ID: 921616547

View in Genome Browser
Species Human (GRCh38)
Location 1:217274553-217274575
Sequence CAGAATGCTGAAACTGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921616541_921616547 1 Left 921616541 1:217274529-217274551 CCCATTAGCAAGTCATCACCTCC No data
Right 921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG No data
921616542_921616547 0 Left 921616542 1:217274530-217274552 CCATTAGCAAGTCATCACCTCCC No data
Right 921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG No data
921616540_921616547 16 Left 921616540 1:217274514-217274536 CCAAGACTGTAAGTACCCATTAG No data
Right 921616547 1:217274553-217274575 CAGAATGCTGAAACTGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921616547 Original CRISPR CAGAATGCTGAAACTGAAAT AGG Intergenic
No off target data available for this crispr