ID: 921646124

View in Genome Browser
Species Human (GRCh38)
Location 1:217620293-217620315
Sequence AAGCAGTGACCAGTCTCCCA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921646122_921646124 18 Left 921646122 1:217620252-217620274 CCTTGCTTGGTTCTTCTAAACTA 0: 1
1: 0
2: 1
3: 10
4: 154
Right 921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG 0: 1
1: 0
2: 3
3: 14
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921646124 Original CRISPR AAGCAGTGACCAGTCTCCCA CGG Exonic
902153128 1:14461075-14461097 AAGCAGTGACAAATTTCACAAGG - Intergenic
904359907 1:29964444-29964466 AAGCAGTTTCCAGGCTGCCATGG - Intergenic
904593618 1:31629067-31629089 AAGCAGAGGCCAGACTCACATGG + Intronic
904869427 1:33607460-33607482 AAGCTCTGACCACTCTCCCCAGG - Intronic
909021617 1:70437633-70437655 AAGGAATTACGAGTCTCCCAGGG + Intronic
909741654 1:79037043-79037065 ATGCAGGGAGCAGTGTCCCAAGG - Intergenic
910573943 1:88737391-88737413 ACTCAGTGACAAGTCTGCCATGG - Intronic
910720808 1:90284492-90284514 AAGCAGGGTCCAGCCTCCTAGGG + Intergenic
911393450 1:97275307-97275329 AAGAAGTGATCACTCCCCCATGG + Intronic
912726962 1:112067296-112067318 AAGGAGACACCTGTCTCCCAGGG + Intergenic
913152879 1:116063031-116063053 AGGCAGAGAGCAGTCTGCCAAGG - Intronic
915036316 1:152928654-152928676 AAGCAGGGACCACTCCCCCAGGG - Intergenic
915805065 1:158839561-158839583 AAGCAGTTACTAGTCCCTCAAGG + Intronic
916031100 1:160878217-160878239 AAGGAGTGAGGTGTCTCCCATGG - Intronic
916915242 1:169399879-169399901 AAGCAGTCACTAGTCTCACTGGG + Intronic
919051560 1:192517772-192517794 AAGCAGGGATCAGACTCCCCCGG + Intergenic
921098914 1:211911461-211911483 AAGCAGTGACCATTGTCTCCAGG - Intergenic
921646124 1:217620293-217620315 AAGCAGTGACCAGTCTCCCACGG + Exonic
923814414 1:237359412-237359434 AAACAATGACCAGTCTCCGAAGG - Intronic
1064356792 10:14626153-14626175 CAGCAGTGACCAGCCTTCAACGG - Intronic
1064582603 10:16809463-16809485 GAGCTGTGTCCAGCCTCCCAGGG + Intronic
1066448117 10:35502541-35502563 AAGAAGTCATCAGTCTCCTAAGG - Intronic
1071200947 10:83220301-83220323 ACCCAGTGACCAGTGTCCCCAGG + Intergenic
1071224587 10:83513572-83513594 AAGCAGTGGCGAGTTTGCCAAGG + Intergenic
1071600938 10:86958440-86958462 AGGCAGAGACCAGGCTCCCTGGG - Intronic
1071990158 10:91093545-91093567 ATGCAGGGAGCAGTGTCCCAAGG + Intergenic
1072920071 10:99569432-99569454 AAGCAGTGCCTACTCTGCCAAGG + Intergenic
1073956900 10:108883036-108883058 AAAAAGAGACCTGTCTCCCAAGG - Intergenic
1074370349 10:112895587-112895609 AAGCAGTCACTAGTCTGCCCAGG + Intergenic
1074720069 10:116256627-116256649 AAGCAGTGCCCACTCACCCCAGG - Intronic
