ID: 921657836

View in Genome Browser
Species Human (GRCh38)
Location 1:217761979-217762001
Sequence GAGGTGGAACAGCATGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921657836_921657840 17 Left 921657836 1:217761979-217762001 CCGTCCTCATGCTGTTCCACCTC 0: 1
1: 0
2: 3
3: 52
4: 543
Right 921657840 1:217762019-217762041 TTCTGACCTCCTTCATGAAATGG 0: 1
1: 0
2: 3
3: 40
4: 515

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921657836 Original CRISPR GAGGTGGAACAGCATGAGGA CGG (reversed) Intronic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900048936 1:530428-530450 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900071167 1:772252-772274 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
900166094 1:1244908-1244930 GAGGGGGAAGAGGAGGAGGAGGG - Intronic
900345497 1:2208498-2208520 GAGGTGGACCCGCGTGCGGAAGG + Intronic
900634020 1:3652935-3652957 GAGAGGGGACAGCAGGAGGAGGG - Intronic
900696222 1:4012203-4012225 GAGGAGGAAAAGGAAGAGGAGGG - Intergenic
900867745 1:5280501-5280523 GAGGAGGACAAACATGAGGATGG + Intergenic
900892273 1:5458066-5458088 CAGGTGGAATAGCATGGTGAAGG + Intergenic
900951483 1:5860431-5860453 GACGGGGAACAGCAGGAGCAGGG + Intergenic
901409547 1:9072530-9072552 GACTTGGACCAGCATGGGGATGG + Intronic
901858353 1:12058507-12058529 GAGGTCACACAGCATGAGGGTGG - Intergenic
902519764 1:17009620-17009642 TAGGAGGATCAGCATGAGGCCGG - Intronic
903390826 1:22962665-22962687 CAGATGGAACAGCACGTGGAAGG - Intronic
904382932 1:30123853-30123875 GATGTGGCTCAGCATGAGGCAGG - Intergenic
904621301 1:31776902-31776924 GAGGGACAACAGCATGGGGAAGG + Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904855066 1:33491564-33491586 GAGATGGATGAGCAGGAGGAAGG + Exonic
905314423 1:37072634-37072656 GAGGTGGAACCACATCAGGGAGG + Intergenic
905319057 1:37102875-37102897 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
905581158 1:39083194-39083216 TACGTGGCACAGCATGAGGATGG - Intronic
906192104 1:43905241-43905263 GAAGAGGAACAGGAGGAGGAGGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906480326 1:46195237-46195259 GAGGTGGAGCAGAATAAGGGAGG - Intronic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907692150 1:56679830-56679852 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
908434028 1:64087288-64087310 GAGATTGACTAGCATGAGGAGGG + Intronic
908567119 1:65368684-65368706 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
909687438 1:78366319-78366341 GAGGTGGAACAGCTTTTGGTAGG - Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
910605803 1:89082704-89082726 GAGGTGGTAGAGCATGAAGAGGG + Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912866695 1:113264108-113264130 GAGGTGGAGCAGTATGGGGTGGG - Intergenic
912900906 1:113647258-113647280 GAGCAGGAACAGATTGAGGAAGG + Intronic
914686117 1:149981098-149981120 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
914900581 1:151709164-151709186 GGGGTGGAACAGGAAGGGGAAGG + Intronic
915257088 1:154641887-154641909 GAGGAGGAAGAGGGTGAGGAGGG - Intergenic
915584816 1:156838790-156838812 GATGTGGAAGAGCTTAAGGAAGG - Intronic
915686780 1:157642151-157642173 GAGGTGGAACATGAGAAGGAAGG - Intergenic
915694950 1:157730657-157730679 GATGTGGAACAGGAAGAGAATGG - Intergenic
915897941 1:159825847-159825869 GAAGAGAAACAGGATGAGGAGGG + Intergenic
915945064 1:160143823-160143845 GGGTGGGATCAGCATGAGGAAGG - Intergenic
915985547 1:160460678-160460700 GTGGGGGAAGATCATGAGGAAGG + Intergenic
916156097 1:161850264-161850286 GAGAGGGAACAGGATGAGGCTGG - Intronic
916423090 1:164654493-164654515 GAGGAGGAACAGGATCAAGAAGG + Intronic
916823350 1:168421766-168421788 GAGGTGGCTTTGCATGAGGATGG + Intergenic
916885338 1:169061878-169061900 GAGGAGGAAAAGGAAGAGGAGGG + Intergenic
917926223 1:179791270-179791292 GATGTGGTACGGCCTGAGGAGGG - Intronic
918389259 1:184040884-184040906 GTGCTGGAACAGTATGGGGAGGG - Intergenic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918668873 1:187187580-187187602 GAGGGGGGAAAGCAGGAGGAGGG + Intergenic
920070774 1:203301481-203301503 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
920540163 1:206772172-206772194 GAGGTGGAGGCGCAGGAGGAGGG + Intronic
921546546 1:216481435-216481457 GAGGTGGAATAGCAGGAGTCTGG - Intergenic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922001372 1:221481869-221481891 GAGGAGGAAGAGGAAGAGGAAGG - Intergenic
922494711 1:226047463-226047485 GAGGTGGGACGGCAAGAGGATGG - Intergenic
922658515 1:227407645-227407667 GAGGAGGAAAAGAAGGAGGAGGG + Intergenic
923769687 1:236927603-236927625 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
924025476 1:239828598-239828620 GAGGTGCAAAAGCCTGAGGTGGG + Intronic
924348712 1:243095267-243095289 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
924790058 1:247237747-247237769 GATGTGGAAAAGAAGGAGGAAGG + Intergenic
1064850824 10:19706968-19706990 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1064863461 10:19852586-19852608 GAGGTGGAACAGTATCACCATGG - Intronic
1064952856 10:20873469-20873491 GAGGAAGAACAGGAGGAGGAGGG + Intronic
1065023003 10:21516537-21516559 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1065794196 10:29291368-29291390 GAGGTGGAGGAGGAAGAGGAGGG + Intronic
