ID: 921632923

View in Genome Browser
Species Human (GRCh38)
Location 1:217456222-217456244
Sequence TCCCAAAGCCCAAGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 3, 2: 4, 3: 31, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921632923_921632930 12 Left 921632923 1:217456222-217456244 CCATGCCCACTTGGGCTTTGGGA 0: 1
1: 3
2: 4
3: 31
4: 228
Right 921632930 1:217456257-217456279 CACCCCTAGATGCTACTGTGGGG 0: 6
1: 37
2: 117
3: 226
4: 404
921632923_921632927 10 Left 921632923 1:217456222-217456244 CCATGCCCACTTGGGCTTTGGGA 0: 1
1: 3
2: 4
3: 31
4: 228
Right 921632927 1:217456255-217456277 CCCACCCCTAGATGCTACTGTGG 0: 5
1: 19
2: 64
3: 145
4: 309
921632923_921632929 11 Left 921632923 1:217456222-217456244 CCATGCCCACTTGGGCTTTGGGA 0: 1
1: 3
2: 4
3: 31
4: 228
Right 921632929 1:217456256-217456278 CCACCCCTAGATGCTACTGTGGG 0: 5
1: 25
2: 70
3: 162
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921632923 Original CRISPR TCCCAAAGCCCAAGTGGGCA TGG (reversed) Intronic
900365138 1:2308932-2308954 TCCCAGAGCCGAAGTGGGGAAGG - Exonic
900605027 1:3520032-3520054 TCCCAAAGGCCTGATGGGCATGG + Intronic
901120678 1:6890538-6890560 TCCAAGAGCCTAAGTGGGCAAGG - Intronic
901837538 1:11934232-11934254 TCCCAAAACCCAAGGGGTGAGGG - Intronic
902512587 1:16974546-16974568 TCCTACAGCCCCCGTGGGCATGG - Exonic
902789087 1:18753098-18753120 TCCAAAAGCCCAAATGAGCTTGG + Intergenic
903259388 1:22123144-22123166 CCCCAAAGACCAAGGGGGAAGGG + Intronic
903991065 1:27270018-27270040 ACCCAAAGCCCAGGAGGTCAAGG - Intronic
905509280 1:38505783-38505805 TCAGAAAGGCCAAGTGGGCATGG + Intergenic
906642452 1:47449586-47449608 TCCCAAAGCCTGAGTGGGGAGGG + Intergenic
907522595 1:55033941-55033963 TCCCATAGCCCCAGAGGGCAAGG - Intergenic
908405608 1:63811452-63811474 TCACAAACCCCATGTGGCCAAGG + Intronic
911529876 1:99031921-99031943 TCCCAAATCCCCAGTTGGTATGG + Intergenic
911822354 1:102437754-102437776 TCCCTAAGCCCAAGCTGGGAAGG + Intergenic
912480399 1:109978314-109978336 TCCCAAAGCTCAGGTGCTCAGGG - Intergenic
916742159 1:167655542-167655564 TCCCAAACCCCCTCTGGGCAAGG + Intronic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
918438764 1:184544808-184544830 TCTCAAAGCTCAAGTGGGGCAGG + Intronic
919812495 1:201417861-201417883 TCCCAAGGCCCAGCTGGGCAGGG - Intronic
920198098 1:204242962-204242984 TCCCAGAGTCCAGCTGGGCAGGG + Intronic
921632923 1:217456222-217456244 TCCCAAAGCCCAAGTGGGCATGG - Intronic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
924182677 1:241454990-241455012 CACCAAAGGCAAAGTGGGCATGG - Intergenic
924744393 1:246818532-246818554 TCCTACAGCCCCCGTGGGCATGG + Intergenic
1062788037 10:281547-281569 TCCCAAAGCACAAGTGTAGAGGG - Intronic
1065794761 10:29295929-29295951 TGCCAAAACTCAAGTGAGCAAGG + Intronic
1065948021 10:30625066-30625088 TGCCAAAACCCAAATGAGCAAGG + Intronic
