ID: 921634006

View in Genome Browser
Species Human (GRCh38)
Location 1:217470304-217470326
Sequence ATGAACAGCCTCTCATCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921634006 Original CRISPR ATGAACAGCCTCTCATCTCT AGG (reversed) Intronic
901867792 1:12118682-12118704 GTGATCAGCCCATCATCTCTAGG + Intronic
902730664 1:18366688-18366710 ATGAAAACCCTGTCATCTGTGGG + Intronic
902846303 1:19113241-19113263 ATGGCCAGCCTCCCATCTCATGG + Intronic
905651828 1:39661809-39661831 ATTAAGGGCCTCTCAGCTCTGGG + Intronic
906949682 1:50324052-50324074 ATGCACAGTCTCTGATCTCAAGG + Intergenic
906951334 1:50336377-50336399 ATCCACATCCTCCCATCTCTTGG - Intergenic
912172476 1:107117334-107117356 ATGAAGAGACTTTGATCTCTTGG + Intergenic
913027905 1:114864359-114864381 TTGAACAGGCTCTCATCTCTGGG - Intronic
915457692 1:156051563-156051585 ATGAATATGATCTCATCTCTAGG - Intronic
919003438 1:191864528-191864550 TTGAACAACCTTGCATCTCTGGG - Intergenic
919534551 1:198770876-198770898 ATCCACTGCCTCTCACCTCTTGG - Intergenic
921188219 1:212687597-212687619 ATGGACAGACTGTCATTTCTGGG + Intronic
921634006 1:217470304-217470326 ATGAACAGCCTCTCATCTCTAGG - Intronic
922125555 1:222717876-222717898 ATATACAGCCTCTACTCTCTTGG + Intronic
922606200 1:226891378-226891400 GCTAACAGCCTCTCATCACTGGG + Intronic
922764765 1:228151052-228151074 AGGAACAGCCCCTCACTTCTGGG + Intronic
924366301 1:243297382-243297404 ATGAACATTCTTTCATCTGTTGG + Intronic
1067018427 10:42774671-42774693 ATAAATAGCTTCTCAGCTCTCGG + Intergenic
1074960972 10:118445605-118445627 ATGGAAAGCTTCTCATTTCTAGG - Intergenic
1075182434 10:120223863-120223885 ATGAACAGTCTTTCTCCTCTGGG - Intergenic
1076753551 10:132555907-132555929 ATGAACAGCCTCTCACCTGCTGG + Intronic
1077511548 11:2967215-2967237 ATGAAAAGCCACTGACCTCTAGG + Intronic
1078110253 11:8386511-8386533 AAGAACTGCCTCTCTTCTCCTGG + Intergenic
1078872539 11:15362570-15362592 ATGAACAGACTCTTATCAGTGGG - Intergenic
1079323140 11:19469183-19469205 AGGAACAGCCACTGATCTTTAGG - Intronic
1080155749 11:29108651-29108673 TTGCACAGCATCTCATCTCCAGG - Intergenic
1080270508 11:30446508-30446530 AGAAACAGCCTTCCATCTCTGGG + Intronic
1080787853 11:35492312-35492334 AGGAAGAACCTCTCATCTCAAGG + Intronic
1081426241 11:42929291-42929313 CTCAACAACCTCTTATCTCTAGG - Intergenic
1082729416 11:56776615-56776637 ATGAACAGCCACTCATTTCTAGG + Intergenic
1089449177 11:118579843-118579865 ATGAACATCATGTCATCACTGGG + Intronic
1091138693 11:133217127-133217149 AGGTACAGCCTCTCACCTCCAGG + Intronic
1093860470 12:24159944-24159966 AGGCAAAGCTTCTCATCTCTGGG + Intergenic
1097161237 12:57048045-57048067 ATCAACAGCTTCCCATCTATGGG - Exonic
1098394776 12:70006045-70006067 ATGCACAGCCTCTCATTGCTGGG - Intergenic