1065948360 10:30627393-30627415 GAGGTGGAGGAGGAAGAGGAGGG - Intronic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066330885 10:34421076-34421098 GAGGTGGAACTGCTTGAGCCTGG + Intronic
1066340371 10:34526696-34526718 CTGGTGGCACAGCAGGAGGAGGG - Intronic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1066727648 10:38409636-38409658 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068435753 10:56989070-56989092 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1068913408 10:62403304-62403326 GAGGAGGAAGAGGAGGAGGAAGG + Intronic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1070799873 10:79239068-79239090 GAGGTTGACCAGGATGAGGGGGG + Intronic
1070927504 10:80235463-80235485 GATTTGGAAAAGCATCAGGAGGG + Intergenic
1071203811 10:83251727-83251749 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1071383999 10:85101426-85101448 GAGGAGGTAGAGCAAGAGGAAGG - Intergenic
1071692777 10:87839896-87839918 AAGGTGGAACAGGAATAGGAAGG - Intronic
1071877793 10:89861436-89861458 GAGGGGGAAGAGGAGGAGGAGGG - Intergenic
1071877800 10:89861454-89861476 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1073597728 10:104817419-104817441 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1074463539 10:113661468-113661490 GAGGTGGAGCAACATTAGGAAGG + Intronic
1075066500 10:119292249-119292271 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1076193807 10:128500731-128500753 GAGGGCGAACAGCCTGAGGAAGG + Intergenic
1076318900 10:129564261-129564283 GAGGGGGAAGAGGAGGAGGAAGG - Intronic
1076975280 11:167029-167051 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1078308012 11:10210377-10210399 GAGGAGGAAGAGAAGGAGGAAGG + Intronic
1078521816 11:12069558-12069580 GAGGTGGAGCAGCAAGAAGAGGG - Intergenic
1078851756 11:15170702-15170724 GAGGTGGAGGAGCTTGAGCATGG - Intronic
1079110515 11:17602660-17602682 GAGGAGGAGGAGCATGAGGAGGG - Intronic
1079361507 11:19774059-19774081 AAGGTGGAATAGCATGTGCAAGG - Intronic
1079976471 11:27097920-27097942 GAGTTGGATTAGCTTGAGGATGG - Intronic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1080293851 11:30702630-30702652 GAAGTGGAGCAGCAGCAGGATGG + Intergenic
1080612925 11:33920619-33920641 GAAGAGGAGCAGCATGAGGTTGG + Intergenic
1081093281 11:38899860-38899882 GAGGTGGAGGAGGAGGAGGAAGG + Intergenic
1081700585 11:45150138-45150160 CAGAAGGAACAGCATGAGGAAGG - Intronic
1081809187 11:45905789-45905811 GATGTGGCACTGCTTGAGGAGGG + Exonic
1081981259 11:47268761-47268783 GAAGTGGAACAGACTGAGAAGGG + Exonic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1082950078 11:58805326-58805348 GAGGTAAAACTGCATGAGGAGGG - Intergenic
1083010663 11:59395269-59395291 GAGGAGGAAGAGTAAGAGGAGGG - Intergenic
1083050085 11:59769274-59769296 GAGGAGGAGGAGGATGAGGATGG + Intronic
1083734374 11:64671181-64671203 GGGGTGGAGTAGCAGGAGGAAGG + Intronic
1083799562 11:65038670-65038692 GAGGAGGAAGAGGATGGGGAAGG + Exonic
1083848841 11:65353838-65353860 TCAGTGGAAAAGCATGAGGACGG - Intergenic
1083966907 11:66048890-66048912 GTGGTTGGAAAGCATGAGGAGGG - Intronic
1084013284 11:66364344-66364366 CACGTGGCACAGCATGAAGAGGG + Exonic
1084380674 11:68810562-68810584 GAGAAGGAACAGGATGTGGAGGG + Intronic
1084859528 11:72009217-72009239 GAGGTTGAAGGGCAGGAGGAAGG + Intronic
1084953580 11:72679749-72679771 GAGGTGGAAGAGTATGAAGAGGG - Intergenic
1084960976 11:72716489-72716511 GTGGAGGAACAGCATCTGGACGG + Intronic
1085036614 11:73304464-73304486 GTGGTGGGACAGCAGGAGGATGG + Intergenic
1086193739 11:84111782-84111804 CATGGGGAACAGCATGAGTACGG + Intronic
1087239959 11:95763570-95763592 GAGGTGGAACAGCAGTGAGAAGG - Intergenic
1088107506 11:106223465-106223487 GAGGAGGAATAACATGAGCAGGG - Intergenic
1090028605 11:123188405-123188427 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1090249425 11:125241041-125241063 GAGGTGGTCCAGCATGGGGATGG - Intronic
1090355501 11:126137831-126137853 GAGGTGAAACAGGATGCAGAGGG + Intergenic
1091042238 11:132292493-132292515 AAGTTGGAAGAGCATGAAGAAGG + Intronic
1091687355 12:2572826-2572848 GAGGAGGAAGAGAAGGAGGAGGG - Intronic
1091716165 12:2777645-2777667 TAGAGGGAACAGCATGAGCATGG - Intergenic
1091842061 12:3628359-3628381 GAGGAGGAATAGGAGGAGGAGGG + Intronic
1091854533 12:3728742-3728764 GAGGTGGAGCAGCAAAGGGAGGG + Intronic
1092210670 12:6644392-6644414 GAAGAGGAACAGGAAGAGGAGGG - Exonic
1092217527 12:6693706-6693728 GAGGAGGCACAGGATGAGGTGGG - Intergenic
1092333453 12:7606706-7606728 GAGGTGGAGGAGGCTGAGGAAGG + Intergenic
1093471363 12:19505567-19505589 GAGGTGTAACATCTTGAGGTGGG + Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093682584 12:22019788-22019810 GAGGAGGAACAGGAAGAGAAAGG - Intergenic
1096040927 12:48516750-48516772 GAGGAGGAATAGGAAGAGGAGGG - Intronic
1096066488 12:48744762-48744784 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1096178155 12:49536678-49536700 GAGGTGGAGGAGGAGGAGGAGGG - Intergenic
1096278337 12:50229981-50230003 GCTGTGGAACAGCATGAGGCAGG - Intronic
1096594999 12:52689433-52689455 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1097384640 12:58934754-58934776 GAGTGGGAAGAGCAGGAGGAGGG - Intergenic
1098442005 12:70528865-70528887 AAGGTGCAAAAGCAGGAGGAAGG + Intronic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1099042291 12:77670868-77670890 GAAGTGGAACAAGACGAGGATGG + Intergenic