1067532295 10:47083084-47083106 TCCCAAAGACGAAGAGGGTAAGG + Intergenic
1068236301 10:54237670-54237692 CACCAAAGCCCAAGTGGGCATGG + Intronic
1068908456 10:62352556-62352578 TCCCAAGGCCCACATGGACAGGG - Intergenic
1070790568 10:79186935-79186957 TGCCAAGGGCCAAGGGGGCATGG - Intronic
1071149523 10:82618011-82618033 CCCAACAGCCCAGGTGGGCAGGG - Intronic
1073456967 10:103643200-103643222 TCCCAAATTCCAACTGGGAAAGG - Intronic
1074761914 10:116673360-116673382 TCCCATTGACCAAGAGGGCAAGG + Exonic
1075090451 10:119441379-119441401 TCCCACAGCCCACCTGGGCAGGG - Intronic
1075494550 10:122908638-122908660 CACCAAAACCCAAATGGGCATGG - Intergenic
1076796072 10:132799090-132799112 TCCCACAGCACAGGCGGGCAGGG + Intergenic
1081598441 11:44475417-44475439 TACCAGAGCCCAGGTGGGCGTGG + Intergenic
1082818223 11:57524938-57524960 TCTGAAAGCTCAAGTGGGGAAGG + Intergenic
1082884541 11:58068631-58068653 TCTCAACAGCCAAGTGGGCAGGG - Intronic
1083427736 11:62597453-62597475 GTCAAAAGCCCAAGTGGGCTGGG + Intronic
1084091217 11:66880390-66880412 CCCCAAAGCCGAAGGGAGCAGGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085329413 11:75635453-75635475 GCCAAAAGCCCAATTAGGCAAGG + Intronic
1087115133 11:94516554-94516576 TCACAAACCCCATGAGGGCAGGG - Intergenic
1087783463 11:102327071-102327093 TACCAAGGCTCAAGTGGACAAGG - Intronic
1090206620 11:124887723-124887745 TCCCAAAGCCCAGGTGAGAGGGG - Exonic
1090304736 11:125681502-125681524 TCCCTAGGCCTAAGAGGGCAGGG - Intergenic
1090359245 11:126161174-126161196 TCCCAAGGCCCAAGGCGGCCTGG + Intergenic
1090579985 11:128148962-128148984 TGCCAAAGCGCAAGTGGGGAAGG + Intergenic
1091323351 11:134666880-134666902 TCCCAAATCCCACTTGGGCCTGG + Intergenic
1091503035 12:1038193-1038215 TCACAACGCCCAAGGGGGTATGG + Intronic
1091700296 12:2654499-2654521 TCCCAAGGCCAAACTTGGCAGGG + Intronic
1092923871 12:13256780-13256802 TCCCAGAGCCTAAATAGGCACGG - Intergenic
1093683574 12:22030734-22030756 TCCAGAAGCCCAAGTGGGCATGG - Intergenic
1095183877 12:39178648-39178670 TCCCAAAACCCAAGTAGGTATGG - Intergenic
1100353003 12:93802525-93802547 TCCCAATGGCCAACTGGTCATGG + Intronic
1100415711 12:94371724-94371746 TCCTAGAGCCAAAGAGGGCAAGG + Intronic
1102776378 12:115523168-115523190 CCCCAGAGCCCAGGTGGTCAAGG + Intergenic
1103235657 12:119370367-119370389 TTCCCAAGCCTAAGTGAGCACGG - Intronic
1103249263 12:119485993-119486015 TCCCAAAGCCCAGGCCTGCAGGG + Intronic
1103559976 12:121788524-121788546 CCCCCATCCCCAAGTGGGCATGG - Intronic
1108924181 13:55717842-55717864 TCTTATAGGCCAAGTGGGCAAGG - Intergenic
1109514415 13:63423366-63423388 TCCCAAAGTTCAAGTGAGCTTGG + Intergenic
1110404446 13:75134125-75134147 GCCCAAACCCAAAGTGGGCAAGG + Intergenic
1110669170 13:78156123-78156145 TTCCAAACCCCATGTAGGCATGG - Intergenic
