ID: 921640570

View in Genome Browser
Species Human (GRCh38)
Location 1:217547821-217547843
Sequence GTCAGAGGAGGTCTGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921640562_921640570 10 Left 921640562 1:217547788-217547810 CCCAAATCTCATCTCGAATTGTA 0: 403
1: 8457
2: 12329
3: 9573
4: 6505
Right 921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 204
921640561_921640570 13 Left 921640561 1:217547785-217547807 CCACCCAAATCTCATCTCGAATT 0: 391
1: 9076
2: 12924
3: 9942
4: 7736
Right 921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 204
921640563_921640570 9 Left 921640563 1:217547789-217547811 CCAAATCTCATCTCGAATTGTAA 0: 355
1: 3839
2: 11950
3: 12661
4: 10322
Right 921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 204
921640560_921640570 14 Left 921640560 1:217547784-217547806 CCCACCCAAATCTCATCTCGAAT 0: 406
1: 9051
2: 12505
3: 10716
4: 7104
Right 921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 204
921640559_921640570 15 Left 921640559 1:217547783-217547805 CCCCACCCAAATCTCATCTCGAA 0: 394
1: 8997
2: 12762
3: 9726
4: 6542
Right 921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG 0: 1
1: 0
2: 1
3: 9
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921640570 Original CRISPR GTCAGAGGAGGTCTGGCGGC GGG Intronic
900091879 1:924254-924276 GTCCGGGGAGGCCTGGCGGGCGG + Intergenic
900226451 1:1535517-1535539 GACAGGGGCGGTCAGGCGGCTGG + Intronic
902251170 1:15154843-15154865 AGCAGGGGAGGTCTGGCTGCTGG + Intronic
906577393 1:46903116-46903138 GTCAGAGGAGGCCTGTCTGGAGG + Intergenic
907386793 1:54130974-54130996 GTCAGGGTAGGTGTGCCGGCGGG - Intergenic
907815188 1:57911627-57911649 GTCTGAGGAGTACTGGTGGCTGG - Intronic
909711548 1:78655773-78655795 GTAAGAGGAAGTCTGAAGGCAGG + Intronic
911163964 1:94708937-94708959 GTCACAGGAAGTCTGGAGGGAGG + Intergenic
912441849 1:109705033-109705055 GTCAGAGGAGGCCCGTCTGCAGG + Intronic
912494007 1:110079736-110079758 GTGAGAGGAGGCCAGGCTGCTGG + Intergenic
915949285 1:160177435-160177457 GCCAGGGGAGGGCTGGGGGCTGG - Intronic
917674456 1:177305627-177305649 GTTAGAGGAGGGGTGGCAGCGGG + Intergenic
919925066 1:202187900-202187922 GCCAGAGGAGCTCTGGGAGCTGG + Intergenic
920202710 1:204269560-204269582 GGCAGGGGAGGTCGGGGGGCTGG - Intronic
920259381 1:204678624-204678646 GTCAGAGGCGGCGTGGAGGCTGG - Intronic
921147998 1:212377738-212377760 GTCAATGCAGGTCTGGCAGCAGG + Intronic
921640570 1:217547821-217547843 GTCAGAGGAGGTCTGGCGGCGGG + Intronic
923706799 1:236350792-236350814 GGCAGGGGAGGGCTGGAGGCAGG - Intronic
924195474 1:241602740-241602762 GTCAGAGGAGGTCATGAGGATGG - Intronic
1066480598 10:35792072-35792094 GCCAGAGGAGCTCTGGAGGGCGG + Intergenic