1099438614 12:82672960-82672982 GAGGAGGAAGAGCAGGAAGAGGG - Intergenic
1101285630 12:103309263-103309285 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
1101563259 12:105880413-105880435 GGGGTGGAAAAGAATGAGCAAGG + Intergenic
1103963150 12:124621951-124621973 GGGGTGGAAGAGACTGAGGAAGG - Intergenic
1104348796 12:128026902-128026924 CAGGTGGGACAGCGTGAGTAGGG - Intergenic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104644390 12:130486584-130486606 GAGATGGCACAGCTTGGGGAGGG - Intronic
1104774148 12:131382389-131382411 GAGGTGGCTCAGCACCAGGAGGG - Intergenic
1104774284 12:131382838-131382860 GAGGTGGCTCAGCACCAGGAGGG - Intergenic
1104774414 12:131383289-131383311 GAGGTGGCTCAGCACCAGGAGGG - Intergenic
1104928793 12:132327787-132327809 GAGGTGAATCCCCATGAGGAGGG - Intronic
1105001990 12:132696006-132696028 GAGGAAGAACAACATGAGGAAGG - Exonic
1106189746 13:27441080-27441102 GAGGAGGAGGAGCAAGAGGAGGG + Intronic
1106243086 13:27925474-27925496 GAGGAGGAAGAGGAAGAGGAGGG - Exonic
1107449450 13:40495452-40495474 GAGGAGGAGCAGGATAAGGATGG - Intergenic
1107772719 13:43806098-43806120 GAGGTGGAGTATCAAGAGGAAGG - Intergenic
1108593289 13:51929396-51929418 GAAGGGGAAGAGCATGAGGCTGG - Intergenic
1110268729 13:73569221-73569243 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1110758174 13:79200806-79200828 GAGGTGGAGGAGCAGGAGGCAGG - Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111245808 13:85538993-85539015 GAGATGGAACAGGAAGAGAAAGG + Intergenic
1113538963 13:111092070-111092092 GAGGAGGAACAGGAGGAGGTGGG + Intergenic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115650746 14:35401417-35401439 GAGGTGGAGCAGTGTGAGGGAGG - Intergenic
1116636190 14:47399259-47399281 GAGGAGGAACAGGACGAGGAAGG + Intronic
1117205235 14:53435616-53435638 GTGGTGGCACAGCATGAGCATGG + Intergenic
1117901837 14:60542563-60542585 GAGGTGGAAGCCCATGAGGCAGG + Intergenic
1118684092 14:68273570-68273592 GAGGTGGAACAGCAGGCTAACGG - Intronic
1118717889 14:68573278-68573300 GAGGGGGCACAGCAGGAGGTGGG - Intronic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1118979118 14:70701768-70701790 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1119268954 14:73284299-73284321 GAGGTGGGAGAGGATGGGGATGG + Exonic
1122284433 14:100642299-100642321 AAGGTGGAGGGGCATGAGGATGG + Intergenic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1124066917 15:26353460-26353482 CAGGTGGAACAGGCTGTGGAGGG + Intergenic
1124788391 15:32703265-32703287 GAAGTGGAGGAGCATGAGGCAGG + Intergenic
1126455340 15:48855467-48855489 GAGGTGGAACATTATTAGGTTGG + Intronic
1126479205 15:49099326-49099348 CAAGTGCAACAGCCTGAGGAGGG + Intergenic
1126532096 15:49721788-49721810 GAGAAGGAACAGTATGAGAAGGG - Intergenic
1127104453 15:55598067-55598089 GAAGTGGTACAGAATGAGGTTGG - Intergenic
1127299037 15:57634541-57634563 GAGGTGGGGCAGCAAGAGCAAGG + Intronic
1128466242 15:67914965-67914987 GAGGAGGAAAAGAATAAGGAGGG - Intergenic
1128617477 15:69121522-69121544 GAAGCGGAAGAGCATGAGGCAGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129117908 15:73375480-73375502 GAGGAGGAAAAGCGTGAGGAGGG + Intergenic
1129179889 15:73867442-73867464 GGGGAGGAAAAGCAGGAGGATGG - Intergenic
1129314438 15:74732688-74732710 GAGGAGGAAGAGAATGAGGCAGG - Intergenic
1130537486 15:84797790-84797812 GAGGTGGTGCTGCAAGAGGAGGG - Intronic
1130537908 15:84800027-84800049 GAGCTGGAAGGGCATTAGGAAGG + Intronic
1130538224 15:84802178-84802200 GAGGTGGCAGAGCCAGAGGAGGG + Exonic
1132699925 16:1217985-1218007 CACGCGGAACAGCGTGAGGAAGG - Exonic
1132715643 16:1288749-1288771 GAGGTTCTACAGCATGAAGAAGG - Intergenic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1133392405 16:5420937-5420959 GAGGAGGAAAAGCAGGAGGAAGG - Intergenic
1133398010 16:5464031-5464053 GTGATGGACCAGCAGGAGGAGGG + Intergenic
1134073228 16:11273417-11273439 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1134531559 16:14988343-14988365 GAGGTGGAAGAGGGTGATGAGGG + Intronic
1134822694 16:17259293-17259315 AAGCTGGAACAGCAGGAGAAAGG - Exonic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1136367790 16:29816808-29816830 GAGGTGGAGCTGCCTGCGGATGG + Exonic
1136602168 16:31299790-31299812 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1137257536 16:46789471-46789493 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1138554785 16:57764930-57764952 GAGGAGCCACAGCATGAGGGTGG + Intronic
1138966485 16:62090631-62090653 GATGTGGAGCAGAATGAGCAAGG - Intergenic
1139743746 16:69057865-69057887 GAGGTAGGGGAGCATGAGGAAGG - Intronic
1139957893 16:70701791-70701813 GAGGAGGGACAGCAAGAGGGAGG - Intronic
1140092539 16:71850175-71850197 TAGGTGGCACAGCATAGGGAAGG - Exonic
1141694159 16:85612075-85612097 GTGTTGGAAGAGGATGAGGAGGG + Intronic
1141916460 16:87100601-87100623 GAGGTGGCCCAGCAGGAAGAGGG + Intronic
1142116920 16:88362302-88362324 ATGGGTGAACAGCATGAGGATGG - Intergenic
1142145203 16:88489986-88490008 GAGGAGGGACAGCGTGGGGAGGG + Intronic
1142153159 16:88521545-88521567 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142153200 16:88521686-88521708 GAGAGGGAACAGCATGAGGGAGG - Intronic
