenic
1198566002 X:137906463-137906485 AATGTTAATCACCAAGAAAATGG + Intergenic
1198570739 X:137953393-137953415 AATGTGCATCAACATATGAATGG - Intergenic
1198727842 X:139695721-139695743 GATAAGAATCAGCTTGAGAAAGG - Intronic
1198775222 X:140172506-140172528 AATGTTAATCACCAAGAAAATGG + Intergenic
1198836136 X:140806406-140806428 AATGTTAATCACCAAGACAATGG - Intergenic
1198941940 X:141965782-141965804 AATGTTAATCACCAAGACAATGG + Intergenic
1198947105 X:142027329-142027351 AATGTGAATCACCAAGACAATGG - Intergenic
1198948434 X:142041152-142041174 AATGTTAATCACCAAGACAATGG - Intergenic
1199092593 X:143708995-143709017 AATGTTAATCACCAAGATAATGG - Intergenic
1199185530 X:144910960-144910982 AATGTTAATCACCAAGACAATGG - Intergenic
1199191999 X:144981583-144981605 AATGTTAATCACCAAGACAAAGG + Intergenic
1199200827 X:145087483-145087505 AATGTTAATCAGCAAGAAAAAGG + Intergenic
1199370436 X:147042039-147042061 AATGTTAATCACCAAGACAATGG + Intergenic
1199476680 X:148254279-148254301 AATGTTAATCAACAAGACAATGG + Intergenic
1199560722 X:149159795-149159817 AATGTTAATCACCAAGACAATGG - Intergenic
1200016656 X:153169848-153169870 AATGTTAATCACCAAGACAATGG + Intergenic
1200039958 X:153357977-153357999 AATGTTAATCACCAAGACAATGG + Intronic
1200295429 X:154914334-154914356 AATGTTAATCACCAAGATAATGG - Intronic
1200332378 X:155311097-155311119 AATGTTAATCACCAAGACAATGG - Intronic
1200377680 X:155801331-155801353 AATGTCCATCAACATGGGAATGG - Intergenic
1200572810 Y:4853568-4853590 AATGTTAATCACCAAGACAATGG - Intergenic
1200628661 Y:5554442-5554464 AATGTTAATCACCAAGACAATGG + Intronic
1200898219 Y:8399513-8399535 TATGTCACTCAGAATGAGAAAGG - Intergenic
1201452198 Y:14128903-14128925 AATGTTAATCTCCATGAGCATGG + Intergenic
1201932515 Y:19367425-19367447 AATATCAATCTGCATGTGAATGG - Intergenic