1075082756 10:119394977-119394999 AAGAAGTGCCCAGTCCCTCAAGG + Intronic
1075518808 10:123131761-123131783 TGGCTGTGACCTGTCTCCCAGGG + Intergenic
1075723496 10:124600317-124600339 AAGCAGGCACCAGTGCCCCAGGG - Intronic
1076329110 10:129652161-129652183 AGCCAGGGACCTGTCTCCCAGGG - Intronic
1077143392 11:1034648-1034670 GAGCTGTGACCGGTCTCCCCTGG + Intronic
1077736852 11:4800417-4800439 ATGCAGGGAGCAGTGTCCCAAGG + Intronic
1078420728 11:11210028-11210050 ACGCAGGGGCCAGTCTCCCATGG - Intergenic
1080745709 11:35106772-35106794 CTGCAGAGACCAGTCTCCCAGGG - Intergenic
1083265520 11:61545066-61545088 GAGCTGTGACCAGTCTCCCTTGG - Intronic
1083422291 11:62560877-62560899 AAGCAGTGAACATTCTCAAAGGG + Intronic
1083618471 11:64037460-64037482 AAGCCCTGAACAGTCGCCCACGG - Intronic
1083856264 11:65394493-65394515 AAGCAGTCTTCAGTCTCGCAAGG + Intronic
1084170436 11:67398358-67398380 TAGCAGCGTCCAGTCCCCCAGGG - Exonic
1085418368 11:76335020-76335042 ACGCAGGGAGCAGTGTCCCAAGG - Intergenic
1085976379 11:81660326-81660348 AGGCAGGGAGCAGTTTCCCAAGG + Intergenic
1086954828 11:92925300-92925322 ATGCAGGGATCAGTGTCCCAAGG - Intergenic
1087578188 11:100016856-100016878 AACCAGTGACCGGTCACACAAGG - Intronic
1087624770 11:100583982-100584004 AAGCAGTGTCCAGCATCCCTAGG - Intergenic
1092112888 12:5976458-5976480 AAGCTATGACCAGTCTCTCAGGG + Intronic
1094728953 12:33152734-33152756 AACCAGTGACTAGACTGCCAAGG - Intergenic
1095782733 12:46078179-46078201 ATGCAGGGAGCAGTGTCCCAAGG + Intergenic
1096069366 12:48766437-48766459 AAGCAGAGACAAGCCACCCAAGG + Exonic
1096719795 12:53512622-53512644 ATGGAGTGACCAGTCTGCAAGGG + Exonic
1097139262 12:56886292-56886314 ATGCAGGGAGCAGTGTCCCAAGG - Intergenic
1101604279 12:106236011-106236033 AAGGAGTGACCATTGTGCCATGG - Intergenic
1101671989 12:106884139-106884161 AAGCACTGACCAGGCTGCCTGGG - Intronic
1106012503 13:25838220-25838242 AAGGAGAGAACAGTCTCCCAGGG + Intronic
1108076016 13:46680444-46680466 AAGAAGTGGTCAGTCTCCCTGGG + Intronic
1109170935 13:59096333-59096355 AAGCAGTTACCAGACTCCAGAGG - Intergenic
1109252197 13:60032593-60032615 AAGCAGGGAGCAGTGTCTCAAGG + Intronic
1111822776 13:93233772-93233794 ACTCACTGACCAGTCTCCCCAGG - Intronic
1115145246 14:30218777-30218799 AAGCAGTGTCCTGGCTCTCATGG - Intergenic
1115732267 14:36284190-36284212 ATGTAGTGAACAGTCTTCCATGG + Intergenic
1115735917 14:36329913-36329935 AAGCATTCACCAGACTCCCAAGG + Intergenic
1118711947 14:68526869-68526891 AAGCAGTGTCCCGTGTGCCAGGG - Intronic
1119003156 14:70901358-70901380 AAGCAGTGAAAAATCTCCAAGGG + Intergenic
1119326373 14:73761946-73761968 AAGCAGAGGCCAGACTCTCAGGG + Intronic