1142444980 16:90130630-90130652 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1142462530 17:104836-104858 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1142763017 17:2052269-2052291 GAGCTGGACCAGGATGGGGAGGG + Intergenic
1143281831 17:5760286-5760308 GTGGTGGTACAGCAGGTGGAGGG - Intergenic
1143391340 17:6561002-6561024 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391355 17:6561063-6561085 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143391424 17:6561269-6561291 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1143471226 17:7177318-7177340 GAGGTGGCCCTGCAAGAGGAGGG + Exonic
1143483413 17:7239500-7239522 GAGGTGGAGGAGGAGGAGGAGGG - Exonic
1143511571 17:7398419-7398441 GCGGTGGAACAGCTGGAGGGTGG + Intronic
1143702571 17:8672203-8672225 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
1143965579 17:10754518-10754540 GAGGAGGGACAGCTTGAGAAAGG - Intergenic
1144727648 17:17509948-17509970 GAGGTAGGACAGGAAGAGGAAGG - Intronic
1144752977 17:17662843-17662865 GAGAAGGAACAGCAGGAGGAGGG - Intergenic
1146701247 17:34962056-34962078 GAGGAGGAAGAGGAGGAGGAAGG + Exonic
1147376821 17:40027404-40027426 CACATGGCACAGCATGAGGAAGG + Exonic
1147575133 17:41594612-41594634 GAGGAGGGAGAGCAGGAGGAAGG + Intergenic
1147666525 17:42152307-42152329 GGGGAGGAACAGCATCAGAAAGG + Intronic
1148180359 17:45600779-45600801 GATGTGGCACTGCTTGAGGAGGG - Intergenic
1148184775 17:45634182-45634204 CAGCTGGAACAGAATGAGCAGGG + Intergenic
1148268541 17:46245115-46245137 GATGTGGCACTGCTTGAGGAGGG + Intergenic
1148851369 17:50557049-50557071 GAGGTGGAAGAGAGGGAGGATGG + Intergenic
1149313419 17:55417981-55418003 GAGGTGGTATAGCCAGAGGATGG - Intronic
1149666070 17:58365389-58365411 GGCCTGGAAGAGCATGAGGAAGG + Intronic
1150005370 17:61465748-61465770 GAGATGGAACAGAGTGAGCAAGG - Intronic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150836185 17:68566028-68566050 GTGATGGAACAGCATGAGGTGGG - Intronic
1151145565 17:72037338-72037360 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
1153299454 18:3580544-3580566 GAGGTGGCAGAGCCAGAGGAGGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1154055260 18:11006706-11006728 GAAGAGGAAGAGCATGAGGGAGG - Intronic
1155185797 18:23385615-23385637 TGGGTGGAACATAATGAGGAAGG + Intronic
1155210504 18:23596487-23596509 GAAGTGAAACATAATGAGGAAGG - Intergenic
1155641077 18:28015960-28015982 GGGGTGGAGCAGCACGAGGTAGG - Intronic
1155777283 18:29780885-29780907 TTGGTAGAGCAGCATGAGGAAGG + Intergenic
1155783814 18:29873812-29873834 GAGGAGGAATAACATGAGTAAGG - Intergenic
1155958999 18:31978119-31978141 GAGGAGGAACAACGTGAGTAAGG + Intergenic
1156472876 18:37388476-37388498 GAGGAGGAAGAGGAGGAGGATGG - Intronic
1156850934 18:41725485-41725507 GAGGTGGTAAAGAATGAGGGCGG - Intergenic
1157398775 18:47368230-47368252 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1157798420 18:50597902-50597924 AAAGTGGCACAGCATTAGGAAGG + Intronic
1158163846 18:54517121-54517143 GAGATGAAACCACATGAGGAAGG + Intergenic
1158341149 18:56468029-56468051 CATGTTGAACAGCATGTGGAAGG + Intergenic
1158525505 18:58209349-58209371 GAGGTGGAGGAGGAGGAGGAGGG - Intronic
1160545535 18:79650812-79650834 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1160652237 19:237212-237234 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
1160819718 19:1052362-1052384 GAGGGGGAAGAGGAGGAGGAGGG + Intronic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1162428989 19:10615610-10615632 GAGGAGGAAGAGGAAGAGGAAGG + Intronic
1163197419 19:15732807-15732829 GAGGTGGACCAAGAGGAGGAGGG + Intergenic
1163690897 19:18737726-18737748 GAGGAGGAGCAGCAGCAGGAGGG - Intronic
1164188317 19:22892767-22892789 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1164194173 19:22939985-22940007 GAGGTGGCAGATCATGAGGTGGG + Intergenic
1165304276 19:34994162-34994184 GAGATGGAGCTGCATGAGGTGGG + Intergenic
1166541276 19:43607708-43607730 GAGGAGGAAGAGGAGGAGGAGGG - Exonic
1167367401 19:49061947-49061969 GAGGAGGAAAAGGAGGAGGATGG + Exonic
1167825403 19:51968282-51968304 GAGGTGGAACAACATGAAGAAGG + Intronic
1168053459 19:53847288-53847310 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
925093315 2:1172824-1172846 GTGGAGGGACAGCATCAGGAAGG - Intronic
925096367 2:1207573-1207595 GAGGTGGAGGAGAATGAGAAGGG + Intronic
925304721 2:2840006-2840028 GAGGGGGAACAGAAAGAGGGGGG + Intergenic
925400876 2:3571767-3571789 GTGGTGAAAAAGCATGAGGGAGG + Intergenic
925507437 2:4584164-4584186 GAGGTGGAGGAGCAGGAGGTGGG - Intergenic
925740626 2:7002781-7002803 GGTGTGGAACAGCCTGAGGCAGG + Intronic
926383555 2:12314585-12314607 GAGATGCAGCAGCAGGAGGAGGG - Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926772318 2:16389411-16389433 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
926843962 2:17113158-17113180 GAGGTGGAAAAGCATAGGGGAGG + Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
928334463 2:30384573-30384595 GAGGTGGAAGATGAAGAGGAGGG + Intergenic
928424381 2:31166045-31166067 GAGGAGGAGCAGCATGGGAAAGG - Intergenic
929151338 2:38751564-38751586 GGGGCGGGACAGCATGGGGAAGG - Intronic
931247782 2:60505678-60505700 GAGGTGGGAATGCATGTGGAGGG - Intronic
