ID: 921634840

View in Genome Browser
Species Human (GRCh38)
Location 1:217480057-217480079
Sequence ATAGCTGGAGACTTTGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 232}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921634835_921634840 -10 Left 921634835 1:217480044-217480066 CCCCAATACAATAATAGCTGGAG 0: 151
1: 315
2: 418
3: 332
4: 411
Right 921634840 1:217480057-217480079 ATAGCTGGAGACTTTGGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921634840 Original CRISPR ATAGCTGGAGACTTTGGTCT GGG Intronic
905062081 1:35148849-35148871 ATTGCTTGATACTTTGGTTTTGG - Intergenic
906499563 1:46331693-46331715 ATTGCTGGATACTTTGGTTTTGG - Intergenic
910853284 1:91669769-91669791 ATTGCTTGATACTTTGGTTTTGG - Intergenic
911878845 1:103207229-103207251 ATAAATGTAGATTTTGGTCTTGG - Intergenic
912152974 1:106882047-106882069 ATAGCTAGAGACTGCTGTCTAGG - Intergenic
913474246 1:119221515-119221537 ATAGCTAGGGACTGTGGTTTGGG + Intergenic
914222469 1:145693180-145693202 ACAGCTGGAGCCTTTGGGCATGG - Intronic
915499478 1:156305276-156305298 ACAGCTGCAGATTTTGGTATAGG + Intergenic
915913360 1:159927805-159927827 ATTGCTGGAGACTTTGCACCTGG - Exonic
916248872 1:162716425-162716447 AATCCTGGAGACATTGGTCTTGG - Intronic
916766347 1:167864079-167864101 ATTGCTTGATACTTTGGTTTTGG + Intronic
921482322 1:215677395-215677417 ATAGGTGGAGACTGTGGGATGGG - Intronic
921634840 1:217480057-217480079 ATAGCTGGAGACTTTGGTCTGGG + Intronic
924859303 1:247904937-247904959 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1062984899 10:1759632-1759654 ATTGCTGCAGCCTTAGGTCTTGG - Intergenic
1065930819 10:30477040-30477062 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1067668195 10:48296393-48296415 ATAGCAGGACACTCTGGTCTGGG - Intergenic
1068676005 10:59770520-59770542 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1070600386 10:77862188-77862210 TTTGCTGTAGAATTTGGTCTTGG - Intronic
1075395571 10:122124550-122124572 CTAGCTGGACACTTGGGGCTGGG - Intronic
1075566682 10:123510062-123510084 AGAGCTTGAGACTGTGGGCTTGG + Intergenic
1075903192 10:126059867-126059889 ATAGCTGGATATTTTTGTTTAGG - Intronic
1077589596 11:3481316-3481338 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1078038349 11:7832890-7832912 AAAGCTGGAGCCTTGGGTCTAGG + Intergenic
1078631479 11:13008519-13008541 ATAGCTTGTGACTTGGGTCTGGG + Intergenic
1078846223 11:15120600-15120622 ATAACTGGAGCCTATGGTGTGGG + Intronic
1083089627 11:60186281-60186303 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1083197063 11:61094548-61094570 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1084827371 11:71741488-71741510 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1085239522 11:75040871-75040893 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1085998616 11:81952182-81952204 ATTGCTGGATACTTTGGTTTTGG + Intergenic
1087894538 11:103572867-103572889 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1089000755 11:115050272-115050294 CAAGCTGGAGACGTTGGGCTGGG - Intergenic
1089640591 11:119844954-119844976 CTTGCTGGAAACTTGGGTCTCGG - Intergenic
1091814799 12:3429575-3429597 ATTGCTTGATACTTTGGTTTTGG - Intronic