1120887058 14:89459997-89460019 CAGCAGGGACCAGACTTCCAGGG - Intronic
1123977019 15:25563404-25563426 TAGCACTCACCAGTCTCTCAGGG + Intergenic
1124398702 15:29329874-29329896 AAGAAGGGACAAATCTCCCAAGG + Intronic
1125403377 15:39327961-39327983 AAGCAGTGACAAGTGACACAGGG + Intergenic
1126203820 15:46019775-46019797 ATGCAGGGAGCAGTGTCCCAAGG - Intergenic
1126273470 15:46848671-46848693 AAGCAGTGTCCTGCATCCCAGGG - Intergenic
1128313567 15:66646438-66646460 ACGCACTGACCACTATCCCAGGG - Intronic
1129203299 15:74019147-74019169 AAGCAGGGGCCAGTCACCCTAGG + Intronic
1131722703 15:95188082-95188104 ATGCAGGGACCAGTGTCCAAAGG - Intergenic
1132866359 16:2094491-2094513 CAGCAGTGCACAGTCTCTCAGGG + Intronic
1133986922 16:10675832-10675854 AAGCAGTACCCTCTCTCCCAAGG - Intronic
1136073199 16:27801216-27801238 AAGGAGTGGCCTCTCTCCCAGGG + Intronic
1139284631 16:65799833-65799855 AAACTGTGACCAGTATTCCAGGG - Intergenic
1141245436 16:82302628-82302650 AAGCAGTGACTGCTCTCCCACGG - Intergenic
1141317379 16:82975247-82975269 AAGCAGAGATAAGGCTCCCAAGG + Intronic
1141616248 16:85211266-85211288 AAGCTGAGACCAGTCTCTCCTGG - Intergenic
1142861482 17:2764822-2764844 AAGCAGTGACAGGGCTCCCCAGG + Intergenic
1142987478 17:3705055-3705077 AAGCAGTGACAAGTCTACCACGG + Intergenic
1143393248 17:6572859-6572881 AGGCAGAGACCAGTAACCCAGGG + Intergenic
1143455999 17:7068172-7068194 GTGCAGAGACCAGTGTCCCAAGG + Intergenic
1146460503 17:33042426-33042448 AAGTAGTACCCAGTCTCACAGGG - Intronic
1147037859 17:37695169-37695191 ATGCAGGGAGCAGTGTCCCAAGG - Intronic
1149811033 17:59671966-59671988 AAGCAGAGTCCATTCTCTCAAGG - Intronic
1151789687 17:76296950-76296972 AAGCAGTGCCCTGCCTGCCATGG + Intronic
1152614906 17:81333601-81333623 AGGCAGTGGCCAGACGCCCAGGG - Intergenic
1155219166 18:23668974-23668996 AAGCCGGGACCAGCCTTCCATGG - Intergenic
1157195779 18:45619226-45619248 AAGCTGAGCCCAGTCTCCCCAGG + Intronic
1157555790 18:48612258-48612280 TGGCAGTGAGCAGGCTCCCATGG + Intronic
1167663936 19:50812288-50812310 GAGCAGTGAGGAGTATCCCAGGG + Intergenic
925280938 2:2683885-2683907 AAGTGGTCCCCAGTCTCCCAGGG - Intergenic
925986738 2:9222520-9222542 AAGAAGTGAGCAGTCTCCTGTGG - Intronic
926140355 2:10364495-10364517 AAGCAGCGAGGAGTCTCCCCCGG - Intronic
927208377 2:20624190-20624212 AGGCAATGACCTGTCTCCCCAGG + Intronic
928743245 2:34380790-34380812 AAGCTGTGTCCATTCTCCCCTGG + Intergenic
929649999 2:43669154-43669176 AACCAGTGTCTAGTCTCTCAAGG - Intronic
930627003 2:53709201-53709223 ATGCAGGGACTAGTGTCCCAAGG - Intronic
931800949 2:65757062-65757084 ATGCAGGGACCAGTGTCCCAAGG + Intergenic
934166169 2:89296268-89296290 CAGCTGTGAAAAGTCTCCCAAGG + Intergenic
