ID: 921642228

View in Genome Browser
Species Human (GRCh38)
Location 1:217569164-217569186
Sequence TCCCATTTCGTCATCTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921642228_921642230 -6 Left 921642228 1:217569164-217569186 CCAGTACAGATGACGAAATGGGA 0: 1
1: 0
2: 0
3: 10
4: 77
Right 921642230 1:217569181-217569203 ATGGGAGTAGACAGATATTTGGG 0: 1
1: 0
2: 1
3: 11
4: 229
921642228_921642229 -7 Left 921642228 1:217569164-217569186 CCAGTACAGATGACGAAATGGGA 0: 1
1: 0
2: 0
3: 10
4: 77
Right 921642229 1:217569180-217569202 AATGGGAGTAGACAGATATTTGG 0: 1
1: 0
2: 1
3: 18
4: 178
921642228_921642231 -5 Left 921642228 1:217569164-217569186 CCAGTACAGATGACGAAATGGGA 0: 1
1: 0
2: 0
3: 10
4: 77
Right 921642231 1:217569182-217569204 TGGGAGTAGACAGATATTTGGGG 0: 1
1: 0
2: 2
3: 25
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921642228 Original CRISPR TCCCATTTCGTCATCTGTAC TGG (reversed) Intronic
902809764 1:18881517-18881539 TTCCATTTCTTCACCTGTACAGG - Intronic
905918788 1:41705120-41705142 ACCCATTTTGTCCTCTGTAAAGG - Intronic
906799705 1:48725725-48725747 GCCCATTTCTTCATTTGTATGGG + Intronic
909332047 1:74425210-74425232 GCTCATTTCCTCATCTTTACTGG + Intronic
909551429 1:76901673-76901695 TTCCATTTGGTCCTCTGAACTGG + Intronic
915724709 1:158009037-158009059 TCTCAATTCATCATCTGGACGGG - Intronic
918225167 1:182474604-182474626 TCCCATCTGGTCACCTATACTGG + Intronic
918315350 1:183318333-183318355 CCCCATTTCCTCATCTGGCCTGG - Intronic
919673671 1:200360694-200360716 GCCCATTTCTTCATCTGCAGAGG + Intergenic
919791374 1:201292874-201292896 TCCCATTCCCTCAGCTATACTGG - Intronic
919968144 1:202549927-202549949 TCCCATTTAGCCATCTGGAAAGG + Intronic
920061703 1:203231274-203231296 TCCAGTTTCTTCATCTGTAAAGG + Intronic
920869448 1:209781896-209781918 TCCCATTTTGTCACCTGTCTTGG - Exonic
921642228 1:217569164-217569186 TCCCATTTCGTCATCTGTACTGG - Intronic
1063226802 10:4023031-4023053 TCTCGTTTTGTCATCTGGACTGG - Intergenic
1063535051 10:6875397-6875419 TCCCACTTCCTCATCTGCCCTGG + Intergenic
1074526971 10:114271105-114271127 TCCCATTTCTTCAACTAGACTGG + Intronic
1074611173 10:115023529-115023551 TCCCATTTAGCTATGTGTACGGG - Intergenic
1081568252 11:44273648-44273670 TCCTATTTTGTCTTCTTTACAGG - Intronic
1090335747 11:125962786-125962808 TTCCATTTGGTCTTTTGTACCGG + Intronic
1097289101 12:57898886-57898908 TTCCATTTCTTCAGCTGTAGGGG - Intergenic
1106588631 13:31078994-31079016 CCCCATTTCCTCATCTGTAATGG + Intergenic
1116800830 14:49441452-49441474 TCCCATTTCCTCCTCTGTTTGGG - Intergenic
1127375590 15:58381779-58381801 TCTCATTTCCTCAACTGTAATGG + Intronic
1131927963 15:97406926-97406948 AGCCATTTAGTCATCTGAACGGG + Intergenic
1143436115 17:6927441-6927463 TCCCATTTCATCATCTTTTTTGG - Intronic
1143883530 17:10049013-10049035 GCCCATTGCTTCATCTGCACTGG - Intronic
1144701263 17:17342308-17342330 CTCCATTTCTTCATCTGTACGGG + Intronic
1149608263 17:57940083-57940105 GCCTCTTTCCTCATCTGTACAGG - Intronic
1149746788 17:59106638-59106660 CCCCATTTCGCCATTTTTACCGG + Exonic
1151049723 17:70963705-70963727 TGCCATTTCTTCATTTGTGCAGG + Intergenic
1153629648 18:7057220-7057242 CCCAATTTCCTCATCTGTAATGG - Intronic
1153687566 18:7561824-7561846 TCCCTTTTTGTCATTTGTTCAGG + Intergenic
1153911990 18:9712466-9712488 TCCCACTTTGTGATCTGAACTGG + Intronic
1156863563 18:41865417-41865439 TTCAATTTCCTCATCTGTAAAGG + Intergenic
1160082774 18:75745174-75745196 TCCCCTTTCTGCCTCTGTACAGG + Intergenic
1161924036 19:7288035-7288057 TCCGACTTCTTCATCTGAACAGG - Intronic
