ID: 921626101

View in Genome Browser
Species Human (GRCh38)
Location 1:217379514-217379536
Sequence GAGGGCAAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2287
Summary {0: 6, 1: 75, 2: 308, 3: 635, 4: 1263}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921626091_921626101 24 Left 921626091 1:217379467-217379489 CCTGGCTTATCTCATTGGGACTG No data
Right 921626101 1:217379514-217379536 GAGGGCAAACAGAAGCAGGGTGG 0: 6
1: 75
2: 308
3: 635
4: 1263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921626101 Original CRISPR GAGGGCAAACAGAAGCAGGG TGG Intergenic
Too many off-targets to display for this crispr