1092415885 12:8290222-8290244 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1095131006 12:38542461-38542483 AAAGCTGGAGACTCTCCTCTGGG - Intergenic
1096207489 12:49735070-49735092 ATTGCTTGATACTTTGGTTTTGG + Intronic
1098248132 12:68541065-68541087 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1100254898 12:92873074-92873096 ATAGATGTGGACTTGGGTCTTGG + Intronic
1100780448 12:98020049-98020071 ATAGCTTGTTACTTTGGTTTGGG - Intergenic
1101029840 12:100647789-100647811 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1102183381 12:110929708-110929730 ATGGCTGAGGATTTTGGTCTGGG - Intergenic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1104094894 12:125548105-125548127 ATTGCTGGAGCCTTTGGTGGGGG - Intronic
1104848781 12:131861019-131861041 ATCGCTGGAGGCTGTGGTCAGGG - Intergenic
1105308064 13:19182699-19182721 ATAGGTGGAGAGGTTGGGCTGGG + Intronic
1105742248 13:23339200-23339222 AAAGTTGGAAAATTTGGTCTTGG - Exonic
1111621247 13:90728298-90728320 ACAGCTTCAGACTTTTGTCTGGG + Intergenic
1112133220 13:96546956-96546978 TTAGCAGGAGAATATGGTCTGGG + Intronic
1114696379 14:24631107-24631129 AAAGCTTGAGACTTTGGTGCAGG + Exonic
1115951547 14:38727487-38727509 GTAGCTGGAGACTCTGGGCCAGG + Intergenic
1117410315 14:55444608-55444630 ATAGCTTAAGATTTTGGGCTGGG - Intronic
1119765331 14:77184118-77184140 ATTCCTGGAGTCTCTGGTCTAGG + Intronic
1119785526 14:77310755-77310777 CTAACTGGAGACTTAGATCTTGG - Intronic
1122103247 14:99430490-99430512 ATAGCTGGAGTCTTTGGTGCTGG - Intronic
1126311238 15:47319372-47319394 ATAGCTGGACATTTTGGACTTGG + Intronic
1126700576 15:51363145-51363167 GTAGCTGCATACTTGGGTCTGGG + Intronic
1127779930 15:62303287-62303309 ATAGCTGGAGAGTTAGAGCTGGG + Intergenic
1128248849 15:66151203-66151225 ATTTCTGGGGACTTTGGTCAGGG - Intronic
1130409724 15:83635199-83635221 ACAGCTGTAGATATTGGTCTAGG + Intergenic
1130413750 15:83670369-83670391 ACTGCTACAGACTTTGGTCTAGG - Intronic
1130994899 15:88898210-88898232 GAGGCTGGAGACTTTGGTCCAGG - Intergenic
1135066906 16:19317635-19317657 ATAGCTTGAGCCTTTGGACAAGG + Intronic
1136421318 16:30135318-30135340 AGAGCTGGAGGCTGTGGGCTGGG + Intergenic
1136451522 16:30356633-30356655 AGAGCTGGAGACTTGGCTGTGGG + Intergenic
1137451293 16:48577181-48577203 AAAGGAGGAGACTTTGGGCTTGG - Intronic
1140755102 16:78059753-78059775 ATTGCTTGATACTTTGGTTTTGG - Intronic
1144932870 17:18874420-18874442 ATTTCGGGAGACTTTAGTCTTGG + Intronic
1147810515 17:43166743-43166765 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1148621797 17:49040085-49040107 AAAGCTGGAGACTTACGTTTTGG - Exonic
1152453435 17:80398157-80398179 ATTGCTTGATACTTTGGTTTTGG + Exonic
1153094090 18:1381747-1381769 ATCAATGAAGACTTTGGTCTGGG - Intergenic
1154014315 18:10603325-10603347 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1156377852 18:36530924-36530946 ATGACTGGAGACTTTGGGCTGGG + Intronic
1158233855 18:55290301-55290323 ATTGCTGCAGACTTTTGTCAAGG + Intronic
1158291656 18:55951226-55951248 ATTGCTTGAAACTTTGGTTTTGG + Intergenic
1160685078 19:430837-430859 ATGGCTGGAGACTTAGGGGTGGG + Intronic
1161830327 19:6597999-6598021 ATTGCTTGATACTTTGGTTTTGG + Intronic
