ID: 921619818

View in Genome Browser
Species Human (GRCh38)
Location 1:217313135-217313157
Sequence AATTATCTGCAGACGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921619818_921619823 16 Left 921619818 1:217313135-217313157 CCTACCATCGTCTGCAGATAATT No data
Right 921619823 1:217313174-217313196 ACAGCTCTTGGTCTGCCACTGGG No data
921619818_921619820 4 Left 921619818 1:217313135-217313157 CCTACCATCGTCTGCAGATAATT No data
Right 921619820 1:217313162-217313184 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
921619818_921619822 15 Left 921619818 1:217313135-217313157 CCTACCATCGTCTGCAGATAATT No data
Right 921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921619818 Original CRISPR AATTATCTGCAGACGATGGT AGG (reversed) Intergenic
No off target data available for this crispr