934201106 2:89886188-89886210 CAGCTGTGAAAAGTCTCCCAAGG - Intergenic
936028615 2:109053572-109053594 AGCCAGTCTCCAGTCTCCCAAGG - Intergenic
936457119 2:112683539-112683561 AAGTAGTGACTGGTATCCCAGGG - Intergenic
936694499 2:114930002-114930024 CAGCAGGGAGCAGTATCCCAGGG + Intronic
937445716 2:121956164-121956186 CAGCGGTGTCCAGTCTCCGACGG + Intergenic
938130121 2:128707923-128707945 ATGCAGTGAGCAGTGTCTCAAGG + Intergenic
939628043 2:144502540-144502562 AAGCAGAGAGCTGCCTCCCATGG + Intronic
947936034 2:234004351-234004373 AGGCAGTGACCAGGCACCCTGGG - Intronic
1171087168 20:22248283-22248305 AAGCAGTTCCCAGTTTTCCACGG - Intergenic
1171406465 20:24915247-24915269 AAGAAGTGACCAGAGACCCATGG + Intergenic
1174681254 20:52410964-52410986 AAGCAGTGATCAGTCTCGACAGG - Intergenic
1175541282 20:59749524-59749546 AGCCAGAGACCAGGCTCCCACGG - Intronic
1175616463 20:60404290-60404312 AAACAGTGACCAATCTTCCTCGG - Intergenic
1176293464 21:5058604-5058626 CAGCACTGACCAGGCCCCCAGGG - Intergenic
1178790779 21:35698019-35698041 AATCAGTGCCCTGTCCCCCAAGG - Intronic
1179863796 21:44205044-44205066 CAGCACTGACCAGGCCCCCAGGG + Intergenic
1180153413 21:45964854-45964876 ATGCAGGGAGCAGTGTCCCATGG - Intergenic
1180723934 22:17930700-17930722 AAGCTGGGAACTGTCTCCCAGGG + Intronic
1181508264 22:23376367-23376389 AAACAGTGTCCTGTCTTCCAGGG + Intergenic
1181556726 22:23675566-23675588 ACACATTGACCAGCCTCCCAGGG - Intergenic
1181912984 22:26255297-26255319 AAGCATTAACCAGGCTCCCGAGG - Intronic
1182881475 22:33737647-33737669 AAAGAGTGAAAAGTCTCCCAAGG + Intronic
1184583329 22:45431229-45431251 CAGCAGTGACCTGTGGCCCATGG - Intronic
1185414285 22:50701233-50701255 CAGCAGAGAGCAGTCTCCCACGG + Intergenic
949289161 3:2443768-2443790 AAGCAGTGACCACTCCTCCTGGG + Intronic
950109835 3:10411981-10412003 AGACAGTGAGCAGCCTCCCAAGG - Intronic
957946581 3:87070736-87070758 AAGGACTGACCAGTCACCTAGGG + Intergenic
958660845 3:97064732-97064754 AAGCACTGACCAGTATCACTTGG - Intronic
962023502 3:131525017-131525039 AAAATGTGACCAGTTTCCCAAGG - Intergenic
962417578 3:135197152-135197174 AAGCTGTGACCAGTATCCCATGG + Intronic
964503014 3:157369227-157369249 GAGAAGTGGCCAGTCTCTCATGG - Intronic
965133038 3:164725974-164725996 AAGCTGTGACCAGTCCAACAGGG + Intergenic
967779456 3:193419591-193419613 AAGCAGTGCACTGCCTCCCAAGG + Intronic
967947821 3:194818096-194818118 AGGCAGAGCCCAGTCTCCCGGGG - Intergenic
968944139 4:3654773-3654795 AAGCAGTGAGCAACCACCCACGG - Intergenic
968993904 4:3933392-3933414 AAGCACTGACCAGAGGCCCAGGG - Intergenic
969488992 4:7488142-7488164 AACTAGTGACCAGTCTGCCATGG + Intronic