931402436 2:61943513-61943535 GAGGTCCAGCACCATGAGGAGGG + Intronic
931766021 2:65457219-65457241 GTGGTAGAACAGGATGGGGAAGG - Intergenic
932494718 2:72140652-72140674 GAGGTGCCTCAGCAGGAGGACGG - Intronic
932496646 2:72148850-72148872 GAGGGGGAAAAGCAGGAGGCAGG + Intergenic
932607343 2:73174336-73174358 TAGGTGGAACAGCGCGAGGCAGG - Intergenic
933946395 2:87289592-87289614 CACGTGGAACAGCAGGTGGAGGG - Intergenic
933981818 2:87556546-87556568 GAGCTGGGACAGGATGATGAGGG + Intergenic
934950090 2:98570288-98570310 GGGCTGGAACAGCATCTGGAGGG + Intronic
934991447 2:98924707-98924729 GAGGTGGAGGAGTAGGAGGAAGG - Intronic
935051833 2:99530879-99530901 GAGCTGGAGCAGCACAAGGAGGG - Intergenic
935192163 2:100786886-100786908 GGAGTGGAGCAGCATGAGGGTGG - Intergenic
935515239 2:104028216-104028238 GTGGTGGAATAGCCTGAGTAAGG - Intergenic
935711858 2:105906091-105906113 GAGAAGGAGCAGCATGAGAAAGG - Intergenic
936312020 2:111394271-111394293 GAGCTGGGACAGGATGATGAGGG - Intergenic
936333800 2:111571949-111571971 CACGTGGAACAGCAGGTGGAGGG + Intergenic
936954895 2:118013824-118013846 GAGGTGGATACGCCTGAGGAAGG + Intronic
937490247 2:122359518-122359540 GAGGAGGAAAAGGAGGAGGAAGG - Intergenic
938143103 2:128812417-128812439 GAGGAGGAAGGGCATGAGGATGG + Intergenic
938161931 2:128993665-128993687 AAGGTGGATGAGGATGAGGAAGG + Intergenic
939304200 2:140388744-140388766 GAGGGGGAACTGTATGAGTAAGG + Intronic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940971232 2:159899153-159899175 GAGTGGGAACAGACTGAGGATGG - Intronic
941303471 2:163831174-163831196 GAGGTGGAGCAACATGGGGGAGG - Intergenic
941324228 2:164093231-164093253 GAGGGGGAATAGCGTGAGTAAGG - Intergenic
941387817 2:164874643-164874665 GAGGTGGAAAAGGAAGAGAATGG + Intergenic
941680848 2:168397298-168397320 GAGGTGGAAGAGTAGGAGAAGGG - Intergenic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942070003 2:172307921-172307943 GAAGTGGAACAGGCAGAGGAAGG - Intergenic
942985412 2:182134778-182134800 GAGGAGGAGCAGCAGGATGAGGG + Intergenic
943009291 2:182427008-182427030 GAGCTTGACCAGCATGTGGAAGG - Intronic
943770843 2:191714601-191714623 GAGGAGGAACAGAATAAAGAAGG + Intergenic
945931495 2:215859881-215859903 AAGGTGGAAGAGCATGAAGCTGG + Intergenic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946934862 2:224709384-224709406 GAGCTGGAACAGCCTGAGAATGG - Intergenic
947038186 2:225884259-225884281 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
948618374 2:239216405-239216427 GAGGAGGAAGACGATGAGGAGGG + Intronic
1168955229 20:1829865-1829887 GAGGGGCGACAGCAAGAGGAAGG + Intergenic
1169417792 20:5432594-5432616 GAGGTGGACCAGCAGAAGGTGGG - Intergenic
1169451514 20:5716032-5716054 GAGGTGGAGGAGGAAGAGGAGGG + Intergenic
1170614826 20:17940057-17940079 CAGGAGGAACAGCATCAGGTGGG - Intergenic
1171163965 20:22954661-22954683 GAGCTGGGACTGAATGAGGAGGG + Intergenic
1171170953 20:23015042-23015064 GATGGGGAACACCATGAGCATGG + Intergenic
1171983074 20:31640510-31640532 GAGTGGGAACTGCATGGGGAAGG + Intronic
1172061448 20:32189905-32189927 GAGGTGGAGAAGCAGCAGGAGGG - Intergenic
1172187545 20:33040522-33040544 GAGGTGGAAGAACTTGAGAAGGG - Intronic
1172625294 20:36343191-36343213 GAATTGGAGCAGCATGTGGAAGG + Intronic
1172928629 20:38564869-38564891 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1173130708 20:40390643-40390665 GAACTGGAACCCCATGAGGATGG + Intergenic
1174287543 20:49483510-49483532 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1174639346 20:52029792-52029814 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1175381783 20:58568755-58568777 AGGGTGGGACTGCATGAGGAGGG - Intergenic
1175434204 20:58931184-58931206 GAGGTGGCACAGAGAGAGGAGGG + Intergenic
1175531123 20:59674754-59674776 GAGGGGGAACAGGAGAAGGAGGG - Intronic
1175611404 20:60354280-60354302 GAGTAAGAACAGCACGAGGATGG + Intergenic
1176037885 20:63049218-63049240 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1176037907 20:63049294-63049316 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1178412541 21:32377578-32377600 GTGGTGGAGCAGCATGAGAGTGG - Intronic
1178423920 21:32463861-32463883 GAGCTGGCACAGAAAGAGGATGG - Intronic
1179488590 21:41726512-41726534 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1181447029 22:22985021-22985043 GGTGTGGAACAGCATGAGGCAGG + Intergenic
1181539920 22:23567541-23567563 GAGGAGGGAGAGCAAGAGGAAGG + Intergenic
1181711845 22:24696136-24696158 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1182099529 22:27648180-27648202 GAGGGGGAAGAGCAAAAGGAAGG + Intergenic
1182127884 22:27829393-27829415 CTGAGGGAACAGCATGAGGAAGG + Intergenic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183043141 22:35198339-35198361 GAGGTGGAGGAGCAGAAGGAGGG - Intergenic
1183060643 22:35334518-35334540 ATGGTGGCACACCATGAGGAAGG + Intronic
1183317654 22:37145781-37145803 GAGATGGAAGAGCAGGAGGGAGG - Intronic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183986272 22:41572195-41572217 GAGTTGGAAGAGGATGGGGATGG - Intronic
1184193150 22:42908491-42908513 GAAGTGGAAAGGCAGGAGGAGGG + Intronic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
1184380816 22:44143878-44143900 GAGGGGGAAGAGAGTGAGGAAGG - Intronic
1184437229 22:44486596-44486618 GATGAAGAACAGGATGAGGAAGG + Intergenic