1066789235 10:39044663-39044685 GTCAGAGGAGGTCTGTCTGCAGG + Intergenic
1067079477 10:43205051-43205073 GGCAGTGGAGGTCTGGCAGGTGG + Intronic
1067122101 10:43482018-43482040 GTGAGAGGAGGTCTGGTGAGAGG + Exonic
1069752359 10:70752620-70752642 GGCTGAGGAGGTCTTGAGGCCGG - Intronic
1071416215 10:85444409-85444431 GTCAAAGGAAATCTGGGGGCAGG - Intergenic
1073392676 10:103192732-103192754 GACCGAGGAGCTCTGGGGGCGGG + Intronic
1077134609 11:992187-992209 GTCAGAGGAGTGCTGCCGCCAGG + Intronic
1077446441 11:2593211-2593233 GTCAGAGTAGGGCTGGCCGGAGG + Intronic
1077483447 11:2827317-2827339 GAGAGAGGAGGTCTGGGGCCAGG - Intronic
1078663604 11:13306563-13306585 CACAGAGGAAGTCTGGCTGCTGG + Intronic
1078663614 11:13306613-13306635 GGCAGAGGAATTCTGGCTGCTGG + Intronic
1079238507 11:18706310-18706332 GTCGGGGGAGGCCTGGGGGCGGG - Intronic
1080815471 11:35752329-35752351 GTCGGGGGAGGTCTGGCAGGAGG - Intronic
1082705727 11:56492184-56492206 GTCAGGGCAGGTGTGGTGGCAGG + Intergenic
1082884372 11:58067586-58067608 GTAAGAGGAGGGCTGGTGCCAGG + Intronic
1083295194 11:61711503-61711525 GTCAGAGGAAGGCTGGGGGCAGG + Intronic
1083737315 11:64688826-64688848 CCCAGAGGAGGTCTGGGAGCTGG - Intronic
1084428984 11:69100998-69101020 CTCAGAGGAGGCCTGCTGGCTGG + Intergenic
1084611212 11:70204015-70204037 GTCAGAGAAGGTGTGGGGGAGGG + Intronic
1084677409 11:70643939-70643961 GGCAGAGGAGATCTGGGGTCGGG + Intronic
1085204737 11:74724565-74724587 GTAGGAGGAGGCCTGGGGGCTGG - Intronic
1089497443 11:118914764-118914786 CCCAGAGGAGGTCTGGTGCCTGG + Intronic
1089638810 11:119833450-119833472 GACAGAGGAGGTCTGGGGAGAGG + Intergenic
1090178682 11:124674140-124674162 GGCAGAGGAGGGCGGGCGGAGGG - Exonic
1090223836 11:125056481-125056503 GTCAGAGGCGGGGTGGGGGCTGG + Intergenic
1090947893 11:131448048-131448070 GACAGATGTGGTCTGGCAGCAGG - Intronic
1091316208 11:134615746-134615768 GGAAGAGGAGGTCTTGAGGCTGG - Intergenic
1091623207 12:2105531-2105553 GTCAGATGCGGCATGGCGGCGGG + Intronic
1095192439 12:39272878-39272900 GTCAGAAGAGATTTGGCTGCTGG - Intergenic
1096816787 12:54206753-54206775 GACTCAGTAGGTCTGGCGGCAGG - Intergenic
1104497002 12:129250182-129250204 GCCAGAGGAGGTGTGAGGGCAGG - Intronic
1106036982 13:26051991-26052013 GTCGGAGCTGGTCTGGCGCCGGG - Intergenic
1113616559 13:111684763-111684785 GTCTGGGGAGCTCTGGCGGTGGG + Intergenic
1113622089 13:111770034-111770056 GTCTGGGGAGCTCTGGCGGTGGG + Intergenic
1115163093 14:30417686-30417708 TTCAGAGGAGGCCAGGCAGCAGG - Intergenic
1118003273 14:61543254-61543276 TACAGAGGAGGTGTGGCTGCAGG - Intronic
1121719762 14:96101011-96101033 ATCAGAGGAGGTCTGAGGACCGG - Intergenic
1121942226 14:98082170-98082192 GTCAGAGAAGGGCTGACTGCTGG - Intergenic
1122296593 14:100709417-100709439 GCCAGGGGAGGCCTGGGGGCCGG - Intergenic