969596024 4:8149735-8149757 CAGCAGTCAACAGCCTCCCAAGG - Intronic
969630813 4:8334928-8334950 GAGCACTGACCACTCACCCAAGG - Intergenic
969658441 4:8511079-8511101 TTGGAGTAACCAGTCTCCCACGG - Intergenic
970383764 4:15535719-15535741 AAGCAGTTTACAGTCCCCCAAGG - Intronic
972074588 4:35070056-35070078 AAGCATTGACCAGTAACACAAGG + Intergenic
972957925 4:44415579-44415601 ATGCAGGGAGCAGTGTCCCAAGG - Intronic
974625920 4:64429084-64429106 ATGCAGAGAGCAGTGTCCCAAGG - Intergenic
975037495 4:69702419-69702441 ATGGCGTGACCATTCTCCCACGG + Intergenic
975867092 4:78735174-78735196 AAGGAGTTACCAAGCTCCCAAGG + Intergenic
977504750 4:97887885-97887907 ATGCAGGGAGCAGTTTCCCAAGG - Intronic
980065725 4:128186831-128186853 ATGCAGGGAGCAGTTTCCCAAGG - Intronic
981402886 4:144335035-144335057 AAGCATTGACTAGCTTCCCAAGG - Intergenic
982178388 4:152727958-152727980 AAGCAGGGTCCCATCTCCCATGG + Intronic
982206101 4:152998381-152998403 AAGCAGTGACCAGTGTCTAAAGG - Intergenic
985368617 4:189260934-189260956 ATGCAGGGAGCAGTGTCCCAAGG + Intergenic
985521868 5:377580-377602 CAGCAGCCACTAGTCTCCCATGG + Intronic
985868506 5:2535288-2535310 AAGGAGTAAACAGTCTCCAAAGG + Intergenic
986660129 5:10052051-10052073 AAGCAGGGAGTAGTGTCCCAAGG + Intergenic
987684971 5:21185014-21185036 AAGCAGAGACCCATCTCCTAGGG + Intergenic
993480124 5:88414566-88414588 AAACATTGCCCACTCTCCCAGGG - Intergenic
995400923 5:111740635-111740657 ATTCAGAGACCAGTCCCCCAAGG + Intronic
995561322 5:113384811-113384833 AAACAGTGAGCACTCCCCCAGGG + Intronic
995915571 5:117241473-117241495 ATGCAGGGAGCAGTGTCCCAAGG - Intergenic
997578012 5:134997586-134997608 AAGCAGTGACAAGGATGCCAAGG - Intronic
999646212 5:153719376-153719398 AAGCAGAGACAAGTCATCCATGG - Intronic
999802832 5:155053665-155053687 AAGCAGGGACCTGTCTCCTTGGG + Intergenic
1001093150 5:168756364-168756386 AAGGAGGGACCAGGCCCCCAGGG + Intronic
1002392821 5:178929077-178929099 ATGCAGGGAGCAGTGTCCCAAGG + Intronic
1002534632 5:179869531-179869553 CAGCAGTGCCCGGTCACCCATGG + Intronic
1002912290 6:1499316-1499338 AAGGAGTGGCCAGCCCCCCATGG - Intergenic
1004000055 6:11589333-11589355 AGGAAGTGACCAGTTTCCAAGGG - Intergenic
1004021164 6:11776753-11776775 CAGAAGAGACCAGCCTCCCAGGG + Intronic
1004565184 6:16789437-16789459 ATGCAGGGACCAGTGTCCTAAGG + Intergenic
1004673830 6:17822661-17822683 AAGCAATGAGCTGTCTCCAATGG + Intronic
1004755172 6:18602603-18602625 AACCAGTTGCCTGTCTCCCAAGG - Intergenic
1004838113 6:19551132-19551154 AATCAGTGACTGGTGTCCCAGGG - Intergenic
1005091824 6:22064579-22064601 AAAAAGTGGCCAGTCTCTCAAGG + Intergenic
1006160692 6:32039127-32039149 GAGCAGGGAGTAGTCTCCCAAGG - Exonic