1184691079 22:46117549-46117571 GAGGTGGACCAGGAAGGGGAAGG + Intergenic
1185222087 22:49634209-49634231 GAGGTGGAAGTGCTGGAGGAGGG - Intronic
950467065 3:13161949-13161971 GTGGGGGAACAGCATGTGCAGGG - Intergenic
950606898 3:14089751-14089773 GACGTGGAAGAGAAGGAGGATGG + Intergenic
950977468 3:17263270-17263292 GAGGTAGAACAGCTTGAGTCTGG + Intronic
951008014 3:17641585-17641607 GAGGAGGAATAGGAGGAGGAAGG - Intronic
951705599 3:25541243-25541265 GAGGCTGAAGAGGATGAGGAGGG - Intronic
953367186 3:42354835-42354857 GAGGTGGGAGAGAAGGAGGAGGG - Intergenic
954419892 3:50413182-50413204 GTGGTGGTGGAGCATGAGGAGGG + Intronic
955840773 3:63110445-63110467 GAGGAGGAAGAGAAGGAGGAGGG + Intergenic
955940987 3:64146958-64146980 GAGGAGGAAGAGGAAGAGGAAGG - Exonic
956262682 3:67362257-67362279 GAGGGAGAACAGCATGTGCAAGG - Intronic
956290418 3:67654645-67654667 GAGGAGGAGCAGCGGGAGGAGGG + Intergenic
956705737 3:71997464-71997486 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
958033254 3:88139770-88139792 GAGGAGGAAGAGGATGAAGAAGG + Exonic
959032469 3:101315940-101315962 TAAGTGGAACAGAATGAAGAGGG + Intronic
960144987 3:114191465-114191487 GAGGTGGAACAAGGTGAGGCTGG + Intronic
960974951 3:123164440-123164462 GGGAGGGAGCAGCATGAGGAAGG - Intronic
961129492 3:124452664-124452686 TAGGTGGAGCCGCATGGGGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961313000 3:126015747-126015769 GAGATGGAAAAGCATGAGCAGGG - Intronic
963490807 3:145998115-145998137 GAGGAGGAAGAGGAAGAGGAGGG - Intergenic
964453945 3:156839994-156840016 GAGGAGGAAGAGGAAGAGGAGGG - Intronic
965333596 3:167407738-167407760 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
965617394 3:170608925-170608947 GAGGTGAAAGAGTAAGAGGAAGG - Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966413448 3:179666198-179666220 GCAAGGGAACAGCATGAGGATGG + Intronic
966508680 3:180736157-180736179 CAGGTGGTACAGCAAGAGGTAGG - Intronic
967066270 3:185919469-185919491 GAGGTGGAGGAGGAGGAGGATGG - Exonic
967314314 3:188136750-188136772 GAGGTGGAAAAGCGTGAGGTAGG + Intergenic
968365596 3:198182760-198182782 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968963694 4:3758683-3758705 GAGGGGGAAGAGGAAGAGGAGGG + Intergenic
969298164 4:6281584-6281606 GTGGTGGCACAGCCTGAGGTAGG + Intronic
969580761 4:8063529-8063551 GAGGTGGAAGAGCTTGAGCAAGG + Intronic
970518745 4:16861795-16861817 CAGGGGGAACAGCATGTGCAAGG - Intronic
971020401 4:22529526-22529548 GAGAGGGAACAGCTTGTGGAAGG + Intergenic
971259447 4:25043111-25043133 GAGAAGGAACAGGCTGAGGATGG + Intergenic
971420247 4:26467875-26467897 GAGGAGGAAGAGGAGGAGGAGGG + Intergenic
973014367 4:45119042-45119064 CAGGAGGAACAGCATGAGGGAGG + Intergenic
974112201 4:57538051-57538073 GAGGAGGATCAGGAGGAGGAGGG - Intergenic
975362350 4:73485675-73485697 GAGGTGGAAGAGAAGGAGGGGGG + Intronic
976231199 4:82845106-82845128 GGGGTGAAAGAGCTTGAGGAAGG + Intronic
976361776 4:84187551-84187573 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
976786107 4:88823365-88823387 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
976947196 4:90784966-90784988 GAGGAGGAACAGGAAGATGAAGG + Intronic
976964433 4:91018714-91018736 GAGGGGGTTCAGCATGAGAAAGG - Intronic
977163171 4:93662024-93662046 TAGCTGGAACAGAATGAGCAAGG - Intronic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978349319 4:107804790-107804812 TCGGTGGAACAGAATGAGCAAGG + Intergenic
979254630 4:118597927-118597949 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
979334331 4:119448104-119448126 GAGGGGGAGCAGCATGAGCCAGG + Intergenic
980092963 4:128461420-128461442 GAGATGGAACAGCAAGGGCAAGG - Intergenic
980712476 4:136588803-136588825 GAGGAGGAACAGGAGCAGGAAGG + Intergenic
981093495 4:140756380-140756402 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
982284820 4:153724133-153724155 GAGAAGGAAAAGGATGAGGATGG + Intronic
982334068 4:154214448-154214470 AAGGTCTAACAGCATGAGGGTGG + Intergenic
983264606 4:165494850-165494872 GAGGTTGAACAGGATGTGTAGGG + Intronic
983640390 4:169939776-169939798 GAGGAGGAAGAGGAAGAGGAGGG + Intergenic
984866042 4:184281597-184281619 GAGCTGGAACAGCAGCAGGTAGG + Intergenic
984979715 4:185267993-185268015 GAGGAGGAAGAGAATGAGGAGGG + Intronic
985155671 4:186984842-186984864 GAGGTGAAACAGGACGAGGGAGG - Intergenic
986094476 5:4541070-4541092 GAGGAAGAACAGCATGTAGAAGG - Intergenic
986614995 5:9606825-9606847 GAGAAGGATCAGCCTGAGGAAGG + Intergenic
987032882 5:13991587-13991609 GAGGGGGAAGAGGAGGAGGAAGG + Intergenic
987286547 5:16463640-16463662 GAGGAGGAAGAGGCTGAGGAAGG - Exonic
988292650 5:29309338-29309360 GATGTGAAACAGAATGATGATGG - Intergenic
988710642 5:33770838-33770860 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
989092968 5:37753859-37753881 GAAGGGGAATAGGATGAGGATGG - Intergenic
989634626 5:43521054-43521076 GAGGAGGAACAGCATGAAGATGG + Intergenic
989711942 5:44409105-44409127 TAGCTGGAACAGAATGAGCAAGG + Intergenic
989756209 5:44958726-44958748 GAGGAGGAACAAGAAGAGGAAGG - Intergenic
992219572 5:74558346-74558368 GAAGAGGAAGAGCAGGAGGAGGG + Intergenic
992950261 5:81851310-81851332 GAGGTGGATCAGAGGGAGGAAGG + Intergenic
993252062 5:85540177-85540199 GAGGTGGGAGTGCAGGAGGAAGG + Intergenic