1162281700 19:9703181-9703203 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1162284772 19:9730030-9730052 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1163151877 19:15420181-15420203 ACAGCTGAAGACATTGGTCATGG + Exonic
1163668295 19:18613215-18613237 ACAGCAGGAGACTTTGGTGGGGG + Intronic
1163867360 19:19785400-19785422 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1163966946 19:20754740-20754762 ATTGCTTGATACTTTGGTTTTGG - Intronic
1163991548 19:21003219-21003241 ATTGCTCGATACTTTGGTTTTGG + Intergenic
1164121830 19:22272753-22272775 ATTGCTCGATACTTTGGTTTTGG - Intergenic
1164130984 19:22361721-22361743 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1164217592 19:23163424-23163446 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1165703009 19:37952842-37952864 ATTGCTGGAGATTCTGGTTTGGG + Intronic
1166375989 19:42327301-42327323 ATCCCTGGTGACTTAGGTCTTGG + Intronic
1166667377 19:44689172-44689194 ATAGCTGGAGACCGGGGTCGGGG + Intergenic
925378449 2:3406037-3406059 ACAGCTGGGAACTTTGCTCTGGG - Intronic
925437346 2:3851367-3851389 ATAGCTTGAGATTTTGTTATTGG + Intergenic
926491692 2:13532584-13532606 ATTGCTTGATACTTTGGTTTTGG - Intergenic
929542643 2:42834208-42834230 CTAGCTGGAGGCTTTGAGCTGGG + Intergenic
931696582 2:64875365-64875387 ATAGCTGAAGACTTTAATTTTGG + Intergenic
932879673 2:75489493-75489515 ATAGGTAGAGACATAGGTCTGGG + Intronic
935721701 2:105985492-105985514 ATTGCTTGATACTTTGGTTTTGG - Intergenic
936419810 2:112353033-112353055 ATTGCTTGATACTTTGGTTTTGG - Intergenic
937777712 2:125799450-125799472 AATGTTGGAGACATTGGTCTTGG + Intergenic
940734911 2:157439908-157439930 ACAGCTGAAGTATTTGGTCTTGG - Intronic
940760355 2:157732039-157732061 ATAACTGGATACTTTTTTCTAGG + Intergenic
941030488 2:160505819-160505841 ATATCTGGAGACATTTGACTGGG + Intergenic
941415364 2:165214048-165214070 ATAGCTGGTGAATTTGGAATAGG - Intergenic
941856066 2:170232276-170232298 ATAGCTTCAGACTTTGGTATTGG + Intronic
942866938 2:180687745-180687767 ATAGCTGGAGTTTTTATTCTGGG + Intergenic
943407836 2:187511325-187511347 ATGGCTTGATACTTTGGTTTTGG + Intronic
944763521 2:202841312-202841334 GCAGCTGGAGACTCTGGGCTTGG - Intronic
945754217 2:213826901-213826923 ATAGCTGGGTGCTTTGGTGTTGG + Intronic
945803133 2:214459080-214459102 ATATCTGGATACTCTGGTGTTGG + Intronic
946997595 2:225412738-225412760 AGAGCTGGAGGCTTGGGTCTAGG + Intronic
947594381 2:231401577-231401599 ATTGCTTGATACTTTGGTTTTGG + Intergenic
949028015 2:241775288-241775310 AGAGCTGGGGACTTTGACCTGGG + Intergenic
1170401178 20:15985371-15985393 ATTGCTAGATACTTTGGTTTTGG - Intronic
1170770316 20:19326966-19326988 TTAGCAGAAGACTTTGCTCTGGG + Intronic
1171407305 20:24920105-24920127 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1172707288 20:36891511-36891533 CTAACTGCAGACTTTGTTCTTGG + Exonic
1173770112 20:45648905-45648927 AAAGGTGGAGACTTTGGGCCTGG + Intronic
1174854303 20:54028536-54028558 AAAGCTGGAGTCCTTGGGCTTGG + Exonic
1177665677 21:24155595-24155617 AGAGGAGGAGACTTTGGACTGGG - Intergenic
1178739865 21:35188775-35188797 ATAGCTTGAGATTTTTATCTCGG - Intronic
1179669097 21:42932921-42932943 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1179671115 21:42949327-42949349 ATTGCTTGATACTTTGGTTTTGG - Intergenic