1111898417 13:94170331-94170353 TCAGAAAGCCCAAGTTAGCACGG - Intronic
1113463852 13:110500299-110500321 TCAGAATGTCCAAGTGGGCAAGG - Intronic
1113917215 13:113881636-113881658 TCCCACAACCCAAGAGGGCCTGG + Intergenic
1114659710 14:24336292-24336314 TGCCAAGCCCCATGTGGGCAAGG + Exonic
1115374520 14:32659630-32659652 TTCCAAAGGCCCAGTGGGAATGG - Intronic
1117748528 14:58896877-58896899 TCCCAGGGCCCAGGTGAGCAGGG + Intergenic
1118586552 14:67359187-67359209 TCCCTAAGCCAAAGTGGGGATGG - Intronic
1120177925 14:81314926-81314948 TCCTAAAGCCCAAGAGTTCAAGG - Intronic
1120907962 14:89636869-89636891 TCCCAAAGCCCTGGAAGGCAGGG - Intronic
1120984536 14:90322345-90322367 TCCCAAACTCCATGAGGGCAGGG + Intronic
1121040331 14:90741071-90741093 TCCCACAGCTAAAGGGGGCAAGG + Intronic
1121780416 14:96618605-96618627 TGCCAAAGCCCAGGGGGACAAGG - Intergenic
1121791308 14:96701691-96701713 TCCCTAAGACCAAGTGGCCTTGG - Intergenic
1122148414 14:99708055-99708077 TCCCAGGCCCCATGTGGGCACGG - Intronic
1122178605 14:99938638-99938660 TCCCTGAGCCCAGGTGGGCCTGG - Intronic
1122222894 14:100252685-100252707 TACCAGAACACAAGTGGGCAAGG - Intronic
1124983519 15:34584209-34584231 TCCGAAAGCCCCATCGGGCAGGG + Intronic
1125691621 15:41600631-41600653 ACCCAGAGCCCAAGAGGGGAGGG - Intergenic
1126410261 15:48366583-48366605 TCCCAAACACCAAGAAGGCAAGG + Intergenic
1128262322 15:66241099-66241121 GCCCAGATCCCAAGAGGGCAGGG - Intronic
1128563318 15:68682833-68682855 CCCCAAATCCCAGGTGGGCTGGG + Intronic
1128834735 15:70800008-70800030 TCCCAAAACTGAGGTGGGCAGGG - Intergenic
1130649864 15:85756430-85756452 TCCCAAAGCCCAACAAGGCAAGG + Intergenic
1131179687 15:90231301-90231323 CCACAAAGCCCACGTGGGAAGGG + Intronic
1131599337 15:93830620-93830642 TCCCAAAGCACAAATCTGCAAGG - Intergenic
1132384538 15:101390690-101390712 GCCAACAGCCCGAGTGGGCAAGG + Intronic
1133521874 16:6566152-6566174 TGCCTAAGTCCAAGTAGGCAAGG + Intronic
1135979352 16:27135170-27135192 TCCTAAAGCCAAAATGGGAAAGG - Intergenic
1136479572 16:30533203-30533225 TCCCACAGCCCGCGTGGACAGGG + Intronic
1136483349 16:30556162-30556184 TCCCACAGCCCGCGTGGACAGGG + Intronic
1137270976 16:46901993-46902015 TCCCAAAGACCCCGTGGCCATGG + Intronic
1137751311 16:50863082-50863104 TCCGGGAGCCCAAGTGTGCAGGG + Intergenic
1138116005 16:54361223-54361245 TCCCAAACCCCATGTGGAGAGGG - Intergenic
1138803518 16:60064254-60064276 TCCCATAGCTCAACTGGGGATGG + Intergenic
1140872854 16:79122789-79122811 TCCCAAGGCAAAAATGGGCAAGG - Intronic
1141706555 16:85668362-85668384 TCCCCAAGCGCAAGTGGCAAGGG + Exonic
1141943752 16:87296193-87296215 TCCTGAAGCTCACGTGGGCAAGG + Intronic
1142509586 17:385623-385645 GGCGAAAGCCCAAGTGTGCAGGG + Intronic
1142669446 17:1480955-1480977 TGCCAAAGCCCAGGAGTGCAGGG - Intronic
1146789564 17:35743629-35743651 TCCCAAAGCCCAGGTCAACAGGG + Intronic