1167197450 19:48040313-48040335 TTCCATTTCCTCATCTATAGAGG - Intronic
928024079 2:27725587-27725609 TTCCATTCCTTCATCAGTACTGG - Intergenic
930259643 2:49130320-49130342 TCCCATTTTGCTATCTGTCCTGG + Intronic
932863640 2:75319313-75319335 TCCCATTTCCTCATCATTCCTGG - Intergenic
934323502 2:91986187-91986209 TGCCATCCCGTCATCTGTCCTGG + Intergenic
934860041 2:97757192-97757214 TCCCAAGTCGTCAGCTGGACTGG + Exonic
935550228 2:104445016-104445038 TTCCCTTTCCTCATCTGTAAAGG - Intergenic
935841583 2:107117533-107117555 TCCCATAACATCATTTGTACAGG - Intergenic
947573560 2:231254401-231254423 TCCTTTTTCGTTATCAGTACTGG - Intronic
1168912386 20:1459417-1459439 TCACATTTCCACAGCTGTACAGG - Intronic
1169656097 20:7924884-7924906 ACGCATTTTGTCATCTGCACAGG + Intronic
1169888064 20:10423390-10423412 TCGCATTTCATCACCTGTCCTGG - Intronic
1179245345 21:39628700-39628722 TCCCATTAGGTCCCCTGTACAGG - Intronic
1182219819 22:28749273-28749295 TTCCAGTTCCTCATCTATACTGG + Intronic
1183621445 22:38975226-38975248 GTCCATTTCCTCATCTGAACAGG - Intronic
949757046 3:7424115-7424137 TCCCATCCCCTCATCTGTAAAGG + Intronic
950796884 3:15517360-15517382 TGCCATTTCCTCATCTGAAAGGG + Intronic
951513930 3:23536641-23536663 TACCTTTTAGACATCTGTACTGG + Intronic
958582883 3:96049688-96049710 TCTCACTTCATCATCTGTGCTGG - Intergenic
959719583 3:109471474-109471496 TCCCAGTTTTTCATCTGCACTGG - Intergenic
963238761 3:142982246-142982268 TCCGATTTCTTCATCTGTAAGGG - Intronic
967860385 3:194147057-194147079 TCACATTTACACATCTGTACTGG + Intergenic
972944019 4:44230932-44230954 GCCCATCTGGTCATCTGTGCTGG + Intronic
975116960 4:70690687-70690709 TCCCATTTCCCCTTCTTTACTGG + Intergenic
981074216 4:140575562-140575584 AGCCATGTCCTCATCTGTACAGG - Intergenic
982181639 4:152753078-152753100 TCCAATTGAGTCATCTGCACAGG - Intronic
986101029 5:4611878-4611900 TCCAATTTCTTCATCTTCACAGG - Intergenic
986576493 5:9218793-9218815 TCCTCTTTCCTCATCTTTACTGG - Intronic
990338859 5:54802492-54802514 TCCCATATCCTCATCTGTCCTGG + Intergenic
995105027 5:108367369-108367391 TTCCATTTCTTCATCTGTAAAGG + Intronic
1021627809 7:22611876-22611898 TCCCAGTTCCTCAAATGTACAGG + Intronic
1023581185 7:41684825-41684847 TCCCATTTCTTCAAGTGTAGTGG - Intergenic
1030491019 7:110234529-110234551 TCCCAGTTGTTCATCTGTACAGG + Intergenic
1033194039 7:139311503-139311525 GCCCATTTCCTCATCTGCACAGG + Intergenic
1033682575 7:143609495-143609517 TCCCATTTCTTCTTCTTTCCTGG - Intergenic
1033702318 7:143852422-143852444 TCCCATTTCTTCTTCTTTCCTGG + Exonic
1036616311 8:10390345-10390367 TCCAGTTTGGTCATCTGTCCTGG - Intronic
1042801246 8:72720311-72720333 TTCCATTTCCTCATCTGTTCTGG + Intronic
1047206914 8:122809803-122809825 TGCCATTTCTTCATCTGTAAAGG + Intronic
1049092737 8:140528996-140529018 TCCCAATTCGATTTCTGTACTGG - Intergenic
1050662486 9:7898261-7898283 TTCTATTTCTTCATCTGTAAAGG - Intergenic
1051112187 9:13651553-13651575 TCCCATTTAGCCATCTTTCCTGG + Intergenic
1051672012 9:19520411-19520433 TACCATTTGTTTATCTGTACTGG - Intronic
1053331306 9:37210573-37210595 TCCCATTTTGACATCTGCAATGG + Intronic
1057717068 9:97503135-97503157 TGCCATTTTGTCCTCTGTGCAGG + Intronic
1059044345 9:110849492-110849514 TCCCATGTCTTCATCAATACTGG - Intergenic
1186357780 X:8805130-8805152 TGTCATTTCGTCATCTGAAATGG + Intergenic
1195710222 X:107767413-107767435 TCCCATTCAGTCTTCTGTGCTGG + Intronic
1195936589 X:110131409-110131431 TCCCAGTTCTTCATCCGCACAGG - Intronic
1196502779 X:116404755-116404777 TTCAATTTCTTCATCTGTATTGG + Intergenic
1198601996 X:138294222-138294244 TTCCATTTCCTCTTCTGTAAAGG + Intergenic