ID: 921633717

View in Genome Browser
Species Human (GRCh38)
Location 1:217466510-217466532
Sequence CCACCATGCCTGGCTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2342
Summary {0: 1, 1: 13, 2: 76, 3: 543, 4: 1709}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921633714_921633717 -4 Left 921633714 1:217466491-217466513 CCGGGATTACAGTCATGAGCCAC 0: 15
1: 1545
2: 3765
3: 4807
4: 4284
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709
921633707_921633717 20 Left 921633707 1:217466467-217466489 CCTCTGCCTCTGCCTCCCTAAGT 0: 2
1: 67
2: 1366
3: 3362
4: 5793
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709
921633706_921633717 21 Left 921633706 1:217466466-217466488 CCCTCTGCCTCTGCCTCCCTAAG 0: 4
1: 191
2: 5023
3: 66082
4: 154244
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709
921633711_921633717 8 Left 921633711 1:217466479-217466501 CCTCCCTAAGTGCCGGGATTACA 0: 11
1: 4232
2: 303484
3: 271643
4: 159169
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709
921633713_921633717 4 Left 921633713 1:217466483-217466505 CCTAAGTGCCGGGATTACAGTCA 0: 17
1: 1888
2: 100273
3: 241677
4: 249926
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709
921633712_921633717 5 Left 921633712 1:217466482-217466504 CCCTAAGTGCCGGGATTACAGTC 0: 1
1: 45
2: 5142
3: 243760
4: 287591
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709
921633709_921633717 14 Left 921633709 1:217466473-217466495 CCTCTGCCTCCCTAAGTGCCGGG 0: 2
1: 118
2: 8768
3: 219542
4: 268041
Right 921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG 0: 1
1: 13
2: 76
3: 543
4: 1709

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921633717 Original CRISPR CCACCATGCCTGGCTAAAAA TGG Intronic
Too many off-targets to display for this crispr