ID: 921619822

View in Genome Browser
Species Human (GRCh38)
Location 1:217313173-217313195
Sequence GACAGCTCTTGGTCTGCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921619819_921619822 11 Left 921619819 1:217313139-217313161 CCATCGTCTGCAGATAATTGCTC No data
Right 921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG No data
921619818_921619822 15 Left 921619818 1:217313135-217313157 CCTACCATCGTCTGCAGATAATT No data
Right 921619822 1:217313173-217313195 GACAGCTCTTGGTCTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921619822 Original CRISPR GACAGCTCTTGGTCTGCCAC TGG Intergenic
No off target data available for this crispr