1124696883 15:31870770-31870792 GTCAGAGGAGGGCGCGCGCCCGG - Intronic
1125756833 15:42070413-42070435 CTCAGGGGAGGTCTGGGGGATGG + Intronic
1127921336 15:63496763-63496785 CTCAGAAGAGGTCAGGCTGCTGG + Intergenic
1129029028 15:72605295-72605317 GTCAGAGGAAGTCTGCAGGTGGG - Intergenic
1129672402 15:77614532-77614554 GCCAGAGGATGGCGGGCGGCGGG + Exonic
1129777012 15:78243562-78243584 GACAGAGGAGGTGTGGCAGGGGG + Intronic
1130059220 15:80557647-80557669 ATGAGAGGAGGACTGGGGGCTGG - Intronic
1130407146 15:83612323-83612345 GTCACAGGAGGCCTGGGGCCTGG + Intronic
1130997822 15:88913456-88913478 GCCAGAGGCGGACTGGGGGCGGG + Intergenic
1131516405 15:93080503-93080525 ATCAGAGGTGGCCTGGCAGCTGG - Intronic
1131596515 15:93803565-93803587 GTCAGATCAGATCTGGCTGCCGG + Intergenic
1132518241 16:375905-375927 GTCAGAGGTGGGGTGGAGGCAGG - Intronic
1132889761 16:2197682-2197704 GACAGAGGAGGTCAGACAGCAGG + Intergenic
1134034442 16:11018859-11018881 GTCAGAGGTGGACTGGGGCCAGG + Intronic
1136234490 16:28905489-28905511 CTGAGAGGAGGTCTGGGAGCTGG + Exonic
1136547510 16:30964101-30964123 GTCAGAGGAAGAGCGGCGGCGGG - Exonic
1140846434 16:78893056-78893078 GTCAGAGGAGCACTGGAGTCAGG + Intronic
1141377521 16:83545646-83545668 GGCAGAGGAGGTCTGGTAGATGG - Intronic
1143022935 17:3926042-3926064 GTCAGGGGAGGCGTGGGGGCTGG - Intronic
1143447944 17:7019834-7019856 GACAGAGCAGGGCTGGCGGGAGG - Intergenic
1143659331 17:8315100-8315122 GTCAGAGGAGCTGTGGGGGGTGG + Exonic
1146298816 17:31672334-31672356 GGCAGAGGAGGGCTGGCACCGGG - Intergenic
1148149088 17:45385469-45385491 GGAAGAGGAGGTCTGGGGTCAGG - Intergenic
1148799445 17:50214004-50214026 GTGAGGGGAGGTCTGGGAGCAGG + Intergenic
1148861707 17:50607958-50607980 GGAAGAGGAGGCCCGGCGGCGGG + Exonic
1149572657 17:57684711-57684733 TGCAGAGGAGGTCTGGGGTCTGG + Intergenic
1152186108 17:78857282-78857304 GACAGGGGATGTCTGGAGGCCGG - Intronic
1152474409 17:80508720-80508742 GTCTGAGGATGTCTCGGGGCAGG - Intergenic
1152521447 17:80859014-80859036 GGCAGAGGAGGTCGGGCTGCAGG + Intronic
1153278179 18:3389614-3389636 ATCAGAGGAGGTCTGTGGGGAGG + Intergenic
1155085656 18:22455187-22455209 CTCAGAGGAGGGCTGGAGACAGG + Intergenic
1158325309 18:56307571-56307593 GTCAGGGGAGGTCTTGCTGATGG - Intergenic
1158405665 18:57157201-57157223 GTGATAGGAGATCTGGCTGCAGG + Intergenic
1159870214 18:73752820-73752842 GTCAAGGGAGCTCAGGCGGCAGG + Intergenic
1160223125 18:76991710-76991732 GTCAGAGGAGCTCTGGCCCCAGG + Intronic
1161224327 19:3136169-3136191 GTCTGAGCAGGTCTGGAGGTGGG + Intergenic
1161978241 19:7617841-7617863 GACAGAGGAGCTGTCGCGGCTGG + Exonic
1162158788 19:8697148-8697170 GTCAGAGGTGGTCTGGGGAGGGG + Intergenic
1162326302 19:10001870-10001892 GTCAGTGGAGGTCTGGAGCAGGG + Exonic