1101833861 12:108281277-108281299 ATGCACAGCCCCTCATATCCTGG + Intergenic
1105017995 12:132797901-132797923 AAGAAAATCCTCTCATCCCTAGG + Intronic
1105705373 13:22964851-22964873 ATGAACCTCCTCTCTGCTCTTGG + Intergenic
1108438557 13:50425631-50425653 AAAAACAACCTCACATCTCTGGG - Intronic
1110278744 13:73668223-73668245 ATGAACATCCTCACATCCATGGG - Intergenic
1111181813 13:84678916-84678938 ATGAAAAGCCTTTCATTTCAAGG + Intergenic
1111515328 13:89323695-89323717 ATAAACATTCTGTCATCTCTTGG - Intergenic
1113062400 13:106337320-106337342 AAGCAGAGCCTCTCCTCTCTAGG - Intergenic
1114394025 14:22340318-22340340 ATGCACATCCTCTTATCTCAGGG - Intergenic
1115469048 14:33748850-33748872 AGGAACAGCCCCTGATTTCTGGG + Intronic
1116244719 14:42394824-42394846 ATGAATTGCCTCTAATCTATAGG + Intergenic
1120082537 14:80232026-80232048 ATGGACAGCCTCACCTCTATTGG - Intronic
1120668266 14:87333278-87333300 ATGAGCAGGATCTCATCTCCAGG + Intergenic
1122080076 14:99261023-99261045 GTGAACACCCTGTCATCTCAGGG - Intronic
1124375794 15:29127912-29127934 TTGAACAGCCTCTGATGGCTTGG + Intronic
1131815824 15:96220215-96220237 ATAGACACCCTCTCATATCTTGG - Intergenic
1133605279 16:7381177-7381199 TAAAACAGCCTCTCATCTCAGGG + Intronic
1137248793 16:46728186-46728208 ATGAACGGCCTCTGAGCCCTTGG + Intronic
1138285806 16:55809513-55809535 AGGAACAGACACTCCTCTCTAGG + Intronic
1138700114 16:58853887-58853909 AAGCACAGCATCTCCTCTCTTGG + Intergenic
1140709001 16:77658823-77658845 TTGAGCAGCTTCTCACCTCTGGG + Intergenic
1140762042 16:78118452-78118474 ATGAACAAACTGCCATCTCTGGG + Intronic
1141520271 16:84574189-84574211 ATGAACTGCGTCCCCTCTCTGGG - Intronic
1144303926 17:13950168-13950190 ATGAGTAGCCTCTCATCTTGGGG + Intergenic
1144451941 17:15388447-15388469 ATGATCAGCCCCTCCTCTCTTGG - Intergenic
1146677661 17:34784647-34784669 AGGTACAGCCCGTCATCTCTGGG - Intergenic
1150272899 17:63878032-63878054 ATAACCAGCCTCTGATCTCAAGG - Intronic
1150278558 17:63915333-63915355 ATAACCAGCCTCTGATCTCAAGG - Intronic
1150279656 17:63921949-63921971 ATAACCAGCCTCTGATCTCAAGG - Intergenic
1151420165 17:73991710-73991732 ATGTGCACCCTCTCATTTCTGGG + Intergenic
1153950061 18:10051057-10051079 TTGAACAGCCTCTAATTTCTAGG - Intergenic
1156218817 18:35030212-35030234 CTGTACAGCCTCCCATCCCTGGG + Intronic
1156593898 18:38523771-38523793 AAGATCAGTCTCTCATCTCTGGG - Intergenic
1158396114 18:57079437-57079459 AGGAAAAGCCTCACACCTCTGGG - Intergenic
1160754931 19:752113-752135 ATGAGCAGGTTCTCCTCTCTGGG + Intronic
1168181672 19:54666207-54666229 ATGGACAGAGTCTCAGCTCTGGG - Intronic
930543139 2:52732927-52732949 ATGATCTGCCTCCTATCTCTAGG - Intergenic
931193456 2:60027736-60027758 ATGAACAGCCTCATCTCTCTTGG + Intergenic
934651398 2:96093128-96093150 ATGTCCAGCCTCTCATTTATGGG + Intergenic
