ID: 921621501

View in Genome Browser
Species Human (GRCh38)
Location 1:217330603-217330625
Sequence GCAAAGAGATGATGTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921621501_921621502 14 Left 921621501 1:217330603-217330625 CCAGTTTCACATCATCTCTTTGC No data
Right 921621502 1:217330640-217330662 ATACATTGTTAGAAGTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921621501 Original CRISPR GCAAAGAGATGATGTGAAAC TGG (reversed) Intergenic
No off target data available for this crispr