1147426864 17:40349979-40350001 TCCTAAAGACCAAGGGAGCAGGG + Intronic
1148864406 17:50621041-50621063 TCCCAGAGCCCAAGTTGGAGAGG + Intronic
1149070216 17:52532638-52532660 TCCCAAGGCTCAAGTGGGGATGG - Intergenic
1150216723 17:63475547-63475569 TCTCCAAGCCAAACTGGGCAGGG + Intergenic
1151882648 17:76904410-76904432 CCCCAAAGTCCAGGTGGGCCTGG + Exonic
1152805854 17:82355971-82355993 CTCCAAAACCCAAGTGGGCTTGG - Intergenic
1153086679 18:1296509-1296531 TCCCGAAGCCCAAGTGGGCGTGG + Intergenic
1156515291 18:37674119-37674141 TCACAAACCCCAACTGGGAAAGG - Intergenic
1156604387 18:38648880-38648902 CTCCAAAGCCAAATTGGGCAGGG + Intergenic
1158078855 18:53564771-53564793 TCTCAAAGCCCAAGTGTGCTGGG - Intergenic
1158227136 18:55213184-55213206 TGCCAAAGGCAAGGTGGGCAAGG - Intergenic
1160348200 18:78152017-78152039 TGGCAAGACCCAAGTGGGCAGGG - Intergenic
1161486714 19:4539785-4539807 TACAGAAGCCCAGGTGGGCATGG - Intronic
1162476764 19:10905119-10905141 GCCCAGAGCCCTGGTGGGCAGGG + Intronic
1163144173 19:15369610-15369632 TCTCAAAGACCCAGTGGGCCTGG + Intronic
1163411804 19:17159519-17159541 TCCCAAAAACCAAGTGGGAATGG + Intronic
1163415626 19:17184811-17184833 TCCCACAGCCCACACGGGCACGG - Intronic
1164255472 19:23524475-23524497 TACAACAGCCCATGTGGGCAGGG + Intergenic
1164313999 19:24070891-24070913 TACAATAGCCCATGTGGGCAGGG - Intronic
1164314532 19:24075290-24075312 TCACAAAGCCCCCATGGGCAGGG - Intronic
1167677534 19:50896662-50896684 TCCCAAGGCCCCAGTGAGCAGGG + Intergenic
925937962 2:8785665-8785687 TCCTAAAGCCCAAATGAGCATGG + Intronic
926259282 2:11242452-11242474 TACCAAAGCCCAAGTGAGAGAGG + Intronic
926568810 2:14507391-14507413 TCGGAAAGCCCAAGGGGTCAGGG - Intergenic
927241109 2:20920200-20920222 TCCCTAGGCAGAAGTGGGCAAGG + Intergenic
929030798 2:37648571-37648593 ACCCAAAGCCCGAGTGGGGCTGG - Intronic
932505247 2:72223284-72223306 TCCCAAAGTCTAAGTGTGTATGG - Intronic
932703610 2:74006764-74006786 GCCGAAAGCCCAAGAGGTCAAGG - Intronic
932777841 2:74539126-74539148 ACCCAAACCCCGAGTGGTCAGGG - Intronic
933368742 2:81388586-81388608 TCCCTAAGCCCAAGCTGGGAAGG + Intergenic
933443754 2:82350174-82350196 TCCCAAAGCCGAAGTGGGCATGG - Intergenic
934660882 2:96143091-96143113 TCCCAAACCCCAAGGGCACAAGG + Intergenic
936083162 2:109448954-109448976 TTCCAAAGCCCAAGGGATCAGGG - Intronic
936084312 2:109456080-109456102 TCCCAAGCCCCCAGTGGGCCTGG - Intronic
938128317 2:128690360-128690382 ACCCAAAGCCCATGAAGGCACGG - Intergenic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
939931086 2:148233982-148234004 TCCCAAAGAGCATCTGGGCAAGG + Intronic
941159415 2:162019350-162019372 ACCCCAAGCCTAAGTGTGCACGG + Intronic
942304474 2:174592278-174592300 TCTCTAATCCCAAGTGGGCAGGG + Intronic
942387021 2:175453133-175453155 TCCTTGAGCCCCAGTGGGCAAGG + Intergenic
944505030 2:200402307-200402329 GCACAAAGCAAAAGTGGGCAAGG - Intronic