1162555087 19:11381649-11381671 GTCAGTGGAGCTTTGGGGGCTGG + Intronic
1163313612 19:16528276-16528298 GTTAGAGCAGGCCTGGCAGCAGG + Intronic
1163591546 19:18196885-18196907 GTCAGAACAGGTCTGGTGGGCGG + Exonic
1163942397 19:20507304-20507326 GTCAGAGGAGGCCCGTCTGCAGG - Intergenic
1164378502 19:27710873-27710895 GTCAGAGGAGGCCTGTTTGCAGG - Intergenic
1164866994 19:31612693-31612715 GTCTGAGGAGGGCTGGAGCCGGG - Intergenic
1166318699 19:42003319-42003341 GTCCGAGGAGGTGAGGAGGCTGG - Exonic
1167358068 19:49016137-49016159 GTCAGAGGTGCTGCGGCGGCAGG + Exonic
1168050157 19:53823958-53823980 GCCAGAGGAGGCCTGGAGGTTGG - Exonic
925302350 2:2826339-2826361 GTGAGGGGAGGCCTGGGGGCTGG - Intergenic
925388116 2:3477105-3477127 GGCAGAGGAGGCCTGGGGGGTGG - Intronic
925920836 2:8636758-8636780 GGCAGAGGAGTTCTGGGGCCTGG - Intergenic
928025930 2:27738485-27738507 GTCAGACCAGAGCTGGCGGCCGG - Intergenic
929961166 2:46497477-46497499 CTCAGAGCAGGGCTGGGGGCAGG + Intronic
931828290 2:66024460-66024482 GTCAGAGAAGGGCTGTCTGCAGG - Intergenic
932771490 2:74503089-74503111 GTCAAAGGAGAGGTGGCGGCAGG - Intronic
933014922 2:77113203-77113225 GTCAGAGGAGGCCCGTCTGCAGG - Intronic
934561875 2:95317743-95317765 GGCAGAGGAGGTCAGGGAGCAGG + Intronic
934888120 2:98042272-98042294 GTCAGAGAAGGTCTAGTGGAAGG + Intergenic
934970831 2:98762815-98762837 GGCAGAGGATGTATGGAGGCAGG - Intergenic
935353676 2:102178052-102178074 GACAGAGGAGTGCTGGGGGCAGG - Exonic
936079665 2:109423682-109423704 GTCAAAGGAGGCTGGGCGGCTGG - Intronic
937099067 2:119254713-119254735 GGAGGAGGAGGTCTGGCGGATGG + Exonic
937110416 2:119362970-119362992 GTGAGAGGAGGCCTGGCAGCTGG - Intronic
937987076 2:127642750-127642772 GGCAGAGGTGGGCTGGGGGCTGG - Intronic
944271074 2:197785796-197785818 GCCAGACGAGGTCTGCGGGCGGG + Intronic
946811012 2:223525887-223525909 GTCAGAGAAGGTCAGGTGGATGG - Intergenic
948215453 2:236226075-236226097 CTCTGAGGAGGTCTGGCTTCAGG - Intronic
1169142240 20:3233221-3233243 GTCAAAGAAGGGCTGGCGGGCGG + Intronic
1169584659 20:7067679-7067701 GTGAGAGGAGTTCTGGGGGAGGG - Intergenic
1171219497 20:23382102-23382124 GTCAGAAGAGGTCTAGTGGAGGG + Intronic
1173171131 20:40724738-40724760 GCCAGAGGAGACCTGGAGGCTGG - Intergenic
1173404769 20:42754950-42754972 GTGAGAGGAGGGCTGTCTGCTGG - Intronic
1178108456 21:29347620-29347642 GTGAGAGGAGGTCTGCCCTCTGG - Intronic
1178508595 21:33183253-33183275 ATCAGAGGTGGTCTGGCTACAGG + Intergenic
1179543571 21:42100090-42100112 GTCAGATGAGGCCTGGCTGGTGG + Intronic
1179578072 21:42320115-42320137 GGTAGAGCAGGTCTGGCTGCTGG - Intergenic
1179804153 21:43826480-43826502 GTCAGAGCAGACCTGGCGCCGGG - Intergenic
1180083743 21:45498220-45498242 GTTTGAGGATGTCTGGGGGCTGG + Intronic