936292783 2:111239238-111239260 GTAAACAGCCTCTCAGCACTGGG - Intergenic
939582798 2:143970325-143970347 ATATACAACCTCTCACCTCTGGG - Intronic
939936325 2:148298043-148298065 AGGAGTAGCCTCTAATCTCTTGG + Intronic
940677267 2:156739735-156739757 ATGAACAACATCTCATACCTGGG + Intergenic
941052263 2:160748401-160748423 AAGAAGAGCCTCTCCTCTCTAGG + Intergenic
941577643 2:167254215-167254237 ATGTATAGCCTCATATCTCTAGG + Intronic
941737397 2:168994005-168994027 ATTAACAGCCTCTCAGATCTTGG + Intronic
945201830 2:207289556-207289578 ATCAAGACCCTCTCGTCTCTTGG + Intergenic
1170458643 20:16556136-16556158 ATGAACAGCCTTTATTCTGTTGG - Intronic
1170517291 20:17144176-17144198 ATCAACATCCTCTCTCCTCTTGG - Intergenic
1170989206 20:21286792-21286814 ATCAACAGCTTCTCCTCTCCTGG + Intergenic
1171163649 20:22951719-22951741 ATGAGCAGCCTCAGCTCTCTGGG - Intergenic
1171351075 20:24503764-24503786 ATGATCTGCCTCTCATCTTTAGG + Intronic
1173787075 20:45801847-45801869 AAAAACTGCCTCTCATGTCTAGG - Intronic
1178661012 21:34507635-34507657 AAAAACAGTCTCTCTTCTCTAGG - Intergenic
1181816104 22:25437893-25437915 ATGAACAGCCCCTTTTCCCTGGG - Intergenic
1182161818 22:28129918-28129940 ATCAACAGCATCTCATCTCCTGG - Intronic
1182780309 22:32862300-32862322 ATGCTCAGGCTCTCAGCTCTCGG + Exonic
954109243 3:48424991-48425013 ATGTAGAGCCTCTCCTTTCTTGG - Intronic
954657861 3:52207939-52207961 ATGAACTTCCTCTAATTTCTAGG - Intronic
956948271 3:74249482-74249504 GTTAACAACCTCTCATCTTTTGG - Intergenic
958253727 3:91300411-91300433 ATGAACATACTCTCCTCCCTTGG + Intergenic
959315844 3:104805646-104805668 ATAAACAGACTTTAATCTCTGGG - Intergenic
961131794 3:124475297-124475319 ATGAACAGTCACTCATCTTGTGG - Intronic
961553389 3:127681423-127681445 ATGGACAGCTTCCCATCTTTGGG - Intergenic
967480231 3:189964049-189964071 ATGATCAGCTTCTCATCTGGAGG - Exonic
967730695 3:192904283-192904305 ATGAACTGCCACCCTTCTCTGGG + Intronic
967863026 3:194167098-194167120 AGCTACAGGCTCTCATCTCTGGG - Intergenic
968578564 4:1379175-1379197 ATGAGCAGCCTCTCATCACTGGG + Intronic
969143449 4:5100202-5100224 ATGGACGGGCTCTCGTCTCTGGG + Intronic
970223736 4:13836043-13836065 AGGCACAGCCTCTGTTCTCTGGG + Intergenic
971155006 4:24072503-24072525 ATGAGCAAGCTCTCCTCTCTAGG + Intergenic
971553662 4:27984506-27984528 AGGAACTAGCTCTCATCTCTAGG + Intergenic
972247232 4:37258185-37258207 ATGAGCAGCCACTATTCTCTAGG + Intronic
972258586 4:37385186-37385208 AGGAAAAGCCTCTCTACTCTTGG + Intronic
972410609 4:38790208-38790230 ATGCACAGCATCTCCTTTCTTGG + Intergenic
974348264 4:60710555-60710577 ATGAACAGTTTCTTATTTCTGGG + Intergenic
976244817 4:82996269-82996291 ATGAAGAGCCTCTCTTTTCTTGG - Intronic
982565017 4:156975213-156975235 ATGAAAAGTGTCTCATTTCTTGG - Intergenic
984446115 4:179837812-179837834 ATGGAAATACTCTCATCTCTTGG - Intergenic