993622588 5:90186285-90186307 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
993813154 5:92508637-92508659 CAGGAGCAAGAGCATGAGGAGGG - Intergenic
995392850 5:111658221-111658243 GTGTTTGAACAGCATGAGAAAGG - Intergenic
995404319 5:111777010-111777032 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
995933015 5:117473600-117473622 GATGTGGAACAGCAGGAGATGGG - Intergenic
998163640 5:139827974-139827996 GAGGTGGAAGAGCAGGAGATGGG + Intronic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
998703581 5:144732704-144732726 GAGCTGGAACAGATTTAGGATGG - Intergenic
999081841 5:148851694-148851716 GAGCTGGAGAATCATGAGGAAGG + Intergenic
1000247167 5:159458336-159458358 GAGGTGACACAGCAACAGGAGGG - Intergenic
1001079097 5:168653858-168653880 GGGGTGGAGTAGGATGAGGAAGG - Intergenic
1002061893 5:176630236-176630258 GATGGGGAACGGGATGAGGATGG - Intronic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1003001398 6:2338009-2338031 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1003137659 6:3445731-3445753 CAAGTGGAATAGCATGAGCAAGG + Intronic
1003313288 6:4987558-4987580 GTGGTGGAGCAGGATGTGGAGGG - Intergenic
1003427846 6:6009120-6009142 CAGGTGGATAAGCAGGAGGAAGG - Intergenic
1003567596 6:7233808-7233830 GAGGTGGAACAGCAGGAGGGAGG + Intronic
1004334271 6:14750070-14750092 GAGCAGGAAGAGCATGAGGAAGG - Intergenic
1006031399 6:31179237-31179259 GAGGTGGAACTGCAGGAGTATGG - Intronic
1006094073 6:31644900-31644922 GAGCAGGATCAGCATGATGAGGG - Intronic
1006605455 6:35253361-35253383 GAGGTGGGACATCCTGAGTAGGG - Intergenic
1006787163 6:36676295-36676317 GCGGTGGAGCAGCATGGGGTAGG - Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1006899246 6:37489571-37489593 AAGGTGGAACAGCCTGGGGGCGG + Intronic
1007060873 6:38939891-38939913 GAAATGGAACAGCATGAGAAAGG + Intronic
1007405133 6:41631072-41631094 GAGATGGGAAGGCATGAGGAAGG + Intergenic
1007482333 6:42158348-42158370 GAGGTGGAAGAGGAGGAAGAGGG - Intronic
1008125736 6:47666141-47666163 GAGGAGGAATAGGAGGAGGAGGG - Intronic
1008759169 6:54833473-54833495 GAGGGGGAAAAGGAGGAGGAGGG + Intergenic
1009677045 6:66838952-66838974 GAGACGGAATAGCACGAGGAGGG + Intergenic
1010739912 6:79489083-79489105 GAGGTTGAAAAGCTGGAGGATGG - Exonic
1012815687 6:104019073-104019095 GAGGTGGAACAGTTAGAGGTGGG + Intergenic
1014553358 6:122814710-122814732 GGGGTGGGACAGAATGAAGAGGG - Intergenic
1015113359 6:129619268-129619290 GAGGGGGAAAAGAAAGAGGAGGG + Intronic
1015218523 6:130777859-130777881 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1015944284 6:138484056-138484078 TAGGTGGAACAGAATGAATAAGG + Intronic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016318457 6:142816231-142816253 GAGGTGGAAATGCCTGAGCAAGG + Intronic
1017037584 6:150280367-150280389 GTGGAGGAAGAGCAGGAGGAAGG - Intergenic
1017168953 6:151437798-151437820 GCTGTGGAACAGATTGAGGAAGG - Intronic
1017180517 6:151547525-151547547 GAGAGGGAACAGCATGAGTTGGG + Intronic
1018604238 6:165579979-165580001 GATGTAGAACAGAGTGAGGAGGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018919504 6:168161515-168161537 GGGGAGGAGCAGCATGGGGAGGG - Intergenic
1019562626 7:1666045-1666067 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1019854118 7:3587000-3587022 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
1019901499 7:4024585-4024607 GACGTGGCACAGCATGGTGAAGG - Intronic
1020212476 7:6166858-6166880 GAGGAGGAACAGCTGGAGGCTGG - Intronic
1021622452 7:22562230-22562252 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1021759106 7:23886032-23886054 CAGGAGGAACAGCAAGTGGAAGG + Intergenic
1022089321 7:27097213-27097235 GACGTGCAGCAGAATGAGGAAGG - Intergenic
1022144625 7:27524685-27524707 GAAGTGGCACAGAATGAGGGTGG - Intergenic
1022812902 7:33886612-33886634 GGGGTGGAACAGGACAAGGAAGG + Intergenic
1022871840 7:34487988-34488010 AAGGTGGCACAGCATGAACATGG - Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1024619210 7:51143021-51143043 GAGGAGGAAAAGTAAGAGGAAGG + Intronic
1025835049 7:65086051-65086073 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1025904822 7:65775530-65775552 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1026389004 7:69880721-69880743 GAGGTGGGAGAGAAAGAGGAAGG - Intronic
1027360088 7:77399562-77399584 GAGGTAGAAGAGGGTGAGGAAGG + Intronic
1027542987 7:79491812-79491834 GAGGTGGAAAAGGTGGAGGAAGG + Intergenic
1027589920 7:80105690-80105712 GAGGAGGAAGAGGAAGAGGAAGG + Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1029473666 7:100770070-100770092 CAGATGGAAAAGCATGAGGAAGG + Intronic
1031780785 7:125961461-125961483 CTGATGGAACAGCAGGAGGAGGG - Intergenic
1032309798 7:130774475-130774497 GAGGAGGAAGAGGAGGAGGAGGG - Intergenic
1032429117 7:131846550-131846572 GAGTAGGAACAGCAGGAAGATGG + Intergenic
1032523492 7:132562900-132562922 GAGGAGGAAGAGGAGGAGGAGGG - Intronic
1032523622 7:132563428-132563450 GAGGAGGAAGAGGAGGAGGAAGG - Intronic
1032704009 7:134406469-134406491 GAGGTGGCAGAGGATGAGGGGGG - Intergenic
1033263628 7:139865738-139865760 GAGGAGGAAGAGGAGGAGGAAGG + Intronic
1033285244 7:140035840-140035862 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1033832579 7:145271426-145271448 AAGGTGGAGGAGCAGGAGGAGGG + Intergenic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034300471 7:150010817-150010839 CAGATGGAACAGAATGAGAAAGG + Intergenic