1180991142 22:19937148-19937170 GTCAGAGGAGGCCCGCCTGCAGG + Intronic
1182321769 22:29482395-29482417 GGCAGTGGAGGTCTGGAGACTGG - Intronic
1182428613 22:30287661-30287683 GTAAGGGCAGGTCTGGAGGCTGG + Intronic
1182572483 22:31249399-31249421 GACTGAGGAGGTGTGGGGGCTGG - Intronic
1183026057 22:35066656-35066678 TCCAGAGGAGGTTTGGAGGCAGG - Exonic
1183527759 22:38334218-38334240 TTCAGAGGGGGTCTGGGTGCTGG - Intronic
1183599994 22:38834446-38834468 GGCAGAGGAGGGGTGGGGGCGGG - Intronic
1183675518 22:39297032-39297054 GTCAGAGGAGGTGCCCCGGCAGG + Intergenic
1184039131 22:41933062-41933084 GTCAGAGAAGGCCTGGTGGATGG + Intergenic
1184296726 22:43529769-43529791 GTCAGAGCTGGTGTGGTGGCTGG - Intronic
1184598288 22:45527372-45527394 GTTAGAGGGGTTCTGGCAGCAGG - Intronic
1184843482 22:47066400-47066422 GTCAGGGGAGGTCGGGAGGGAGG + Intronic
949336279 3:2978789-2978811 GTCACAGGAGGCCTGGCTCCAGG - Intronic
950132763 3:10558594-10558616 GTCATAGGAGGTCAGGCTTCAGG - Intronic
950892567 3:16417294-16417316 GACAGAGAAGTTCTGGAGGCCGG - Intronic
952128527 3:30332390-30332412 GTCAGAGCGGGTCTGGGTGCAGG + Intergenic
954103407 3:48395775-48395797 GTCAGATGAGGTCTGTGGGGAGG - Intronic
959674705 3:109021183-109021205 ATCAGAGGCTGTCTGGCGTCTGG - Intronic
961739849 3:129026458-129026480 GGCAGAGGAGGTATGTCAGCAGG - Intronic
962776468 3:138665660-138665682 GTGAGAGGATGGCTGGAGGCTGG - Intronic
962942885 3:140141699-140141721 GTCTGAGGAGGGCTAGAGGCTGG - Intronic
968382664 4:109101-109123 GTGAGAGGAGGTGCGGTGGCAGG - Intergenic
969444446 4:7236241-7236263 GCCAGAGGAGGTCTCACTGCAGG + Intronic
969627771 4:8316483-8316505 GTCACAGGAGGCCTGGTTGCAGG - Intergenic
971376172 4:26057439-26057461 TTCAGATGAGGTCTGGCTTCTGG - Intergenic
972848583 4:43020126-43020148 GTAAGAGGAGGGCTGCCAGCAGG - Intronic
973230749 4:47837148-47837170 GGCACAGGAGGGCTGGCCGCCGG - Intronic
974998589 4:69193735-69193757 GTCAGAGGAGGCCTGTCTACAGG + Intronic
982165444 4:152609614-152609636 GTCAAAGCAGGTCCTGCGGCTGG + Intergenic
983013092 4:162574390-162574412 GGCAGAGAAGGTCTGCTGGCTGG + Intergenic
984866418 4:184284199-184284221 GTCAGAGGGGACCTGGTGGCGGG - Intergenic
985537255 5:472448-472470 GTGAGAGGTGGCCTGGCGGGCGG - Intronic
989624047 5:43412550-43412572 GTCAATGGAGATCTGGCAGCTGG + Intergenic
999331175 5:150674370-150674392 CTCAGAAGAGGTCTGGATGCAGG - Intronic
1001928475 5:175656746-175656768 GTCACAGGAGGTCTGGAAGCAGG + Intergenic
1002186148 5:177455684-177455706 GTCGGAGGAGGTGAGGCCGCCGG - Intronic
1002340191 5:178511354-178511376 GTCAAAGGAGGTCTCCAGGCTGG + Intronic
1002360845 5:178669607-178669629 GTCAGAGAAGGTCTGTGGGAAGG + Intergenic
1005317270 6:24615660-24615682 TTCAGAGTAGGTCTTGGGGCTGG - Intronic