986334103 5:6740309-6740331 ATGAAAAGCCTTTTATCTTTGGG + Intronic
989974166 5:50562601-50562623 TTGGACAGCCTTTCATCTGTGGG + Intergenic
990853479 5:60235484-60235506 ATAAACAGTGTCTCATCTTTAGG + Intronic
990974740 5:61549410-61549432 GTTAATAGCCTCTCATCTCTCGG - Intergenic
991605521 5:68396798-68396820 AGGAGCAGCCTCTTCTCTCTGGG - Intergenic
992554649 5:77891596-77891618 ATGAGCAGCTTCTCTTCTATTGG - Intergenic
993448914 5:88049583-88049605 ATGGACAGCCTTTCACCTCTAGG - Intergenic
997890720 5:137673839-137673861 AAGAACAGTCTCTGAGCTCTGGG + Intronic
1001730546 5:173952155-173952177 ATGAAAAGCGTTTCATCCCTAGG + Intronic
1009190745 6:60626625-60626647 ATGAACATACTCTCCTCCCTTGG - Intergenic
1014241177 6:119019239-119019261 ATTTACAATCTCTCATCTCTTGG - Intronic
1019620647 7:1990281-1990303 CTCAGCACCCTCTCATCTCTTGG - Intronic
1019828969 7:3306836-3306858 ATTACCAGTCTCTGATCTCTGGG - Intronic
1021926411 7:25538636-25538658 AAGAACAGGCACTGATCTCTTGG + Intergenic
1022478859 7:30729901-30729923 AAGAACTGCCTCTCATTCCTAGG - Intronic
1025781016 7:64601934-64601956 AGGAAAAGTCTCTCATCCCTTGG - Intergenic
1026487042 7:70830514-70830536 ATGAATAGCCAGTCATCTTTTGG + Intergenic
1026514359 7:71055362-71055384 ATTAACCGCCTCTCATTTATGGG - Intergenic
1027125508 7:75554083-75554105 ATGAACAGCCCCTCATGCCCCGG + Intronic
1029115312 7:98233546-98233568 ACCACCAGCCTCTCCTCTCTGGG - Exonic
1029146312 7:98448613-98448635 GTGGACAGCAGCTCATCTCTTGG + Intergenic
1029197568 7:98816538-98816560 AGGCACAGACTCTCTTCTCTGGG - Intergenic
1030264551 7:107606144-107606166 ATGAACAGCTTCTAATATTTAGG - Intronic
1032751537 7:134846425-134846447 ATTACCAGCCTCCCCTCTCTAGG + Intronic
1037207960 8:16347668-16347690 ATGTACAGCCTCTTCTGTCTAGG - Intronic
1037737969 8:21581952-21581974 ATGAAAACGCTCTCATCACTTGG + Intergenic
1048141229 8:131796612-131796634 TGGAACAGCCTCTCAGCTCCAGG - Intergenic
1050620533 9:7447596-7447618 ATGTTCACCATCTCATCTCTGGG - Intergenic
1051062307 9:13058710-13058732 ATGACAAGCCTATCATCTCTAGG - Intergenic
1051384307 9:16490858-16490880 ATGAGCAGTCCCTAATCTCTAGG + Intronic
1055196283 9:73598450-73598472 ATATACAGCCTCTCCTCTCCAGG - Intergenic
1055355804 9:75435970-75435992 ATGTCCAGCCTCACATATCTGGG - Intergenic
1056768370 9:89459309-89459331 GTGAACAGCCTCTAGTCCCTGGG + Intronic
1059033654 9:110729820-110729842 ATGAACTACCTCTCTTTTCTTGG - Intronic
1059959307 9:119549882-119549904 AGCAGCAGCCTCTCTTCTCTGGG - Intergenic
1060545014 9:124454416-124454438 CTGAACAGGCTGGCATCTCTGGG + Intronic
1187235950 X:17467338-17467360 AAACACAGCATCTCATCTCTTGG + Intronic
1196047143 X:111268184-111268206 TTGAACAGACTCTTCTCTCTGGG - Intronic
1198221235 X:134604456-134604478 CTCATCAGCCTTTCATCTCTAGG + Intronic