1011003263 6:82615383-82615405 AAGCAGTGACCAGAGTTTCATGG + Intergenic
1012718819 6:102714215-102714237 AAGCAGTGGCCCGTGTGCCAGGG + Intergenic
1017401837 6:154073532-154073554 AAGCAGTGAACAGTCTACCAGGG + Intronic
1018163286 6:161069153-161069175 AAGCACTGAGTAGTCTCTCAGGG - Intronic
1019042857 6:169120784-169120806 ATCCAGTGACCAGTGTCCCTGGG - Intergenic
1020411531 7:7896858-7896880 AAACAGTGAGTAGTCTCCTAGGG + Intronic
1027429487 7:78095569-78095591 AAGCAATCATAAGTCTCCCATGG + Intronic
1027623333 7:80519759-80519781 AAGCTGTGACCTGTCAGCCAAGG + Intronic
1028825284 7:95265409-95265431 AAGCTGGGACCAGAATCCCAAGG + Intronic
1032241531 7:130162979-130163001 AAGCAGTGAGCAGTCTGCACTGG + Intergenic
1035317266 7:158003973-158003995 AAACACTGGCCAGGCTCCCAAGG - Intronic
1035455064 7:159002841-159002863 TAGCAGTGACCAGCATCCCGTGG - Intergenic
1036826892 8:11983879-11983901 AAGAAGTACCCATTCTCCCATGG - Intronic
1039257845 8:35738732-35738754 AATCAGTGACCAGTCAAGCAGGG + Intronic
1039589799 8:38736783-38736805 AAGTAGTGACCAGTCTCTGGGGG + Intronic
1043254295 8:78113945-78113967 AAAAAGTGCCCTGTCTCCCATGG + Intergenic
1046314314 8:112479569-112479591 ATGCAGGGAGCAGCCTCCCAAGG - Intronic
1047403351 8:124564187-124564209 AAGCAGAAAACAGACTCCCATGG + Intronic
1048197583 8:132344959-132344981 ATAGAGTGACCAGTCTCTCAAGG + Intronic
1048710741 8:137207487-137207509 AAGGAGTGAGCATTCTTCCAGGG - Intergenic
1050718044 9:8552530-8552552 AAGCTGCGAGAAGTCTCCCAGGG - Intronic
1051357754 9:16255117-16255139 ACTCCCTGACCAGTCTCCCAGGG + Intronic
1052160000 9:25246281-25246303 CAGCTTTCACCAGTCTCCCAGGG + Intergenic
1052702204 9:31950859-31950881 ATGCAGGGACCAGTGTCCCAAGG + Intergenic
1053150256 9:35738716-35738738 ATGCAGTGGCCAGTGTGCCAGGG - Intronic
1056025257 9:82487923-82487945 ATGCAGTTAACAGCCTCCCAAGG - Intergenic
1056605022 9:88078417-88078439 AAGCAGTGAGCAGTTACACATGG + Intergenic
1057860408 9:98636407-98636429 AAGAAATGACCTGTCTCCAAGGG - Intronic
1057983133 9:99682070-99682092 ATGCAGGGAGCAGTGTCCCAAGG + Intergenic
1058400279 9:104609168-104609190 AACCAGTGACCAAAATCCCAGGG + Intergenic
1060639111 9:125223803-125223825 AAGGAGTCCCCAGTGTCCCAAGG - Intronic
1186511094 X:10130271-10130293 AAGCAGAGCCGAGGCTCCCAGGG + Intronic
1188377757 X:29453675-29453697 AAACAGTGAAGAGTCTCCGAAGG - Intronic
1191873314 X:65768978-65769000 ATGCAGGGAGCAGTGTCCCAAGG - Intergenic
1191894735 X:65980114-65980136 TGGAAGTGTCCAGTCTCCCAGGG + Intergenic
1193558434 X:82985362-82985384 ATGCAGGGAGCAGTGTCCCAAGG + Intergenic
1198807856 X:140507398-140507420 GAGCAGTGACTAGTTTCCCCTGG - Intergenic