1005938785 6:30545659-30545681 GAATGAGCAGGTCTGGCGGCAGG + Exonic
1006434343 6:34018504-34018526 GTAGGAGGAGGTCTGGCTGAAGG + Intergenic
1006449067 6:34095625-34095647 GCCAGAGGAGGTTTAGCGGGAGG - Intronic
1006763783 6:36486907-36486929 TTAAGAGAAGGCCTGGCGGCCGG + Exonic
1007813794 6:44505829-44505851 GTCACAGCAGGTCTGGAGGCAGG + Intergenic
1008445612 6:51586658-51586680 GTCAGAGGAGGGCTGGTGGGAGG - Intergenic
1010492723 6:76494250-76494272 GTCAGAGGAGGCCTGTCTGCAGG - Intergenic
1014154203 6:118092543-118092565 GTCAGTGGAGGTCTGGAGGATGG - Intronic
1018627719 6:165795897-165795919 GTCTGAGGAGGTATGGAGGGTGG - Intronic
1019571447 7:1714388-1714410 GTCAGAGGTGGTGTGGGGGGTGG - Intronic
1026900175 7:74032674-74032696 GACAGAGGAGATCTGGGGGAGGG + Intronic
1026965000 7:74433965-74433987 GACAGGGTAGGTCTGGGGGCAGG - Intergenic
1028641182 7:93043660-93043682 GGCAGAGCAGGTCCGGCGCCAGG + Intergenic
1033267542 7:139898950-139898972 GTCAGAGGCAGAGTGGCGGCTGG - Intronic
1033619331 7:143048417-143048439 GGCAGAGCAGGGCTGGAGGCAGG - Intergenic
1035262533 7:157671117-157671139 GTAAGAGCAGGTCTGTGGGCAGG - Intronic
1036698065 8:10992061-10992083 GACTGTGGAGGCCTGGCGGCAGG - Intronic
1037763214 8:21755997-21756019 GTCAGAGGCTGGCTGGCTGCTGG + Intronic
1038684919 8:29707794-29707816 GTCAGAGGAGGCCTGGACGAGGG - Intergenic
1039824105 8:41158225-41158247 GGCACAAGAGGTCTGGAGGCAGG + Intergenic
1040352502 8:46583089-46583111 GTCAGAGCAGGCCTGTCTGCAGG + Intergenic
1042527344 8:69777390-69777412 GACTGAGGAGGTCAGGCGGAAGG + Intronic
1044206300 8:89494944-89494966 TTCAGAGGAGGTCAGGCACCTGG - Intergenic
1045396733 8:101768296-101768318 CTCACAGGAAGTCTGGCTGCAGG + Intronic
1049210983 8:141386288-141386310 CTCAGAGCAGGCCTGGCAGCTGG - Intergenic
1049460391 8:142724627-142724649 AGCAGAGGAGGTCTGGAGGGTGG + Intergenic
1049463657 8:142741412-142741434 GTCAGAGGAGGGCTGGGCCCTGG - Intronic
1057410244 9:94811465-94811487 GACGGAAGAGGTCTGGGGGCAGG - Intronic
1058830680 9:108813483-108813505 GGCAGAGGAGGAGTGGAGGCAGG + Intergenic
1060661460 9:125407667-125407689 TTCAGAGGAGAGCTGGGGGCTGG + Intergenic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062130329 9:134889059-134889081 CTGAGAGGAGGTCTGACGCCAGG - Intergenic
1186156376 X:6730639-6730661 TTCAGAGAAGGTCTGGCTGAGGG + Intergenic
1187674567 X:21702822-21702844 GTTAGAGGAGGTGTGCCGACAGG - Intergenic
1191776912 X:64824255-64824277 GTCAGAGGAGGCCTAGTGGAGGG + Intergenic
1195750671 X:108159773-108159795 GGCAGGGGAGGTCTGGCTGAGGG + Intronic
1198337821 X:135684628-135684650 GTCAGGGGAGGCCTGGGGGTAGG + Intergenic
1200093675 X:153647472-153647494 CTCAGAGGTGGTCTGGCCCCCGG - Intronic
1200377956 X:155804062-155804084 GTCAGATGGTGTCTGGGGGCTGG + Intergenic