944626000 2:201569463-201569485 TACCAAAGGCAAGGTGGGCATGG - Intronic
945317925 2:208391064-208391086 TCCCTAAGCCCAAGCTGGGAAGG - Intronic
945931199 2:215856184-215856206 TGCCAAAGCTCAACTGTGCAGGG + Intergenic
947144207 2:227049721-227049743 TTTCTAAGCCAAAGTGGGCACGG + Intronic
947380974 2:229545057-229545079 TCCCAAACCCCAAAAGAGCATGG - Intronic
947729416 2:232419842-232419864 TCCCATAGCCCAGGTGGCCCAGG - Intergenic
948739001 2:240030773-240030795 TCTCAAGATCCAAGTGGGCATGG + Intergenic
1168761886 20:354884-354906 TCCCCACGCCCCAGTGGCCAGGG - Intronic
1168876090 20:1173294-1173316 TCCCAAAGCCCTTGTAGGTAGGG - Intronic
1171172848 20:23031352-23031374 CCCCATAGCCCATGTGGCCATGG + Intergenic
1171208399 20:23298875-23298897 TCACAAAGCCTAGGTGGCCAGGG - Intergenic
1172233109 20:33350413-33350435 TCCCCAAGTACAGGTGGGCAAGG + Intergenic
1172967927 20:38851947-38851969 TGCTTAAGCCCATGTGGGCAAGG + Intronic
1174595439 20:51679688-51679710 TCCAAAAGGCCAAGAGGTCATGG + Intronic
1174833364 20:53834131-53834153 TCCGCCAGCCCAAGTGGCCACGG - Intergenic
1175163613 20:57027411-57027433 TTCCAGAGGCCAAGTGAGCAAGG + Intergenic
1176981043 21:15381251-15381273 TCCTGAAGCCAAAGTTGGCATGG - Intergenic
1178213772 21:30569446-30569468 TCCAGAAGCCCAAATGGGCATGG - Intergenic
1178734452 21:35136496-35136518 TCCCACAGCCCAAGTGGGGGTGG - Intronic
1178913322 21:36693470-36693492 TCCCAAAGCCCAGGTGTGTGTGG + Intergenic
1179458439 21:41515886-41515908 TGCCAAAGGCAAGGTGGGCATGG - Intronic
1180856449 22:19048895-19048917 TCCCCAGGCCCAGGTGGGGAAGG - Intronic
1184415302 22:44348779-44348801 TCCCATTGCCCCAGTAGGCAAGG + Intergenic
1184942360 22:47778367-47778389 TCCCAAGGCTCCAGAGGGCAGGG + Intergenic
949213525 3:1536114-1536136 TCCCAAAGCCCACCTCAGCATGG + Intergenic
950177193 3:10883033-10883055 CCCCACAGCCCAAGGGGGCGGGG + Intronic
950446573 3:13042241-13042263 TCCCATTGCCCTAGTGGCCAAGG + Intronic
951118985 3:18901237-18901259 TGCCAAAACCCAAGTAAGCAAGG - Intergenic
953339291 3:42120257-42120279 TCCCAAAGCCCAAAGGTCCATGG - Intronic
954671686 3:52294417-52294439 GCCCAGAGCCCAGGTGGGGAAGG - Intergenic
954882225 3:53844137-53844159 TCCCTAAGCCCCAGGGGGCCAGG + Intronic
956456465 3:69425815-69425837 TCCCAAAGCCCAAGTAAGTGGGG + Intronic
959910776 3:111761347-111761369 TCCAAAAGCAGAAGTGGGTATGG + Intronic
961343091 3:126243457-126243479 TCTCAAAGCCCCAGTGGGCATGG + Intergenic
961622771 3:128237912-128237934 TCCCAAAGAGCAGGTGGGCAAGG - Intronic
962431449 3:135324217-135324239 TCCCAAATGCCAGTTGGGCAAGG + Intergenic
963926377 3:150955802-150955824 TCCCAAAGCCCAACTGTCTATGG + Intronic
966659554 3:182399027-182399049 ACCCACAGCCCATGCGGGCAGGG + Intergenic
968093328 3:195910936-195910958 TCACAGAGCCCAACTGTGCAAGG + Intronic
968648082 4:1749692-1749714 TCCCAGAACCCAGCTGGGCAGGG - Intergenic