950331533 3:12159582-12159604 ATAGCTGGAGACAGCGCTCTTGG + Intronic
951166567 3:19489832-19489854 ATTGCTTGATACTTTGGTTTTGG - Intronic
951248769 3:20370465-20370487 ATTGCTTGATACTTTGGTTTTGG - Intergenic
952611623 3:35216684-35216706 GCAGCTGGAGACTCTGGTCTAGG - Intergenic
955152287 3:56379900-56379922 ATATTTGGAGCCTTTGCTCTGGG + Intronic
957405708 3:79773720-79773742 ATTGCTTGATACTTTGGTTTTGG + Intergenic
958813775 3:98893340-98893362 AAATCTGGAGGCTTTGGACTTGG - Intronic
961893436 3:130148835-130148857 ATTGCTTGATACTTTGGTTTTGG - Intergenic
962096240 3:132295809-132295831 ATTGCTTGATACTTTGGTTTTGG + Intergenic
962276854 3:134021059-134021081 ATTGCTTGATACTTTGGTTTTGG + Intronic
964522990 3:157587150-157587172 ATTGCTTGATACTTTGGTTTTGG - Intronic
964933334 3:162051869-162051891 ATTGCTTGATACTTTGGTTTTGG - Intergenic
966029860 3:175332892-175332914 ATAGCTGGGCACTCTGGTATTGG + Intronic
966866234 3:184260440-184260462 ATAGCTGGAGCCTTTGGAAGAGG - Intronic
967683572 3:192394072-192394094 AAAGCTGGAGACTTATTTCTGGG - Intronic
968062673 3:195738197-195738219 ATAGCTGGAGAGTTTTCTCCAGG - Intronic
968640123 4:1710180-1710202 ATATTTAGAGACTTGGGTCTAGG - Intronic
968783233 4:2599092-2599114 TTAGCTGGAGACTTGGGTGCAGG + Intronic
969276987 4:6142591-6142613 ATAGCTGGAGTCTCTGCTCTCGG + Intronic
971027229 4:22600212-22600234 ATTGCTGGATACTTTGGTTTTGG + Intergenic
971357580 4:25908907-25908929 ATAGCTTGAGGCTCTGGTCAGGG + Intronic
971587987 4:28430475-28430497 ATCTCTGGATACTTTGGTTTGGG + Intergenic
972274844 4:37547269-37547291 ATTGCTTGATACTTTGGTTTTGG + Intronic
972778039 4:42261418-42261440 AAAGCTGCAGTCTTTGGTTTTGG + Intergenic
972953782 4:44363676-44363698 ATACCAGGAGTCTTTTGTCTAGG - Intronic
972991589 4:44827796-44827818 ATTGCTTGATACTTTGGTTTTGG - Intergenic
974949920 4:68575701-68575723 ATTGCTGGATACTTTGGTTTTGG - Intronic
974987883 4:69051826-69051848 ATTGCTGGATACTTTGGTTTCGG + Intronic
975205393 4:71639140-71639162 ATTGCTTGATACTTTGGTTTTGG + Intergenic
976015608 4:80549351-80549373 ATAGATGGAAACTTAGGACTTGG + Intronic
976491113 4:85671575-85671597 TTAGCTGTAGACTTTTGTTTTGG + Intronic
976990428 4:91358557-91358579 ATTGCTGGATACTTTGGTTTTGG - Intronic
977043888 4:92045665-92045687 ATTGCTTGATACTTTGGTTTTGG - Intergenic
977683400 4:99819799-99819821 ATAGCAGAAGTCTTTGTTCTTGG + Intronic
977972102 4:103224457-103224479 ATTGCTTGATACTTTGGTTTTGG + Intergenic
978026127 4:103877051-103877073 ATAACTGAAGAATTTTGTCTGGG - Intergenic
978716328 4:111847417-111847439 ACATCTGGAAACTTTGATCTGGG - Intergenic
979052393 4:115951348-115951370 ATTGCTGGATACTTTGGTTTTGG + Intergenic
980072746 4:128260844-128260866 ATTGCTTGATACTTTGGTTTTGG + Intergenic
980440616 4:132839494-132839516 ATAGCTGAAAACTCAGGTCTTGG + Intergenic
980655349 4:135775819-135775841 AATGCTAGAGATTTTGGTCTAGG + Intergenic
980776707 4:137446263-137446285 ATTCCTGGAGATTTTGCTCTAGG - Intergenic
980779558 4:137479135-137479157 ATTGCTTGATACTTTGGTTTTGG + Intergenic
981604391 4:146526734-146526756 ATTGCTTGATACTTTGGTTTTGG + Intergenic
982557192 4:156882129-156882151 ATAGCAGGATACTTAGGACTTGG - Intronic
982662886 4:158228102-158228124 ATTGCTTGATACTTTGGTTTTGG - Intronic