1034546078 7:151790226-151790248 GAGCAGGAAGAGCAAGAGGAAGG - Intronic
1034805583 7:154086491-154086513 CAGATGGAACAGAATGAGAAAGG - Intronic
1035047242 7:155975684-155975706 GAGGTTGAGCAGCTTGGGGAGGG + Intergenic
1036277366 8:7367216-7367238 CAGGTAGAAGAGCATGAGCAGGG + Intronic
1036343964 8:7943119-7943141 CAGGTAGAAGAGCATGAGCAGGG - Intronic
1036589671 8:10157489-10157511 GGGGTGGAGGTGCATGAGGAGGG + Intronic
1036657934 8:10689987-10690009 GGGTTGGAACTGCACGAGGAAGG - Intronic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1036839306 8:12103886-12103908 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1036861095 8:12350129-12350151 CAGGTAGAAGAGCATGAGCAGGG - Intergenic
1037013408 8:13873404-13873426 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1037517970 8:19652695-19652717 TAAGTGGAACAGCAGGAGGTGGG - Intronic
1037969338 8:23160958-23160980 GGGGTGGAGCACCATGTGGAGGG - Intronic
1038208281 8:25490379-25490401 GAGGAGGAAAGGGATGAGGAGGG + Intronic
1038483687 8:27918965-27918987 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1039063734 8:33592133-33592155 GTGGTGGTACAGCATGAGGTAGG + Exonic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1040071962 8:43195738-43195760 GAGGAGGAAGAGGAGGAGGAGGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040704270 8:50106472-50106494 GAACTGGAACAAGATGAGGATGG - Intronic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1040852404 8:51914584-51914606 GAAGTGGAACAGGAAGGGGAAGG - Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1046344887 8:112910486-112910508 GAGGTGAAAGACCCTGAGGAAGG - Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047376993 8:124309004-124309026 GAGGTGGAGGAGGAAGAGGAAGG - Intergenic
1047701386 8:127452683-127452705 GAGGAGGAAAAGCAGGAGAAAGG + Intergenic
1048169860 8:132096005-132096027 GAGTTGCCACAGCTTGAGGATGG - Intronic
1048518911 8:135136098-135136120 GAGGAGGAAAAGGAAGAGGAGGG + Intergenic
1048911987 8:139144017-139144039 CAGATGGAACTGCATGAGGGAGG - Intergenic
1049647037 8:143740168-143740190 GAGGTGGAGCACCAGGAGGTGGG - Intergenic
1051158927 9:14183777-14183799 GAGGTGGAAGAGAATGAGGGAGG - Intronic
1051206364 9:14693287-14693309 GAGGTGGCGCGGCAGGAGGAGGG - Exonic
1051320120 9:15894286-15894308 GTGGGGGAAGAGCATCAGGAAGG + Intronic
1052446472 9:28567886-28567908 GAGTAAGAACTGCATGAGGAGGG - Intronic
1053037821 9:34840508-34840530 GAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1056775438 9:89508858-89508880 GAGGTGGACTAGCAGCAGGAAGG - Intergenic
1057303441 9:93899481-93899503 GAGGTGGCTCTGTATGAGGAGGG - Intergenic
1057457538 9:95228038-95228060 GGGGTGGAACAGCATGCAGAAGG - Intronic
1057480900 9:95444946-95444968 GATGTGGGAAAGCAGGAGGATGG - Exonic
1058505438 9:105661511-105661533 GAGCAGGAACAGAATGATGAAGG - Intergenic
1058822352 9:108744332-108744354 GAGGTGGCACGGGATGAGGGTGG + Intergenic
1058976377 9:110128701-110128723 GAGCTTTAACAGCCTGAGGATGG + Intronic
1059201418 9:112420618-112420640 GAAGTGCAACAGCATGACCATGG - Intronic
1059739974 9:117140635-117140657 GAGGAGGAAAAGGAGGAGGAGGG + Intronic
1059968999 9:119645194-119645216 GAGGAGGAAAAGGAGGAGGAGGG - Intergenic
1060821099 9:126661966-126661988 GAGGCGGAACTGCAGCAGGAAGG + Intronic
1060997199 9:127881433-127881455 GAGCTGGGAGAGAATGAGGAAGG + Intergenic
1061139184 9:128753857-128753879 GAGGTGGATCCGCGTGAGGCGGG + Exonic
1061193667 9:129096010-129096032 GAGGTGGAAGTGCATGGCGATGG + Exonic
1061848842 9:133403021-133403043 CCGGTGGGACAGCAGGAGGAGGG - Intronic
1062316603 9:135970444-135970466 GAGGAGGGACGGCATGAGGAGGG - Intergenic
1062749965 9:138245627-138245649 GAGGGGGAGCAGCATGAGCCAGG - Intergenic
1185714475 X:2330177-2330199 GAGGAGGAGAAGCAGGAGGAGGG + Intronic
1186239805 X:7554136-7554158 GAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1186313164 X:8342082-8342104 GAGGAGGAGAAGCAGGAGGAGGG - Intergenic
1187006495 X:15238034-15238056 GAGGTGGCACAGCATTAAGAGGG + Intronic
1187551331 X:20308877-20308899 GAGGAGGAAAAGGATGAAGATGG - Intergenic
1188291517 X:28394896-28394918 GATGTGGAACCACAAGAGGAAGG + Intergenic
1189063155 X:37776268-37776290 CAGGTGGAAAAGTATGAGAAAGG + Intronic
1189297409 X:39928866-39928888 GAGATCCAACAGCCTGAGGAAGG - Intergenic
1190108148 X:47573552-47573574 GAGGAGGAAAAGTATGAGGATGG + Intronic
1191715430 X:64190828-64190850 GATGTGGAACGGGATGGGGAAGG - Exonic
1195392403 X:104376362-104376384 GAGGTGGAGGAGGAAGAGGAGGG - Intergenic
1195396809 X:104419715-104419737 TTGGTGGTACAGCATGGGGAGGG + Intergenic
1195738009 X:108033424-108033446 TGGGTGCAGCAGCATGAGGAGGG - Intergenic
1197998862 X:132411189-132411211 GAGTTGGGACAGCATGAAGAAGG - Intronic
1198633142 X:138664875-138664897 AAGGTGGAAAAGGATGAGAAGGG - Intronic
1199708481 X:150451307-150451329 GAGGTGGAACTGCCCCAGGAAGG + Intronic
1199896898 X:152135442-152135464 GAGGAGGAAGAGGAGGAGGAGGG + Exonic
1201607118 Y:15799341-15799363 GATGTGGAAGAGGAGGAGGAAGG + Intergenic
1202362569 Y:24127488-24127510 GAGTTGGAGGAGCAAGAGGAAGG + Intergenic
1202508275 Y:25544505-25544527 GAGTTGGAGGAGCAAGAGGAAGG + Intergenic