975410093 4:74038889-74038911 TCCCAAAGTCCCAGAGTGCACGG - Intergenic
979160397 4:117452735-117452757 TCAAAAAGCCCAATTAGGCAAGG + Intergenic
981609575 4:146578985-146579007 CTTCAGAGCCCAAGTGGGCAAGG - Intergenic
982127534 4:152197424-152197446 TGCCAAAGCCCAATTTGGCAGGG + Intergenic
983064215 4:163190744-163190766 TCCCTAAGCCCAAGCTGGGAAGG - Intergenic
984373668 4:178899666-178899688 TCCCAAAGCCCACGTGGATGTGG + Intergenic
988195080 5:27994597-27994619 TCCAAATGCTCAAGTGGGGAAGG + Intergenic
988481700 5:31637148-31637170 TCCCAAAGCCTAGGGTGGCATGG - Intergenic
988922813 5:35960603-35960625 TCCTAAAGCCCACGTGAGCATGG + Intronic
989346048 5:40430602-40430624 TCCCAAAGGGCAAGTGGGGACGG - Intergenic
990813088 5:59750856-59750878 ACCCAGAGCCCAAGAGGTCAAGG + Intronic
990985893 5:61640473-61640495 TCCCCATGACCAAGTGGACAGGG - Intronic
995233803 5:109801640-109801662 TCCCTGAGCCGAAGTGGGCAAGG - Intronic
995259621 5:110087085-110087107 TCAGACAGCCAAAGTGGGCAGGG + Intergenic
997346141 5:133193895-133193917 TCTCAAAGCAGAACTGGGCATGG - Intergenic
997423704 5:133788484-133788506 TCCCAAGCCCCAACTGGCCACGG + Intergenic
998868559 5:146530049-146530071 TCCCAAAGCCCAAGTGGGCCTGG - Intergenic
1000209276 5:159096016-159096038 CCCCTAAGCCCAAGGGGCCATGG + Intronic
1000516416 5:162241000-162241022 TCCTGAAGCCCCAGTGGGCAGGG + Intergenic
1001243547 5:170088436-170088458 TTACAAAGCCCAAGACGGCAAGG + Intergenic
1002031045 5:176430709-176430731 CCCCAAAGCCCAAGAGGTCAGGG + Intergenic
1002568599 5:180127803-180127825 TCTCCAAGCCCCAGTGGGGAGGG - Intronic
1002714233 5:181216501-181216523 TCCCAGAGTCCCAGTGGCCAAGG + Intergenic
1003783128 6:9451683-9451705 CCCCAAAGCCCCAGAGGGCATGG - Intergenic
1007730066 6:43940251-43940273 TCCCAAAATCCAAGTGGGGAAGG + Intergenic
1010127013 6:72444308-72444330 TCCTGAAGCCACAGTGGGCAGGG + Intergenic
1010986260 6:82427985-82428007 TACCAAAGCCCATGTTTGCAAGG + Intergenic
1013476151 6:110509040-110509062 TCCCAAAACCCAAGTGGGCATGG - Intergenic
1014096674 6:117468897-117468919 TCCAAAAGCAAAAGTGGCCATGG + Intronic
1015876547 6:137828404-137828426 TTCCAAAGGCCAAGGGGGAAAGG - Intergenic
1016990271 6:149923566-149923588 TCCCAAATCCCGAGTGGACGTGG + Intergenic
1018208785 6:161460507-161460529 TCCCCAAACCCAAGTGATCACGG - Intronic
1018465002 6:164035823-164035845 TCCCAGAGCCACAGTGGTCAGGG + Intergenic
1019371747 7:665712-665734 TCCCAAAGCCCAAGCCAGAATGG + Intronic
1021919340 7:25468369-25468391 TTCCAAAATCCAAGTGGGTAAGG + Intergenic
1022336478 7:29426716-29426738 TCACAAGGCCCAATTAGGCATGG + Intronic
1023167184 7:37354535-37354557 TCCCAAAGCGCAAGAGAGCTTGG - Intronic
1024439802 7:49403975-49403997 TCCCAAAGAGAAAGTGAGCAAGG - Intergenic
1025782149 7:64611366-64611388 TCACAACGCCCATGTAGGCAAGG - Intergenic