986594777 5:9409819-9409841 TTACCTGGAGACTTTGATTTGGG - Intronic
987095691 5:14547198-14547220 AAAGCTGGAGAGTTTAATCTTGG - Intergenic
987299200 5:16581674-16581696 ATGGCTGGAGACTTAGGGATTGG - Intronic
987930753 5:24397198-24397220 ATTGCTAGATACTTTGGTTTTGG - Intergenic
988076057 5:26356758-26356780 ATATCTGGATACTCTGGTTTTGG + Intergenic
988621477 5:32828182-32828204 ACAGCTGGAGTCATTGGCCTTGG - Intergenic
989096337 5:37785302-37785324 ATTGCTTGATACTTTGGTTTTGG - Intergenic
989211812 5:38863828-38863850 ATATCTGGATACTCTGGTGTTGG + Intronic
991437797 5:66614441-66614463 ATTCCTGAAGACTTTAGTCTTGG + Intronic
991685155 5:69175042-69175064 AGAGCTTTAAACTTTGGTCTGGG + Exonic
992789320 5:80199258-80199280 ATAGCTGGAGACCTTGGGTGAGG + Intronic
992989772 5:82272767-82272789 ATTGCTGGATACTGTGGTTTTGG - Intronic
995967086 5:117920692-117920714 ATACCTGCAGACATTGGTCTAGG + Intergenic
996432989 5:123401875-123401897 GCAGCTGGAGACTCTGGGCTAGG - Intronic
997860670 5:137412492-137412514 ATAGCTGTCCACTTTGGTTTAGG + Intronic
998114655 5:139526835-139526857 ATTGCTGGATACTTTAGTTTTGG + Intronic
998417515 5:141956534-141956556 AGGGCTGGAGTCCTTGGTCTTGG + Exonic
998555336 5:143117766-143117788 ATAGCTGAAGACTTTGATAAGGG + Intronic
1000604997 5:163318534-163318556 ATTGCTGGATACTTTGGTTCTGG - Intergenic
1000666128 5:163999522-163999544 ATAGTGAGAGACTTTGGTCAAGG - Intergenic
1002999379 6:2317248-2317270 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1003250853 6:4428251-4428273 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1003370535 6:5521614-5521636 ATAGCTAGAGTCTTGGGTCTTGG - Intronic
1006936994 6:37725515-37725537 ATAGCTGGAGACTTGTGGTTAGG - Intergenic
1008317302 6:50060496-50060518 TTAGATGTAGAGTTTGGTCTAGG - Intergenic
1009395303 6:63193175-63193197 GCAGCTGGAGACTCTGGGCTAGG - Intergenic
1010317666 6:74469110-74469132 ATTGCTGGATACTTTGGTTTAGG + Intergenic
1012800666 6:103822997-103823019 ATAGCTGGAGACTTCAGCATTGG + Intergenic
1013487763 6:110614483-110614505 ATTGCTGGAGCCTGTGCTCTGGG + Exonic
1013559381 6:111289635-111289657 ATTGCTGGATACTTTGGTTTTGG - Intergenic
1014547330 6:122748407-122748429 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1018584530 6:165341638-165341660 ACAGCTGCAGACTTCAGTCTAGG + Intronic
1020044119 7:5027747-5027769 ATTGCTTGATACTTTGGTTTTGG - Intronic
1020323662 7:6958350-6958372 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1021174385 7:17434310-17434332 ATAGCTGCACAGTTTTGTCTTGG + Intergenic
1021454686 7:20817012-20817034 ATAGCTGTTGACTTTGATTTTGG + Intergenic
1022047816 7:26637099-26637121 ATAACTGGTGACATTGATCTTGG - Intergenic
1022489871 7:30808357-30808379 ATTGCTTGATACTTTGGTTTTGG + Intronic
1024188307 7:46977425-46977447 ATGGCTGCAAAGTTTGGTCTTGG - Intergenic
1026663924 7:72325696-72325718 ATAACTTGAGGCTTGGGTCTTGG + Intronic
1028382878 7:90218340-90218362 ATATTTGAAGACATTGGTCTAGG - Intronic
1029821793 7:103153421-103153443 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1032782206 7:135172306-135172328 ATTGCTGGATACTTTGGTTTTGG + Intergenic
1032907501 7:136387348-136387370 ATAGCTGGTGAATTTCATCTAGG - Intergenic
1032979699 7:137267826-137267848 ATTGCTTGATACTTTGGTTTTGG - Intronic
