ID: 921617479

View in Genome Browser
Species Human (GRCh38)
Location 1:217286998-217287020
Sequence CTGTGCCAATGGAACTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921617474_921617479 21 Left 921617474 1:217286954-217286976 CCTTATTTTATAATTTTATAATG No data
Right 921617479 1:217286998-217287020 CTGTGCCAATGGAACTTTTAAGG No data
921617476_921617479 -10 Left 921617476 1:217286985-217287007 CCTATCAATAGGCCTGTGCCAAT No data
Right 921617479 1:217286998-217287020 CTGTGCCAATGGAACTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921617479 Original CRISPR CTGTGCCAATGGAACTTTTA AGG Intergenic
No off target data available for this crispr