1025783641 7:64623869-64623891 TCCCTAAGCCCAAGCTGGGAAGG + Intergenic
1030797956 7:113813181-113813203 TCCCAAAGATAGAGTGGGCAAGG + Intergenic
1032797694 7:135290798-135290820 CCCCAAAGTCCCAGAGGGCATGG - Intergenic
1032913921 7:136465452-136465474 TCCAGAAGCTCAAGTGGGGAAGG - Intergenic
1034534735 7:151719730-151719752 TCCCAGAGCCTATGTGGGCCTGG + Intronic
1040797062 8:51298415-51298437 GCCCAAAGCCCCATTGGGGAGGG - Intergenic
1041935375 8:63326574-63326596 TCCTGAAGCCCCAGTGGGCCTGG - Intergenic
1044030776 8:87233758-87233780 TGCCACAGCCAAACTGGGCATGG - Intronic
1044278252 8:90327014-90327036 TCCCTAATCTCAAGTGGGCAGGG - Intergenic
1047615423 8:126558541-126558563 TCCCGAGGCCCGAGTGGGCGGGG - Intergenic
1048007375 8:130430526-130430548 TCCCCATGCCCAGGTGGTCAGGG - Intronic
1048504424 8:135007957-135007979 TCCCACAGCCAGAGTGGGAATGG - Intergenic
1050195989 9:3085206-3085228 TCCCTAAGCCCAAGCTGGGAAGG + Intergenic
1053042977 9:34890477-34890499 TCCCAGAATCCCAGTGGGCATGG + Intergenic
1057364436 9:94405621-94405643 ATAAAAAGCCCAAGTGGGCATGG - Intronic
1057658895 9:96982446-96982468 ATAAAAAGCCCAAGTGGGCATGG + Intronic
1059652233 9:116325574-116325596 CCCCCAAGGCCAAGTGGACAAGG + Intronic
1060243227 9:121922817-121922839 TCCCAAAGGTTAAGTGGACAAGG + Intronic
1060913128 9:127366711-127366733 TCCCAAAGAAAAAGAGGGCATGG + Intronic
1061118487 9:128629032-128629054 ACACAAAGCCCAAGCTGGCAGGG - Intronic
1061973469 9:134056758-134056780 TCCCAGAGTCCCAGTGGGGAGGG + Intronic
1188239678 X:27770645-27770667 TCTCAAGGCTCAAGTGGGGAAGG + Intergenic
1188765680 X:34088444-34088466 TCCGAAAACCCAACTGGGAATGG + Intergenic
1189083354 X:37996470-37996492 AACTAACGCCCAAGTGGGCAAGG + Intronic
1192220731 X:69195788-69195810 TCTCAGAGGCCAGGTGGGCAGGG + Intergenic
1192860093 X:75058683-75058705 ACCCAAAACCCAAGTGGCAATGG + Intronic
1193352741 X:80481339-80481361 TCCCTAAGCCCAAGCTGGGAAGG + Intergenic
1195084327 X:101400054-101400076 CCCCAAAGTCCAAGGGGTCATGG - Intronic
1195443884 X:104928638-104928660 TCCCAGAGCTCAAGTAGCCACGG + Intronic
1195927256 X:110038412-110038434 TCCCTGAGCCAAAGTGGGCATGG - Intronic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1196239006 X:113318251-113318273 TACCATTGCCCAAGTGGGCCTGG - Intergenic
1199606174 X:149581383-149581405 TCCCAAAGCCCAAAGGGCCCTGG + Intergenic
1199632947 X:149787985-149788007 TCCCAAAGCCCAAAGGGCCCTGG - Intergenic
1199635813 X:149810480-149810502 TCCCAAAGCCCAAAAGGCCTTGG - Intergenic
1199643813 X:149886071-149886093 TCCCAAAGCCCAAAAGGCCTTGG - Intergenic
1199948636 X:152687646-152687668 TCCCAAAGCCCAAAAGGCCCTGG - Intergenic
1199961040 X:152780803-152780825 TCCCAAAGCCCAAAAGGCCCTGG + Intergenic
1200137354 X:153881620-153881642 TCCCCAAGCCCAAAAGGGAAAGG - Intronic
1201727509 Y:17170196-17170218 TCCCAGATCCCAAGTGTGCCTGG + Intergenic