1036372402 8:8172633-8172655 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1036493609 8:9250050-9250072 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1036878501 8:12493008-12493030 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1037018963 8:13944451-13944473 CTACCTGCAGACATTGGTCTTGG - Intergenic
1038089392 8:24236333-24236355 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1038798514 8:30729455-30729477 ATTGCTTGACACTTTGGTTTTGG + Intergenic
1041515251 8:58692250-58692272 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1041600559 8:59712311-59712333 AGAGTTGCAGGCTTTGGTCTAGG + Intergenic
1043005788 8:74816628-74816650 AGAGCTGGAGACATTGTACTGGG - Intronic
1043114362 8:76231405-76231427 TTAGCTGGAGATTTTGGAGTTGG - Intergenic
1043209548 8:77493930-77493952 ACAGCTGGAAACTTTGTACTGGG + Intergenic
1049861816 8:144903797-144903819 GAAGCTGGAGCCTTTAGTCTTGG - Intergenic
1051012430 9:12433999-12434021 ATAGCTGTAAACTTTCCTCTTGG + Intergenic
1052507811 9:29377960-29377982 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1055202370 9:73682018-73682040 ATAGTTGGGTACTCTGGTCTTGG + Intergenic
1056264683 9:84885337-84885359 ATAGCTGGAGACTATGTTTCAGG - Intronic
1057449474 9:95143984-95144006 TTGGCTGGTGTCTTTGGTCTTGG - Intronic
1058918555 9:109591091-109591113 TTGGCTCGAGACTTTGGTGTTGG - Intergenic
1059755390 9:117288811-117288833 ATAGTTGGATACTGAGGTCTGGG - Intronic
1062224786 9:135443738-135443760 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1185708906 X:2286638-2286660 AGAGCTGGAGACTTCGCTTTTGG - Intronic
1186086423 X:5995472-5995494 ATAGCTGGAGACATCTGACTGGG + Intronic
1190770940 X:53513500-53513522 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1191036580 X:56031322-56031344 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1191639024 X:63410115-63410137 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1193515679 X:82459492-82459514 ATAGTTGGAAGCTTTGGTCAGGG + Intergenic
1193576616 X:83206416-83206438 ATAGATGGAGAATTTGGACTAGG + Intergenic
1194399935 X:93430540-93430562 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1194906398 X:99581837-99581859 ATACATGGGGACATTGGTCTGGG - Intergenic
1195073082 X:101300120-101300142 ATACTTGAAGACATTGGTCTGGG - Intergenic
1196460365 X:115923381-115923403 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1198969501 X:142266004-142266026 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1199135975 X:144253500-144253522 TTGGTTGGAGATTTTGGTCTAGG + Intergenic
1199347717 X:146761299-146761321 AGGCCTGCAGACTTTGGTCTTGG + Intergenic
1200394661 X:155976809-155976831 ATTGCTTGATACTTTGGTTTTGG - Intergenic
1200942862 Y:8803835-8803857 ATTGCTTGAGACTTTGGTTTTGG + Intergenic
1200969953 Y:9141200-9141222 ATAGCCTAAGACCTTGGTCTGGG - Intergenic
1201308029 Y:12567856-12567878 ATTGCTTGATACTTTGGTTTTGG + Intergenic
1201773969 Y:17644645-17644667 GTATCTGGAGACTTTTGCCTTGG + Intergenic
1201827588 Y:18261344-18261366 GTATCTGGAGACTTTTGCCTTGG - Intergenic
1202141049 Y:21723046-21723068 ATAGCCTAAGACCTTGGTCTGGG + Intergenic
1202145816 Y:21780752-21780774 ATAGCCTAAGACCTTGGTCTGGG - Intergenic